ID: 922682760

View in Genome Browser
Species Human (GRCh38)
Location 1:227614502-227614524
Sequence TTTTTTATAAATAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 854}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922682760_922682763 0 Left 922682760 1:227614502-227614524 CCTTCTTCCCTATTTATAAAAAA 0: 1
1: 0
2: 6
3: 87
4: 854
Right 922682763 1:227614525-227614547 ATCACCTTTCTTCCAACAAATGG 0: 1
1: 0
2: 3
3: 23
4: 202
922682760_922682766 22 Left 922682760 1:227614502-227614524 CCTTCTTCCCTATTTATAAAAAA 0: 1
1: 0
2: 6
3: 87
4: 854
Right 922682766 1:227614547-227614569 GCAAAGCCTCCCTTCTAGATCGG 0: 1
1: 0
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922682760 Original CRISPR TTTTTTATAAATAGGGAAGA AGG (reversed) Intronic
900984242 1:6064399-6064421 CTTTTTATAAATAGGGAAGGGGG + Intronic
901501511 1:9655287-9655309 TGTTTCATAAATAGCGAAGGTGG + Intronic
901811623 1:11770118-11770140 TTTTTAAAAAAAAGGGAAAATGG + Intronic
901937991 1:12640582-12640604 ATTTTTCCAAATAGGGTAGATGG + Intergenic
902057459 1:13613884-13613906 TTTTTTTTAAAGAGAGAAAAGGG + Intronic
902695779 1:18139926-18139948 TTTTTTAAAAAAAAGGAAGTTGG - Intronic
903041150 1:20531660-20531682 TTTTTTAAAAAGAAGGCAGATGG + Intergenic
903044430 1:20554362-20554384 TTTTTTTTGCACAGGGAAGAAGG - Exonic
903752082 1:25630148-25630170 TATTTTTTAAATAGGGTAAAGGG - Intronic
904156622 1:28488618-28488640 TTTTTTGAAAATAGAGATGAGGG - Intronic
904173072 1:28605584-28605606 TCTATTACAAATAGGGAAAATGG + Intronic
904865193 1:33572868-33572890 TTTTTTTTAAGTTTGGAAGAAGG + Intronic
904925067 1:34041152-34041174 ATTTATTTAAATAAGGAAGAGGG + Intronic
905378395 1:37541206-37541228 TTTTTTTTAACTATGGAAGTAGG - Intronic
905780768 1:40707190-40707212 TTTTATATATATATGGTAGAAGG + Intronic
905889190 1:41509209-41509231 TTTTTTAAAAAGAGAGAGGATGG - Exonic
906013686 1:42553476-42553498 TTTTTTTTAAATGGAGAAAATGG - Intronic
906115958 1:43357530-43357552 TTTTTTCTGTAAAGGGAAGATGG + Intergenic
906340360 1:44974302-44974324 TTTTTTATATATAGAGAGAAAGG - Intronic
906812690 1:48845183-48845205 TTTTTTTCAGATAGGGAACAAGG + Intronic
906950443 1:50330969-50330991 TTTTTTATAGAGTGGGAAGACGG - Intergenic
906976716 1:50582225-50582247 TTTTTTTTAAATGGGAAAAAAGG - Intronic
907082213 1:51634204-51634226 TCTTTGCTAAATAGGGAAAAAGG + Intronic
907217946 1:52882191-52882213 TTATTTAGAAATAAGGAAGTTGG - Intronic
908162346 1:61422732-61422754 TTTTTTTTAAATAGAGACGGGGG - Intronic
908652480 1:66351050-66351072 TATTTTTTGAAAAGGGAAGAAGG - Intronic
908870331 1:68603276-68603298 TTTATAATAAAAAGGCAAGAAGG - Intergenic
908896187 1:68902827-68902849 TTTTATATAAAATAGGAAGATGG + Intergenic
909071858 1:71004292-71004314 GTTTGTATAAAATGGGAAGATGG - Intronic
909378496 1:74968611-74968633 CAGTTTATAAATAGGAAAGATGG - Intergenic
909546079 1:76848525-76848547 CTTTTTATAAAAATAGAAGAGGG - Intergenic
909754846 1:79212314-79212336 TTATTGATAAATAGTGCAGATGG + Intergenic
