ID: 922680889

View in Genome Browser
Species Human (GRCh38)
Location 1:227594659-227594681
Sequence CTTTATGTGCAAGATGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 6, 2: 44, 3: 57, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922680889 Original CRISPR CTTTATGTGCAAGATGTATA AGG (reversed) Intronic
901369909 1:8788126-8788148 CTGTATGTACAAGAAGTTTATGG + Intronic
902051874 1:13569809-13569831 GTTTATGTGCAAGGTGTGTAAGG + Intergenic
902115777 1:14119909-14119931 CTTTATGTGTACGATCTATTTGG + Intergenic
904570110 1:31457572-31457594 GTTTATATGCAAGGTGTGTAAGG - Intergenic
906506708 1:46385509-46385531 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
907295649 1:53450856-53450878 ATTAATGTACAAGATGTAAAAGG - Intergenic
908683492 1:66688751-66688773 ATTTATGTCCAAGATGAAAATGG - Intronic
909115733 1:71533505-71533527 GTATATGTGTGAGATGTATAGGG - Intronic
909575877 1:77175525-77175547 TTTTACATGCAAGGTGTATAAGG + Intronic
909645446 1:77911662-77911684 CTATATGTATAAGGTGTATATGG + Intronic
909680377 1:78285127-78285149 CGCTATGGGCAAGATGAATAGGG - Intergenic
909748233 1:79125893-79125915 CTTTATTTGCAAGATGAGAATGG + Intergenic
910348472 1:86268469-86268491 CTATATTTGCAAGAAATATATGG + Intergenic
910651334 1:89571447-89571469 CTTTTTGTGCCAGTTGTAAATGG + Intronic
910808191 1:91209586-91209608 GTTTGTGTGCAAGGTGTATAAGG - Intergenic
911095503 1:94051563-94051585 GGCTCTGTGCAAGATGTATATGG - Intronic
912979694 1:114360185-114360207 TTTTACATGCAAGATGTATAAGG + Intergenic
917311872 1:173687206-173687228 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
918391674 1:184070414-184070436 CTTTATGTGCATTATATATTGGG + Intronic
920389595 1:205591074-205591096 ACTTCTGTGCAAGATGTATCTGG - Intronic
921258984 1:213368874-213368896 TTTTATGTGCAAGATGAAGTAGG + Intergenic
921526491 1:216224453-216224475 CTTTATGTGTCAGAGGTAAATGG + Intronic
922680889 1:227594659-227594681 CTTTATGTGCAAGATGTATAAGG - Intronic
922999252 1:229992632-229992654 CTTTAAGTGCATGAAGTTTATGG + Intergenic
923016433 1:230130130-230130152 TTTCATGTGCAAGAGGTATTAGG - Intronic
923339420 1:232994998-232995020 CTTTATCTGCAAGATGAGGAGGG + Intronic
924399053 1:243658211-243658233 CTTAATATTCAAAATGTATAGGG + Intronic
924714845 1:246563766-246563788 CCTTATGAATAAGATGTATATGG + Intronic
924735440 1:246751531-246751553 GTTTATGTGCAAGGTGTGTAAGG - Intronic
1062869332 10:886073-886095 CTTAATATCCAAGATATATAAGG + Intronic
1064176558 10:13080462-13080484 GTTTATGTGCAAGATATGTAAGG + Intronic
1064904819 10:20334348-20334370 ATTTATGTGACAGATGTTTATGG + Intergenic
1065930898 10:30477920-30477942 GTTTATGTGCAAGGTGTATAAGG + Intergenic
1066482925 10:35814555-35814577 CTTTAAGAGCCAGATGTGTAAGG + Intergenic
1067561031 10:47304645-47304667 CCTTATATGTAAGATATATATGG + Intronic
1068675904 10:59769286-59769308 GTTTATGTGCAAGATGTATAAGG - Intergenic
1069769775 10:70890829-70890851 ATGTATGTGTAAGATGCATATGG - Intergenic
1069939137 10:71941933-71941955 GTTTATATGCAAGGTGTATGAGG + Intergenic