910163725 1:84300466-84300488 TTATTTTTAAAAAGGGAAGCAGG + Intronic
910404816 1:86876312-86876334 ATTTATAGAAACAGGGAAGATGG + Intronic
910467051 1:87511031-87511053 TTTTTTATTTTTAGTGAAGACGG - Intergenic
910538502 1:88327600-88327622 CTTTTTATAAAAAATGAAGAAGG - Intergenic
910675814 1:89815572-89815594 TTTTATTTAAATAGGGAAGGGGG + Intronic
910685800 1:89914746-89914768 TTTTTTACATATAGTGAAGATGG + Intronic
910866985 1:91797761-91797783 TTTTCTACCAAGAGGGAAGAAGG - Intronic
912105915 1:106275063-106275085 TTTGTTATTATTTGGGAAGATGG + Intergenic
912197769 1:107419609-107419631 TTTTTTTTGAAGAAGGAAGAAGG - Intronic
912263952 1:108136527-108136549 TTTTTTCACAAAAGGGAAGATGG - Exonic
912824059 1:112889288-112889310 CTTTTTAAAAATAGGGATGGGGG - Intergenic
912840681 1:113036551-113036573 TTTTTGATAAAGTGAGAAGAGGG + Intergenic
912986927 1:114443078-114443100 TTTTTTTTAAATAATGGAGATGG + Intronic
913023047 1:114805959-114805981 TTTTTAATAAATTGGAAAGTTGG + Intergenic
913358022 1:117945409-117945431 TTATGGATAAATGGGGAAGATGG - Intronic
916000688 1:160612396-160612418 TTTTTTTTAAGGTGGGAAGAGGG - Intronic
916093162 1:161325199-161325221 TTTTTTTAAAATAGAGATGAGGG - Intronic
916103614 1:161413666-161413688 TTTTTTTTTAATAGAGATGAGGG - Intergenic
916260475 1:162836881-162836903 TTTTCTATAAATGGGGAATAGGG + Intronic
916755358 1:167764129-167764151 TCTTTAAAAAATATGGAAGATGG + Intronic
917512189 1:175677872-175677894 TTTTTATTAAGTAGAGAAGAAGG + Intronic
918094569 1:181324089-181324111 ATTTTCAGAAAGAGGGAAGAGGG - Intergenic
918471906 1:184883977-184883999 ATTTTTTTAAATCAGGAAGAAGG + Intronic
918484427 1:185014441-185014463 TTTTTTTTAAATGGGTAAGAGGG - Intergenic
918610059 1:186479219-186479241 TTTTTTTTAAATAAAGAATACGG + Intergenic
918611396 1:186496505-186496527 TCTCTTATAAGCAGGGAAGATGG - Intergenic
918674489 1:187265808-187265830 TTTTTTTTAAATCTGGAAAATGG - Intergenic
919439781 1:197617522-197617544 ATTTTAATAAATAGTAAAGATGG - Intronic
919637733 1:200019471-200019493 TTTTTAAAAAATAGAGATGAGGG - Intergenic
919676276 1:200386531-200386553 ATTTTTATAAAAAGAGAAAAGGG + Intergenic
919720547 1:200829378-200829400 TTTTTTAAAAATAGAGATGGGGG - Intronic
919868392 1:201801491-201801513 ATTTTTTTAAATAGAGATGAGGG + Intronic
920433744 1:205935320-205935342 TTTTTTGTAAGGAGGGAACAGGG + Intronic
920893003 1:210011622-210011644 GTTTTTATAAATAATGAAAAAGG + Intronic
921522526 1:216174324-216174346 TTTTTTAAAAATTGGAAAAATGG + Intronic
922645289 1:227280429-227280451 TATTTTATAAAAATGGGAGATGG + Intronic
922682760 1:227614502-227614524 TTTTTTATAAATAGGGAAGAAGG - Intronic
923057509 1:230438153-230438175 TTTTTTTTATATAGAGAAGGGGG + Intergenic
923228332 1:231960421-231960443 TTTTTTATATTTAGTGGAGATGG + Intronic
923335108 1:232961667-232961689 TTTTATATAAATTTGGAATAGGG - Intronic
923590998 1:235319704-235319726 TTTTTTAAAAAAAGGGAGGACGG + Intronic
923786558 1:237073697-237073719 TTTTTTATTTTTAGTGAAGACGG - Intronic
924119100 1:240778458-240778480 TTTTTTCTTAATTGGGAAAAAGG + Intronic