1071283229 10:84121940-84121962 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1072391880 10:94995686-94995708 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
1074056517 10:109927034-109927056 CTCTATGTGCAACATGTGAATGG + Intergenic
1074694661 10:116038964-116038986 CTTTATGTGTGAGATGAAGATGG + Intergenic
1074904484 10:117849426-117849448 ATTTATGAGGAAGATGCATAAGG + Intergenic
1075355566 10:121770841-121770863 TTTTATATGCAAGATGTTTTAGG - Intronic
1078751414 11:14168038-14168060 TTTTACGTACAAGGTGTATAGGG - Intronic
1079350556 11:19688236-19688258 CTTTATGTACAACAAATATAAGG - Intronic
1079891539 11:26061507-26061529 CTTTGAGTGCAAGTAGTATAAGG - Intergenic
1079935480 11:26610427-26610449 GTTTATGTGCAGAATATATAGGG - Intronic
1080207844 11:29751597-29751619 CTTTATCTCCAAGACATATAGGG + Intergenic
1080484706 11:32693472-32693494 CTTTCTATGCAAGAGGCATAAGG - Intronic
1081235275 11:40639743-40639765 CTGTATTTGCAACATGAATATGG + Intronic
1085239682 11:75042540-75042562 GTTTATGTGCAAGGTGTGTAAGG + Intergenic
1086255704 11:84873961-84873983 CTTTATATGCAAGATCAGTAAGG - Intronic
1086973567 11:93108774-93108796 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1086987367 11:93265056-93265078 GTTTATGTGCAAGGTGTGTAAGG + Intergenic
1087640146 11:100747726-100747748 GTTTATGTGCAAGGTGTGTAAGG - Intronic
1087664640 11:101030063-101030085 CTTTAGATTCAAGAAGTATATGG + Exonic
1087684412 11:101246941-101246963 CTTTATATGCAAGGTATATAAGG + Intergenic
1087894699 11:103574525-103574547 GTTTATGTGCAAGGTGTATAAGG + Intergenic
1090611251 11:128472873-128472895 TTAGATGTGCAAGATGTTTACGG - Intronic
1090701321 11:129298529-129298551 CTGAATCTGCAAGAAGTATAGGG - Intergenic
1090864046 11:130679939-130679961 CTTGATGTGCATGATTGATATGG - Intronic
1091814615 12:3427572-3427594 GTTTATGTGCAAGGTGTGTAAGG - Intronic
1093356636 12:18175146-18175168 GTTTATGTGCAAGGTGTGCAAGG + Intronic
1093594238 12:20942443-20942465 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1095680342 12:44967430-44967452 ACTTTTGTGCAAGAGGTATATGG + Intergenic
1096207610 12:49736253-49736275 GTTTATGTGCAAGGTGTATAAGG + Intronic
1103846229 12:123903590-123903612 ATTGATTTGCAAGATGTATGGGG - Intronic
1104232332 12:126897495-126897517 CTTTAATTGCAACATTTATAAGG - Intergenic
1105480948 13:20774753-20774775 CTGTATGTGCAAGATAATTAAGG - Intergenic
1105738763 13:23299887-23299909 GTTTATGTGCCAGATATAAAAGG + Intronic
1106471286 13:30057159-30057181 TTTTACATGCAAGGTGTATAAGG + Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1109812323 13:67529994-67530016 CTTAATATGCAAGATGTTGAAGG + Intergenic
1109909612 13:68892145-68892167 GTTTATGTGCAAGATGTGTAAGG - Intergenic
1109968038 13:69727280-69727302 CTCTATGTGCAAGATCTGTGTGG - Intronic
1110048903 13:70869460-70869482 CTTTATGTAAAAAATATATAAGG - Intergenic
1110648198 13:77914010-77914032 GTTTATCTGTAATATGTATATGG - Intronic
1111570816 13:90083037-90083059 TTTTATGTTCAAGGTTTATATGG - Intergenic
1112090812 13:96081445-96081467 CTTTTTGTGCATAAAGTATATGG + Intergenic
1113207559 13:107934652-107934674 CTTTAAATGCAAGATTTAGAAGG + Intergenic
1113700694 13:112385336-112385358 TTTTATATACAAGATGTGTAGGG - Intronic
1114236206 14:20826110-20826132 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
1115252000 14:31358736-31358758 ATTTATGAGAAAGATGTAGAGGG - Exonic
1115986340 14:39106524-39106546 CTATGTGTCCTAGATGTATAAGG - Intronic
1116251599 14:42491235-42491257 CATTATTTGCAAGATATAGAAGG - Intergenic
1116272922 14:42795454-42795476 ATTTTTGTGTAAGATGTGTAAGG + Intergenic
1116725753 14:48559877-48559899 GTTTATGTGCAAAGTGTGTAAGG + Intergenic
1117179652 14:53179139-53179161 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1117955303 14:61118621-61118643 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1122382611 14:101319916-101319938 GTTTATGTGCAAGGTGTGTAAGG + Intergenic
1124060471 15:26289366-26289388 CTCTATGTGCAAGCTGGAGAGGG + Intergenic
1124526186 15:30455483-30455505 CATTATATGGAAAATGTATAGGG + Intergenic
1126072658 15:44879115-44879137 TTTTACATGCAAGATGTGTAAGG - Intergenic
1127384750 15:58458367-58458389 CTTTAATTGCAAGAGGTAGAAGG - Intronic
1129222646 15:74140690-74140712 CTTTATGTTGGAAATGTATAAGG - Intergenic
1130792960 15:87175753-87175775 TTTTATATGCAAAATGTAAATGG + Intergenic
1133583825 16:7172333-7172355 CTTTATTAGGAAGATGTGTAGGG - Intronic
1139122565 16:64038129-64038151 CTATATGTGCAAGGGATATATGG - Intergenic
1139659084 16:68408704-68408726 ATTTATGTGCAAAATGTACCAGG - Intronic
1143243834 17:5466899-5466921 CTTTATGTGCAAGGTGTGTAAGG + Intronic
1144512972 17:15893390-15893412 ATTTATGTACAAGATTTATTGGG - Intergenic
1144618652 17:16800247-16800269 CTTTATGAGCATGAAGCATATGG + Intronic
1144894054 17:18515455-18515477 CTTTATGAGCATGAAGCATATGG - Intergenic
1146764050 17:35503090-35503112 AGTTTTGTGCAAGGTGTATAAGG + Intronic
1148367589 17:47068220-47068242 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1148829071 17:50417973-50417995 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1148837414 17:50472709-50472731 CTTAATTTCCAAAATGTATACGG + Intronic
1149771249 17:59323076-59323098 CTTAATGTGCAAGAAATATATGG - Intergenic
1150322654 17:64229089-64229111 CTTTTTGCACAAGATTTATATGG - Intronic
1153826486 18:8879983-8880005 GTTTATGTGCAAGGTGAATAAGG - Intergenic
1154014252 18:10602667-10602689 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1155746301 18:29359819-29359841 GTTTATGTGCAAGGTGTGCAAGG - Intergenic
1158626606 18:59077213-59077235 GTTTATGTGCATGCTGTATTAGG - Intergenic
1159101083 18:63960031-63960053 CTTTATTTGCAAATTATATATGG + Intronic
1162281789 19:9704264-9704286 GTTTATGTGCAAGGTGTATAAGG + Intergenic
1163867194 19:19783750-19783772 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1164121671 19:22271135-22271157 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1164130828 19:22360014-22360036 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1167828274 19:51995184-51995206 CTTTATGTGTAAGAGATAAAAGG - Intronic