924196614 1:241614467-241614489 TTTTTAAAAAATAGGGTACACGG + Intronic
924446794 1:244140341-244140363 TTGTTTACAAATAATGAAGAAGG - Intergenic
1063466955 10:6252845-6252867 TTTTTTAGAAGTAGGGGAGAGGG + Intergenic
1063729893 10:8684679-8684701 ATTTTTAAAAATAAGGAGGAGGG + Intergenic
1063898300 10:10705353-10705375 TTTTTTTTTAATAGGGAAGGAGG - Intergenic
1063937222 10:11090424-11090446 TTTTTTATTAATTGGGAGGAGGG - Intronic
1064042981 10:11984704-11984726 TTTTTTTTAAAGAGCAAAGATGG - Intronic
1064571467 10:16698012-16698034 TTTTTTTTACTTTGGGAAGAGGG + Intronic
1064700546 10:18015627-18015649 TTTTTTAAAAATAAAAAAGAAGG - Intronic
1064716545 10:18182336-18182358 TTTTTTTGAAATAAGGTAGAAGG + Intronic
1064860816 10:19823509-19823531 TTTTTTATTTTTAGGGAAGACGG - Intronic
1064936725 10:20686568-20686590 TTTTTTCCAAAGAAGGAAGAGGG + Intergenic
1065193850 10:23241673-23241695 TTTTTTTTAAAGAAGGAAGCAGG + Intergenic
1065376980 10:25053063-25053085 TTTTTTTTAAAGAGACAAGATGG - Intronic
1065432244 10:25671484-25671506 TTTTTTTTAATTAAGGAAGATGG - Intergenic
1065440917 10:25752644-25752666 TGTTTTATAATTTGGGAAAATGG + Intergenic
1065785671 10:29211749-29211771 CTTTTTACATATATGGAAGAGGG + Intergenic
1066613118 10:37270490-37270512 TTTTTTATTATCAGTGAAGAGGG - Intronic
1067087037 10:43248025-43248047 TTTTTTATAAATAGAAATGGGGG - Intronic
1067119568 10:43462774-43462796 TTTTTTATAAATAGAGATAGGGG + Intronic
1067165735 10:43865129-43865151 TTGTTTTTCAATAAGGAAGATGG - Intergenic
1068000956 10:51333601-51333623 TTTTGGATAAACAGGGAAAATGG - Intronic
1068130877 10:52893869-52893891 TCTTTTGGAAAAAGGGAAGAGGG + Intergenic
1068303015 10:55170303-55170325 TTTTTTTTAAATAGCCAATATGG - Intronic
1068598514 10:58930868-58930890 TTTTTTAGAAATGAGGCAGAAGG - Intergenic
1069024293 10:63522464-63522486 TTTTTTTTTAATCGGGGAGAGGG - Intronic
1069287700 10:66736553-66736575 TTATTAATAAACAGGTAAGATGG - Intronic
1070005982 10:72424488-72424510 TTTTTTGTAAATAGAGATGGGGG + Intronic
1070007004 10:72434159-72434181 ATTTTTCTAAGTAAGGAAGATGG - Intronic
1070493409 10:76998816-76998838 ATTTTTATAATTGGAGAAGAAGG + Intronic
1070502738 10:77086876-77086898 TATCTTATAAATATGGAAGCTGG + Intronic
1071275057 10:84046181-84046203 TATTTTATAAATATGGTGGAGGG + Intergenic
1071294719 10:84211403-84211425 TCCTTTATAAATGAGGAAGAGGG - Intronic
1071903657 10:90148194-90148216 TTTTTTTTCAAGAGGGCAGATGG + Intergenic
1071926026 10:90410074-90410096 TATTTTATAAATATTAAAGAGGG - Intergenic
1071940185 10:90582076-90582098 TTATTTATAATTAGCAAAGATGG - Intergenic
1073716076 10:106108877-106108899 CTCTTAATAAATAGGGAAGAGGG - Intergenic
1073842224 10:107510763-107510785 CTTTTTAAAAATAGAGAATAAGG - Intergenic
1074416321 10:113270011-113270033 TTTTTTTTAAAAAAGGAAGTTGG + Intergenic
1074502383 10:114038181-114038203 TTTTTTTTAAAAAAAGAAGAGGG + Intergenic
1074606092 10:114969129-114969151 TTTTTTTTAAATATGGAACACGG + Intronic