1167906788 19:52667480-52667502 GTTTATGTGCAAGTTGTGTAAGG + Intronic
926491559 2:13531238-13531260 GTTTATGTACAAGATGTATAAGG - Intergenic
926503255 2:13680490-13680512 GTTTATATGCAAGGTGTGTAAGG + Intergenic
926664758 2:15509022-15509044 TTTTATATGCAAGATGTTTCAGG - Intronic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
930217213 2:48709105-48709127 AGCTATGTGCATGATGTATAGGG + Intronic
933222111 2:79702343-79702365 CTTTATTTTCATGTTGTATATGG + Intronic
935048247 2:99501089-99501111 GTTTATGTGCAAGGTATATAAGG + Intergenic
935721587 2:105984359-105984381 GTTTATGTGCAAGGTGTATAAGG - Intergenic
936716518 2:115193062-115193084 GTTTATTTGCAAGGTGTGTAAGG - Intronic
937820499 2:126304728-126304750 TATTATCTGCAAAATGTATATGG - Intergenic
938925884 2:136041966-136041988 GTTTCAGTGCAAGATGTAGAAGG + Intergenic
939678984 2:145107216-145107238 CTTTATGTGAAAGATACAAAGGG + Intergenic
940353118 2:152710662-152710684 CTTTATGTGGGAGATTTATGGGG + Intronic
943407994 2:187513017-187513039 GTTTATGTGCAAGGTGTATAAGG + Intronic
945483620 2:210369658-210369680 GTTTATGTGCAAGGCGTGTAAGG - Intergenic
945712033 2:213308988-213309010 CTGTGTGTACAAGGTGTATATGG - Intronic
946430625 2:219625384-219625406 CTTGGTGTGCAGGATGTACATGG + Intergenic
947154138 2:227144517-227144539 TTTTCTGTACAATATGTATATGG - Exonic
1171864091 20:30465254-30465276 CTTTTTGTGCAATCTGTAAAGGG - Intergenic
1171864119 20:30465767-30465789 CTTTTTGTACAATATGTAAAGGG - Intergenic
1171965326 20:31525456-31525478 CTTTACTTGCAAGATGGATATGG + Intronic
1174803324 20:53583675-53583697 CTGTATGTGCAAAATCTCTAAGG - Intronic
1176979542 21:15365022-15365044 CTATATGTGTAAGGTGTATATGG - Intergenic
1177162990 21:17568947-17568969 CTTTATATCCATGATCTATATGG - Exonic
1177261192 21:18732395-18732417 CTTTATCAGCAAGATGAAAACGG + Intergenic
1178023073 21:28432193-28432215 CTTTATTTGCAAGACATACATGG + Intergenic
1180561346 22:16616954-16616976 CTGTATGTGCAAAATCTCTAAGG + Intergenic
1182311761 22:29413980-29414002 GTTTATGTGCAAGGTGTATAAGG - Intronic
1182580173 22:31303622-31303644 CTTTATCTGTAAAATGGATAGGG + Intergenic
1182688512 22:32139344-32139366 GTTTATGTGCAAGGTATATAAGG + Intergenic
1182956205 22:34429026-34429048 CTTTATGTGAAAAATGAAAATGG + Intergenic
1183003777 22:34883264-34883286 CCTTATCTGTAAGATGTAGAAGG + Intergenic
1183325725 22:37192230-37192252 TTTTATATGCAAGGTGTGTAAGG - Intronic
1183534310 22:38388048-38388070 CTGTATGTGCAAAATCTCTAAGG - Intronic
1183610205 22:38896975-38896997 CGTTAAGTGAAAGATGAATAGGG - Intergenic
1184201531 22:42972559-42972581 CTTTTTTTCCTAGATGTATAAGG - Intronic
949610079 3:5695109-5695131 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
949611060 3:5704019-5704041 GTTTATGTGCAAGATGTATAAGG - Intergenic
950594500 3:13967110-13967132 GTTTATGTGCAAGATGTATAAGG - Intronic
950745493 3:15084759-15084781 TATTATGTGCAAGAAGTGTATGG - Exonic