1074634389 10:115296576-115296598 AGTTTTATTAATGGGGAAGAGGG - Intronic
1075239317 10:120763892-120763914 TTTTATATAGACAGTGAAGAGGG + Intergenic
1075282191 10:121148847-121148869 TTTTTTAAAAGTAGGGATAAAGG + Intergenic
1075324702 10:121521802-121521824 TTTTAGATAAATAGAGAAGTGGG - Intronic
1075361798 10:121844258-121844280 ATTTTTAAAAATAAGGGAGAAGG + Intronic
1076331456 10:129673277-129673299 TTTTTTTTAAATTGGGATGTGGG - Intronic
1076552551 10:131292512-131292534 TTTTTTAAAAATAGAAAAAATGG - Intronic
1078222034 11:9359512-9359534 TCTTTTAAAAATATGGAAGTAGG - Intergenic
1078237104 11:9495602-9495624 TTACTGATAAATAGTGAAGATGG - Intronic
1078939917 11:15991050-15991072 TTTTTTCTAAACAGGAAGGAGGG + Intronic
1079199643 11:18365057-18365079 TCTTTTTTAAATAGTGGAGATGG - Intronic
1079422143 11:20303628-20303650 TGTTTTACAAACTGGGAAGAGGG - Intergenic
1079481603 11:20886581-20886603 TTTTTTAAAAATAAAAAAGAAGG - Intronic
1079749318 11:24176734-24176756 ATTTTTATAAATTGGTAATACGG - Intergenic
1079877908 11:25883581-25883603 TTTTTTATAAATAAATAAAATGG + Intergenic
1080063089 11:27978521-27978543 TTTTTTATAAGAAGAGTAGATGG - Intergenic
1080357503 11:31467790-31467812 TTTTTTTTACAAAGGGAACAAGG + Intronic
1080361102 11:31515238-31515260 TCTTTTACAAAAAGGTAAGAAGG - Intronic
1080471110 11:32546457-32546479 TTTTTTTTTAATAGGGATGGGGG + Intergenic
1080590764 11:33721502-33721524 TTTTTTATAAATATGGTTGGTGG - Intronic
1080868901 11:36219306-36219328 TTTTTTTTAAATAATGAACATGG + Intronic
1081289557 11:41307783-41307805 TGTTTTAAATAAAGGGAAGAAGG - Intronic
1081308230 11:41539678-41539700 TTTTTAAAAAATAGGAAAGAAGG + Intergenic
1081824640 11:46037327-46037349 TTTTTTATCAATAGGCCTGAAGG - Intronic
1082829448 11:57604636-57604658 TTTTTTTTAAAAAGGGAGGTGGG - Intronic
1084216019 11:67647270-67647292 TTTTTCCTAAATTGAGAAGAGGG + Intronic
1084851599 11:71945940-71945962 TTTTTTATTTTCAGGGAAGATGG - Intronic
1085592686 11:77778534-77778556 TTTTTCAGAAAGAGAGAAGAGGG - Intronic
1085656846 11:78323503-78323525 TTTTTTTTGAATTGGGGAGACGG - Intronic
1085715995 11:78873916-78873938 TTTTTTCTTAATAGAGAAGGTGG - Intronic
1086076026 11:82853615-82853637 TTATTTTTAAATAAGGACGAGGG + Intronic
1086179876 11:83937769-83937791 TTTTTTAAAAATAGGTAAAAGGG - Intronic
1086428896 11:86716316-86716338 GTTTATACAAAGAGGGAAGAGGG + Intergenic
1086546695 11:88004029-88004051 TTTTATATATATATGGGAGAAGG + Intergenic
1086908336 11:92442905-92442927 TATTTTAGAAATAGAAAAGAAGG - Intronic
1087642360 11:100768857-100768879 TTATATATAAAATGGGAAGATGG - Intronic
1088164044 11:106910420-106910442 TTTTTTGTAAACAGGAAAAAAGG + Intronic
1088209991 11:107444105-107444127 TTTTTTTTAAGGAGGGAAGGGGG + Intronic
1088381487 11:109198389-109198411 ATTTTTATATATGGGGAAGTAGG - Intergenic
1088601368 11:111479435-111479457 TTTTTTAAAAATAGAGAACAGGG - Intronic
1088766352 11:112983423-112983445 TTTTTTTTCAAGTGGGAAGAGGG + Intronic
1088936412 11:114404933-114404955 CCTTTAATAAATAGGGAATAAGG + Intronic
1089430389 11:118419241-118419263 TTTTTTTTAATGAGGGAAAATGG - Intronic
1089585119 11:119505641-119505663 TTTTTTAGAAATAGAGATGGGGG - Intergenic
1089804865 11:121076730-121076752 TTTTTCCTAAACAGGGAAAAAGG - Intronic
1090183783 11:124722771-124722793 TTTTTTAAACATGGGGAAGCTGG - Intergenic
1090188818 11:124754796-124754818 TTTTTTTTTAATGGGAAAGAGGG - Intronic
1090619325 11:128547789-128547811 TTTTTAAAAAATAGGGATGATGG + Intronic
1090683817 11:129092597-129092619 TTGTATATAAATAAGTAAGATGG - Intronic
1090763770 11:129859300-129859322 TTTTTTTTAAATCAGGAAGCTGG + Exonic
1090920193 11:131200114-131200136 TTTTTGAAAAAAAGGAAAGAAGG + Intergenic
1091390583 12:123843-123865 ATTTTTATAAATGAGGAACAGGG - Intronic
1091815707 12:3436137-3436159 TTTTTTATAAGCAGGTAAGCAGG - Intronic
1091853462 12:3719815-3719837 TTTTTTATAAAAATGGAAGGTGG + Intronic
1092373686 12:7937789-7937811 TACTTTATAAAAAGGGAAGAAGG - Intergenic
1092554827 12:9546645-9546667 TTATCTATAAATATGGAATATGG + Intergenic
1093194649 12:16115668-16115690 TTATTTCTAAATAAAGAAGAGGG + Intergenic
1093378535 12:18461103-18461125 TTTTATATATATAGTGAAAAAGG + Intronic
1093949569 12:25149406-25149428 TTTTTTAGAGATAGTAAAGATGG - Intronic
1094052208 12:26232921-26232943 TTTTTTTTTAATAGGGCACAAGG - Exonic
1094179995 12:27582351-27582373 TTTTTTAAGAAGAGGGGAGAGGG + Intronic
1094517279 12:31144020-31144042 TTATCTATAAATATGGAATATGG - Intergenic
1094577436 12:31700137-31700159 TTTTTTAAATATAAGAAAGAGGG - Intronic
1094680011 12:32659605-32659627 ATTTTTAAAAATGGGGATGAGGG - Intergenic
1094719243 12:33046057-33046079 TTCATTGTAAATAGGGAGGAAGG + Intergenic
1094725556 12:33111690-33111712 TTTTCTATAAATAGGGATCATGG + Intergenic
1095309862 12:40685829-40685851 GTTTTTATCTATAGGGTAGATGG + Intergenic
1095574662 12:43722684-43722706 TCTTTTCTAAAAAGGGAAGATGG - Intergenic
1095595862 12:43957435-43957457 TTATTTATATATAGGAATGAAGG + Intronic
1095866085 12:46973735-46973757 TTTTTTAAAAACAGGAAATAGGG - Intergenic
1096060706 12:48697130-48697152 CTTTTTTTAAAAAGGGAAGAAGG + Intronic
1096115935 12:49055057-49055079 TTTGTGTTAAATAGGGATGATGG - Intronic
1096834717 12:54342401-54342423 TTTATTATACAAGGGGAAGAAGG - Intronic
1096872929 12:54605505-54605527 TTTTTTTTAAATAAGGATGGGGG + Intergenic
1097687372 12:62703556-62703578 TTTGTTATAGAAAGGCAAGAAGG - Intronic
1097778390 12:63674448-63674470 TTTTTACTAAATGGGGAAAATGG - Intergenic
1098276480 12:68817189-68817211 TATTTTATAAATGGGGAAGCAGG - Intronic
1098716726 12:73836290-73836312 TTATTTAAAAATAAGGTAGATGG - Intergenic
1099022370 12:77422709-77422731 TTTTTTAAAATAAGGGAATAGGG + Intergenic
1099734322 12:86548867-86548889 TTATTTTTAAATATGTAAGAAGG + Intronic
1100142977 12:91641626-91641648 TTTTCTATAAATAGAAAAGGTGG - Intergenic
1100437248 12:94582987-94583009 TTTTTTTTAAAAAAGAAAGATGG + Intronic
1101144670 12:101830218-101830240 TTTTTTAAAAATAGAGACGGAGG - Intronic
1101320334 12:103668022-103668044 TTTTTTATAGATAAGGAAACAGG - Intronic