951909897 3:27738819-27738841 CTTTATGTGTGAAATGAATAGGG + Intergenic
952807744 3:37373113-37373135 TTTTACATGCAAGGTGTATAAGG + Intergenic
952950122 3:38516171-38516193 ATTTATGTGGAATATATATATGG + Intronic
954543921 3:51416606-51416628 CTGTATGGGAAAAATGTATAAGG - Intronic
954604623 3:51899439-51899461 GTTTATGTGCAAGGTGTGTAAGG + Intronic
954821219 3:53329879-53329901 CTTTATGTGCATGTTAGATACGG - Intronic
955681923 3:61511020-61511042 CTTGCTGTTCAAGATTTATATGG + Intergenic
957724698 3:84048719-84048741 GTTTATATACAAGATGTGTAAGG + Intergenic
957743324 3:84304014-84304036 ATCTATGTGAAAGATTTATAGGG - Intergenic
958525354 3:95251743-95251765 CAGTATGTGTAAGATGTACATGG + Intergenic
960096266 3:113693095-113693117 ACTTACGTTCAAGATGTATATGG + Intronic
960239501 3:115323900-115323922 CATCATGTGCAGGAAGTATATGG - Intergenic
960589525 3:119352161-119352183 TTCTATGTACAAGATGAATAGGG + Intronic
960654465 3:119987374-119987396 GTTTATATGCAAGGTGTGTAAGG + Intronic
960720469 3:120620391-120620413 GTTTATGTGCAAGGTGTATAAGG - Intergenic
960789041 3:121406402-121406424 CTTTCTCTGCATGATGTAAAAGG + Intronic
962097267 3:132305130-132305152 GTTTATGTGCAAGGTGTATAAGG + Intergenic
962280031 3:134044744-134044766 CTTTATATGCAAGATAAATTTGG + Intronic
962962671 3:140325447-140325469 CTTTATGGGCAAGGTGTTTGGGG - Intronic
964007195 3:151845962-151845984 CTTATTGTGCAGGATGTTTAGGG - Intergenic
964071543 3:152639911-152639933 GTTTATTTGCAAGAAGTAAATGG + Intergenic
964933163 3:162050093-162050115 GTTTATGTGCAAGGTGTATAAGG - Intergenic
967622329 3:191649189-191649211 CTTTATCAGCAACATGAATATGG - Intergenic
970711993 4:18874907-18874929 TTTTATGTGCAAGGTGTGTAAGG - Intergenic
970793290 4:19885536-19885558 ATTTATGTGAAAGATTTATGTGG + Intergenic
970926019 4:21453313-21453335 CTTTATATGAAAGAGGTAGAAGG + Intronic
971727658 4:30334462-30334484 CATTATGTGCAGTATTTATAAGG - Intergenic
972784869 4:42317240-42317262 GTTTATGTGCAAGGCGTGTAAGG + Intergenic
972991437 4:44826158-44826180 GTTTATGTGCAAGGTGTATCAGG - Intergenic
975083869 4:70313124-70313146 CATTATGTGAAAGAAGTATATGG + Intergenic
975205546 4:71640730-71640752 GTTTATGGGCAAGGTGTATAAGG + Intergenic
977972270 4:103226169-103226191 GTTTATGTGCAAGGTGTATAAGG + Intergenic
978292505 4:107159913-107159935 CTGGATGTGTAAGATGTGTAAGG - Intronic
978314062 4:107416506-107416528 GTTTATGTGCAAGGTGTATAAGG + Intergenic
978705407 4:111703307-111703329 TGTTATGTGAAAAATGTATAAGG - Intergenic
979093243 4:116514994-116515016 TTTTAAGTGGAAGATGTGTACGG - Intergenic
979756304 4:124344190-124344212 TTTTATGTTTAAGATGTACATGG + Intergenic
980241286 4:130179500-130179522 CTGTATGTGCATAATGTATGTGG - Intergenic
980438912 4:132815988-132816010 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
981075055 4:140582401-140582423 CTTTGAGTGCAAAATGTTTAAGG - Intergenic
981146038 4:141325259-141325281 CTTAATGTGCATGAAGTATGAGG - Intergenic
983708271 4:170685099-170685121 GTTTATGTGCAAGGTGTACAAGG + Intergenic
984064515 4:175031756-175031778 CTTTATATGCAAAAACTATAAGG - Intergenic