1101574691 12:105986641-105986663 TTTTTTTTAAATAGAAAAGAGGG - Intergenic
1101696440 12:107131746-107131768 TTTTTTACAAATATGGAATAAGG + Intergenic
1101918559 12:108914857-108914879 TTTTTTAACAAAAGGAAAGAAGG - Intronic
1102943559 12:116964869-116964891 TTTTTCCTTAATAGGGAGGAGGG - Intronic
1103174516 12:118850919-118850941 TTTTTTAAAAATAGAGATGGGGG + Intergenic
1103249015 12:119483999-119484021 CTTTTTATAAACAGAGAAAAAGG + Intronic
1103361651 12:120358200-120358222 TGTTTTCCAAAGAGGGAAGAAGG + Intronic
1104111658 12:125710298-125710320 GTTTTTATAGAAAGGGAGGAAGG + Intergenic
1104212625 12:126704425-126704447 CTTTGTTTACATAGGGAAGAGGG - Intergenic
1104326484 12:127803556-127803578 TTTTTTCTACAAAGGGAAAAGGG - Intergenic
1105652845 13:22399449-22399471 TTTTTTTTAAAGAGGGAGAAAGG + Intergenic
1105939025 13:25130384-25130406 TTTATTATAAGTTGGGATGAAGG - Intergenic
1106403288 13:29450278-29450300 TATTTTATTACTATGGAAGAAGG + Intronic
1106458244 13:29946240-29946262 CTTTTTATAGATAAGGAAGCTGG - Intergenic
1106477074 13:30108140-30108162 TTTTTTTTAAAAAAGGAAGTGGG + Intergenic
1106747210 13:32718089-32718111 TATTATATAAGTAGGGAAAAGGG + Intronic
1107327332 13:39258603-39258625 TATTTTATAAATAAGGAAATTGG + Intergenic
1107529245 13:41266152-41266174 TTTTTTTTAAATAGAGATGGGGG + Intergenic
1107534962 13:41320168-41320190 TTTAATATAACTAGGGAAGTAGG + Intronic
1107580025 13:41773388-41773410 TTTTTTAAAACTACTGAAGAAGG + Intronic
1107741812 13:43458604-43458626 TTTTATATAAGTAGGGGAAAGGG + Intronic
1107991745 13:45824793-45824815 TTTTTAATAAATGAGGAATAAGG - Intronic
1108302019 13:49087807-49087829 TTTTTTATAAGAGGGGAAGTTGG + Intronic
1108691446 13:52862748-52862770 TATTTTATAGATAGGCAAGTAGG - Intergenic
1108778854 13:53802412-53802434 TTTTGTATAAATAGAAAATATGG + Intergenic
1108812184 13:54240916-54240938 TTTTTTAAAAAACGGGGAGAAGG + Intergenic
1108926638 13:55756490-55756512 TTTCTTTAAAATAGGGAAGTAGG + Intergenic
1109005091 13:56863973-56863995 TGTCTTCTAAATAGGGACGATGG - Intergenic
1109368301 13:61387585-61387607 TTTTTGATAAAAGGGAAAGAAGG + Intergenic
1109386514 13:61634990-61635012 TCTTTTAAAAATGGGGAAGGGGG + Intergenic
1109469189 13:62782791-62782813 TATTTTATAAATAAGTAATATGG + Intergenic
1110029120 13:70583522-70583544 TATTGTATTAATAGGTAAGAAGG + Intergenic
1110048560 13:70862008-70862030 ATTTTTAAAAATATGGTAGAAGG - Intergenic
1110095857 13:71519510-71519532 TGTTTTATAAATGGGAAAAATGG - Intronic
1110165402 13:72436496-72436518 TTTTTCATAAATAGTGAACATGG - Intergenic
1110222563 13:73089221-73089243 TTTTTTAATAATAGAGATGAGGG + Intergenic
1110224738 13:73107813-73107835 TTGTTTATAAATAGTAATGAGGG - Intergenic
1110624363 13:77635642-77635664 TTTTTAATTAATAGGATAGATGG + Intronic
1110645546 13:77879345-77879367 TTTTTTTTAAATGGGAAAGCAGG + Intergenic
1110769996 13:79331303-79331325 TTTTATATCAAAAGGAAAGAGGG - Intronic
1110872776 13:80471836-80471858 TTATGAATAAATAGGAAAGAAGG - Intergenic
1111303001 13:86369057-86369079 TTTTGTATTATTAGGGGAGACGG + Intergenic