987359799 5:17096476-17096498 TTTTATATGCAAGAAGTACATGG + Intronic
987930645 5:24396110-24396132 AGTTATGTGCAAGGTGTATAAGG - Intergenic
988640510 5:33036226-33036248 CTTTATCTCCAAGATTGATATGG + Intergenic
989096151 5:37783347-37783369 GTTTATGTGCAAGGTGTATAAGG - Intergenic
990744237 5:58942514-58942536 CTTTCTGTGCCTGATTTATAAGG - Intergenic
991009226 5:61865474-61865496 CTTTAATTACAAGATGTTTATGG - Intergenic
991305965 5:65176359-65176381 GTTTATGTGCAAGTTGTATAAGG + Intronic
993055297 5:82973482-82973504 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
993745393 5:91591158-91591180 TTTTATATGCAAGGTGTGTAAGG - Intergenic
995568478 5:113455897-113455919 CTTTATTTCCAAAATATATAGGG - Intronic
995867329 5:116705441-116705463 GTTTATGTGCAAGGTGTATAAGG + Intergenic
996057491 5:118997985-118998007 CTTTACATGCAAGATGTGTAAGG - Intergenic
996208377 5:120772852-120772874 CTTCATGTGAAAACTGTATATGG - Intergenic
998552597 5:143091981-143092003 GTTTATGTGCAAGGTGTATAAGG - Intronic
998938786 5:147258428-147258450 GTTTATGTGCAAGGTGTATAAGG - Intronic
999808328 5:155104746-155104768 CTTTATGTTCAAGATATGCATGG + Intergenic
1000236727 5:159368600-159368622 GTTTATGTGCATGGTGTATAAGG + Intergenic
1000616351 5:163432261-163432283 CTTTAAGTTCAAGATGTCTGAGG - Intergenic
1000926712 5:167203018-167203040 CTTTATAGGTAAGATGTGTATGG - Intergenic
1001558545 5:172653739-172653761 GTTTATGTGCAAGGTGTATAAGG - Intronic
1002999220 6:2315643-2315665 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1003728064 6:8789404-8789426 CTTTATTTGCAAGAGGTATTAGG + Intergenic
1005216841 6:23538980-23539002 AAGTATGTGCAAGATCTATATGG - Intergenic
1005461825 6:26076480-26076502 GTTTATGTGCAAGGTATGTAAGG + Intergenic
1006326097 6:33355192-33355214 ATTTATGTGCAAGATGTATAAGG - Intergenic
1006570634 6:35000733-35000755 GTTTATGTGCAAGGTGTATAAGG + Intronic
1008123374 6:47642918-47642940 GTTTATGTGCAGGGTGTATAAGG + Intergenic
1008365380 6:50673067-50673089 CTTTATGGGCTAGTTGCATAGGG + Intergenic
1008585620 6:52945941-52945963 CTTTATGCACCAGATGCATATGG + Intergenic
1009635661 6:66261434-66261456 GTTTATGTGCAAGGTGTATAAGG + Intergenic
1010949773 6:82021888-82021910 TTTTATATGCAACATGTAAAAGG + Intergenic
1011512261 6:88114178-88114200 CTTTGTGTGATATATGTATATGG + Intergenic
1011570266 6:88727227-88727249 GTGAATGTGCAAGGTGTATAAGG + Intronic
1012136543 6:95564254-95564276 CTTGATCTATAAGATGTATAAGG + Intergenic
1012890275 6:104889294-104889316 CTTTATGTGAAATATTTAGAAGG - Intergenic
1015358855 6:132313128-132313150 CTATATGTGCATGTTGTATGGGG + Intronic
1016930705 6:149405024-149405046 GTTTATATTCAAAATGTATAAGG + Intronic
1017195078 6:151691600-151691622 CTTTATGTGCCAGATCTAATAGG + Intronic
1017768164 6:157623847-157623869 CTTTATTTAAAAGATGTATTAGG - Intronic
1018138096 6:160797876-160797898 CTTTATGTTCAAGGTGTGTAAGG + Intergenic
1018191491 6:161313057-161313079 GTTTATGTGTAAGGTGTGTAAGG - Intergenic
1018487057 6:164251530-164251552 CTTTATATACTAGATGCATAGGG + Intergenic
1020057963 7:5131485-5131507 CTTTGTATGCAAGATGTAGCAGG - Intergenic
1020506398 7:8994263-8994285 CATTATATGCAAAAAGTATAGGG - Intergenic
1020655616 7:10925306-10925328 GTTTATGTGCAAAGTGTATAAGG + Intergenic
1022490090 7:30810358-30810380 GTTTATGTGCAAGGTGTACAAGG + Intronic
1023436454 7:40145253-40145275 GTTTATGTGCAAGGTGTGTAAGG - Intronic
1023798992 7:43816890-43816912 GTTTATGTGCAAGGTGTATAAGG + Intergenic
1023799390 7:43820545-43820567 GTTTATGTGCAAGGTGTGCAAGG + Intergenic
1025271006 7:57516650-57516672 TTTTATTTGAAAGATTTATAAGG + Intergenic
1027680118 7:81209648-81209670 GTTTATGTGTAAGAGGTATAAGG + Intergenic
1028333872 7:89627589-89627611 GTTTATGTGAAAGGTGTATAAGG + Intergenic
1028793654 7:94880426-94880448 GTTTATGTGCAAGGTGTGTAAGG + Intergenic
1028966066 7:96802623-96802645 CTTTATGCGCAAGTTGTACCAGG + Intergenic
1029795697 7:102892279-102892301 CTTTGTAGGCAAAATGTATAAGG - Intronic
1032170448 7:129579965-129579987 GTTTATATGCAAGGTGTATAAGG + Intergenic
1032347307 7:131128154-131128176 CTTTATGTTCAAGCTGCATATGG - Intronic
1032979574 7:137266375-137266397 GTTTATGTGCAAGGTGTATAAGG - Intronic
1033835648 7:145308070-145308092 GTTAATGTACAAAATGTATAAGG + Intergenic
1034250155 7:149683670-149683692 TTTTACATGCAAGGTGTATAAGG - Intergenic
1035380319 7:158435209-158435231 GTTAATGTCCAAAATGTATAAGG + Intronic
1036827968 8:11993526-11993548 GTTTATGTGAGAGATGTACAAGG + Exonic
1037186324 8:16067819-16067841 CTTCATTTGGAAGATATATAGGG + Intergenic
1038089554 8:24238050-24238072 GTTTATGTGCAAGGTGTATAAGG + Intergenic
1039140574 8:34383126-34383148 TTTTATATGCAAGATGTATAAGG - Intergenic
1039876880 8:41594381-41594403 GTTTATGTGCAAGGTATATTAGG - Intronic
1041226994 8:55710457-55710479 GTTTATGTGCAAGGTATATAAGG + Intronic
1041393666 8:57370079-57370101 TTTTACGTGCAAGGTGTGTAAGG + Intergenic
1042088031 8:65129950-65129972 GTTTATGTGCAAGGTATATAAGG - Intergenic
1042382877 8:68139170-68139192 AATTATGTGAAAGATATATAGGG + Intronic
1044184772 8:89238290-89238312 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
1044505654 8:93015640-93015662 CATTCTGTGCAAAATGTACATGG + Intronic
1046898514 8:119498925-119498947 ATATATGTGGAATATGTATATGG + Intergenic
1046898517 8:119498954-119498976 ATATATGTGGAATATGTATATGG + Intergenic
1046898520 8:119498983-119499005 ATATATGTGGAATATGTATATGG + Intergenic
1046898523 8:119499012-119499034 ATATATGTGGAATATGTATATGG + Intergenic
1046898526 8:119499041-119499063 ATATATGTGGAATATGTATATGG + Intergenic
1046898529 8:119499070-119499092 ATATATGTGGAATATGTATATGG + Intergenic
1046898532 8:119499099-119499121 ATATATGTGGAATATGTATATGG + Intergenic
1046898535 8:119499128-119499150 ATATATGTGGAATATGTATATGG + Intergenic
1047444776 8:124909919-124909941 GTTTATGTGCCAGATGTGTAAGG + Intergenic
1052507978 9:29379625-29379647 GTTTATATGCAAGGTGTATAAGG + Intergenic
1052663555 9:31467009-31467031 TTTTATGTGTAAGGTGTGTAAGG - Intergenic