1111638268 13:90933050-90933072 TTATTTATAAAATTGGAAGAAGG - Intergenic
1112369597 13:98783169-98783191 TTTTTTATAAAGAGAGGAGGGGG + Intergenic
1112500145 13:99936620-99936642 TTTTTTTTAAATAGTAGAGATGG - Intergenic
1112747829 13:102547415-102547437 TTTTTTCTTAAGATGGAAGAAGG - Intergenic
1113242788 13:108358166-108358188 TTTTTTTTTAACAGGGAAAAAGG + Intergenic
1113412369 13:110101507-110101529 TTTTCAGGAAATAGGGAAGAAGG + Intergenic
1113664574 13:112132269-112132291 TTTTTTAAAAACAAGGAAGGAGG - Intergenic
1113992169 14:16036194-16036216 TTTTTAATAAATTGTAAAGAAGG - Intergenic
1116398036 14:44471176-44471198 ATTTTTAAAAAAAGGAAAGATGG - Intergenic
1116424066 14:44767943-44767965 TTTTCTTTAAAAAGGGAGGAGGG + Intergenic
1116513312 14:45773694-45773716 TTTTTTAAAATTGGGGAAAATGG - Intergenic
1116805729 14:49492514-49492536 TTTTTTATAAAATAGGAAGGGGG + Intergenic
1117089898 14:52239098-52239120 TATTTTATAAATAAGGAAATAGG - Intergenic
1117926418 14:60784349-60784371 TTTTTTTTAAATAGAGATGAGGG + Intronic
1117946935 14:61037166-61037188 TTGTTTAGAAAAAGGAAAGAAGG + Intronic
1118189757 14:63569872-63569894 TTTTATATAAAAAATGAAGATGG + Intergenic
1118412368 14:65494840-65494862 TTTTTTATACTTAAGGAAGTGGG + Intronic
1118583057 14:67324355-67324377 TTTTATTTAAATATGTAAGATGG + Intronic
1118748084 14:68788714-68788736 TTTTTTTTAAGTGGGGAGGAAGG - Exonic
1118868459 14:69721651-69721673 TTTTTTATTTTTAGTGAAGATGG - Intergenic
1119378900 14:74216344-74216366 TTATTTTTAAAAAAGGAAGATGG - Intergenic
1120077666 14:80177949-80177971 TTTATTATAAATAAGGAAATTGG + Intergenic
1120488715 14:85148990-85149012 ATTTTTAGAAAGAGGGAAGAAGG + Intergenic
1120497998 14:85260177-85260199 TTCTTTATAACAAGGCAAGAAGG + Intergenic
1121039766 14:90736277-90736299 TTTTTTAAAAAAAGGGGAGGAGG + Intronic
1122396200 14:101433940-101433962 TTTTTTATTTTTAGTGAAGACGG + Intergenic
1122515601 14:102306234-102306256 TTTTTTTTTAAGAGGGAAGTGGG - Intergenic
1122998509 14:105278731-105278753 TTTTTTTTAAATAGAGATGGGGG - Intronic
1123697291 15:22888171-22888193 TTTTTTATGAATAGTGAACTAGG - Intronic
1123770237 15:23521462-23521484 TTTTTTATTATTAGTGGAGATGG - Intergenic
1125315285 15:38424995-38425017 TCTTTTATGAATAGGGAAATAGG + Intergenic
1125441717 15:39710310-39710332 TTTTTTATATTTAGGAGAGACGG - Intronic
1125584660 15:40811741-40811763 TTTTTTATAAATGAGGAAACAGG + Intronic
1125904748 15:43380872-43380894 TTTTTTTAAAATAAGGAAAATGG - Intronic
1126017886 15:44370661-44370683 TTTATTTTTAATAGGGAAGACGG + Intronic
1126137954 15:45410880-45410902 TTTTTTTTAAATAGCGACAAGGG - Intronic
1126225838 15:46268028-46268050 TTTTTTAAAAATTGAGAAGTGGG + Intergenic
1126506325 15:49407526-49407548 AATTTTAAAAATAGGGGAGAGGG - Intronic
1127048059 15:55048769-55048791 TTTTTTGTAAAGAGGGGAGGTGG - Intergenic
1127076896 15:55335628-55335650 TTATTTTTAAATAGGGTAGTTGG + Intronic
1127343889 15:58074535-58074557 TTTTTTATAGATACTGAAAAGGG - Intronic