1053110846 9:35458772-35458794 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
1054810308 9:69429041-69429063 CGTTATGTGCAGGTTGTACAGGG + Exonic
1055211552 9:73800982-73801004 ATTAATGTCCAAAATGTATAAGG + Intergenic
1056410284 9:86319236-86319258 CTTTACATACAAGCTGTATATGG + Intronic
1056414548 9:86363726-86363748 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1057174195 9:92983911-92983933 GTTTACATGCAAGATGTGTAGGG - Intronic
1057252806 9:93517503-93517525 CCTTATGTGCCAGATTTCTAAGG + Intronic
1057518635 9:95742388-95742410 CTTTGTGTGCCAGATGTAAAAGG + Intergenic
1058802336 9:108556861-108556883 TTTTATGTGCCAGCTGTAGAGGG - Intergenic
1059085252 9:111294438-111294460 ATTTATGTGCAAATTGTATTAGG - Intergenic
1188167743 X:26882808-26882830 GTTAATGTGCAAGGTGTGTAAGG - Intergenic
1188328851 X:28843471-28843493 CTATATGTGCAAGATGTCCAGGG + Intronic
1188433245 X:30130698-30130720 CTTTATCTGCAAGATATTTGGGG - Intergenic
1189034449 X:37481400-37481422 GTTTATGTGCAAGATGTATAAGG + Intronic
1189312313 X:40028350-40028372 CTTTCACTGAAAGATGTATAGGG + Intergenic
1189833982 X:45002603-45002625 GTTTATGTGCAAGGTTTGTAAGG - Intronic
1190270110 X:48856224-48856246 GTTTATGTGCAAGGTGTATAAGG + Intergenic
1190540919 X:51477829-51477851 CTTTATGTGCAAGGTGTATAAGG - Intergenic
1190771113 X:53515183-53515205 GTTTATGTGCAAGGTATATAAGG + Intergenic
1191918081 X:66223815-66223837 GTTTATGTGCAAGGTGTATAAGG - Intronic
1192399549 X:70821115-70821137 ATTAATGTGCAAGATATGTAAGG + Intronic
1192450353 X:71240880-71240902 ATTGATGTGAAAGATGGATATGG + Exonic
1193717232 X:84947192-84947214 GTTTATGTGCAAAGTGTATAAGG + Intergenic
1194051655 X:89077002-89077024 TTTTACATGCAAGATGTGTAAGG - Intergenic
1195508045 X:105681412-105681434 TTTTCTTTTCAAGATGTATAAGG - Intronic
1196162163 X:112497884-112497906 TTTTATATGCAAGGTGTGTAAGG - Intergenic
1196249583 X:113445018-113445040 CCCTTTGTGCAAGATGTTTACGG - Intergenic
1196396501 X:115268402-115268424 CTTTACGTACAGTATGTATAAGG - Intergenic
1196460195 X:115921706-115921728 GTTTATGTGCAAGGTGTATAAGG - Intergenic
1198681929 X:139192122-139192144 TTATATGTGGAAGATGAATAGGG + Intronic
1198855607 X:141012337-141012359 GTTTATGAGCAAGGTGTGTAAGG + Intergenic
1198876527 X:141233859-141233881 GTTTATGAGCAAGGTGTGTAAGG - Intergenic
1198907088 X:141575031-141575053 GTTTATGAGCAAGGTGTGTAAGG - Intergenic
1198909703 X:141599377-141599399 GTTTATGAGCAAGGTGTGTAAGG + Intronic
1198917383 X:141688769-141688791 GTTTATGAGCAAGGTGTGTAAGG - Intronic
1199278461 X:145972778-145972800 GTTTATGTGCAAGGTGTGCAAGG + Intergenic
1199637672 X:149828874-149828896 GTTTACGTGCAAAGTGTATAAGG + Intergenic
1200763387 Y:7060235-7060257 GTTTATGTGCAAAGTGTATAAGG - Intronic
1201260171 Y:12151328-12151350 GTTTATAAGCAAGGTGTATAAGG - Intergenic
1201900007 Y:19039319-19039341 GTTTATGTGCAAGATGTGTAAGG - Intergenic
1202086510 Y:21142408-21142430 GTTTATGTGCAAGGTGTGTAAGG - Intergenic
1202086597 Y:21143599-21143621 GTTTATGTGTAAGGTGTGTAAGG + Intergenic