1127367175 15:58302008-58302030 TTTTTTAAAAAAATGAAAGAGGG + Intronic
1127554309 15:60072413-60072435 ATTTTAATAAAAAGGGAAAATGG - Intergenic
1127566264 15:60191911-60191933 TTTTATATCAATAGGGTACAAGG + Intergenic
1127583329 15:60357490-60357512 TTTTTTTTAAGTAGTGAATAGGG + Intronic
1127899637 15:63331410-63331432 TTGTTTCTGAATAGGAAAGAAGG + Intronic
1128414564 15:67432989-67433011 TATTTTATTTATATGGAAGAAGG + Intronic
1128489263 15:68130180-68130202 TTTTTTAAAAATAGGAAAAAAGG + Intronic
1128855906 15:71014914-71014936 TTTTTTCTGAATTGGGAATAAGG - Intronic
1129492466 15:75941981-75942003 TTTTTTTTAAAAAGGGCAGGGGG + Exonic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1129807332 15:78474343-78474365 TCTTTTCTAATTAGGGAAGAAGG - Intronic
1129811129 15:78510977-78510999 TTTTTTTTAAATAGAGAAGCGGG + Intronic
1130638654 15:85649480-85649502 TTTTTTAGAGATGGAGAAGAGGG - Intronic
1130877978 15:88030755-88030777 TTTTTTTTTAAAAAGGAAGAAGG - Intronic
1130941647 15:88514980-88515002 TTTTTTATACATAAAAAAGATGG - Intronic
1131214081 15:90522474-90522496 TTTCTTTTAAAAAAGGAAGAAGG + Intergenic
1131244656 15:90780391-90780413 TTTTTTCTAATTAGAGACGAGGG + Intronic
1131288182 15:91080703-91080725 TTTTTTAAAAATAGAAATGAGGG + Intergenic
1131415273 15:92250263-92250285 TTTTTTAAAAACAGGCAATAAGG - Intergenic
1131588508 15:93722077-93722099 TTTATTTTAAACATGGAAGAAGG - Intergenic
1131632083 15:94188139-94188161 TTTTGGAAAAATAGGGGAGAAGG + Intergenic
1131633412 15:94203970-94203992 TTTCCTGGAAATAGGGAAGAGGG + Intergenic
1131966863 15:97853415-97853437 TTCTTCATTAAAAGGGAAGAAGG - Intergenic
1132070430 15:98771911-98771933 TTTTTTTTAAATAGGTAGGGAGG + Intronic
1132384314 15:101389434-101389456 TTTTTTAGAAAAAGGTAAGTGGG + Intronic
1132505411 16:305855-305877 TTTTTTAAAAATAGAGATGGGGG + Intronic
1132887315 16:2188189-2188211 TTTTTTATAAAAAGTAGAGATGG + Intronic
1132894444 16:2221699-2221721 TTTTTTAAAAGTATGTAAGAGGG + Intergenic
1133329623 16:4964414-4964436 TTTTGTATTTTTAGGGAAGACGG - Intronic
1133541613 16:6760993-6761015 TTTCTTATTAATTGGAAAGATGG - Intronic
1133674940 16:8062186-8062208 TTACTTATAAATAGAGAAGTGGG + Intergenic
1134037072 16:11039357-11039379 TTTCTTATAAATAGGAAATCAGG - Intronic
1134060791 16:11198448-11198470 TTTTTTTAAAAAAGGAAAGAAGG + Intergenic
1135744425 16:25004011-25004033 TTGTTTGTAAATTGGGAAAAAGG - Intronic
1135870687 16:26147127-26147149 TTTTTTTTAAATAGGGGAGGTGG + Intergenic
1136174766 16:28508990-28509012 TTTTTTTTAATTAGAGAAGGGGG - Intronic
1136319361 16:29472611-29472633 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1136433932 16:30211955-30211977 TTTTTTCTTAATAGAGATGAGGG - Intergenic
1138031180 16:53560586-53560608 TTTTTTTTAAATAGAGACAAGGG + Intergenic
1138092255 16:54184675-54184697 TTTTTTATAAAAGCGAAAGAAGG + Intergenic
1138774933 16:59709588-59709610 TTTATAAAAAATAGGTAAGATGG - Intergenic
1138788766 16:59877480-59877502 ACCTTTATAAATGGGGAAGATGG - Intergenic
1138799238 16:60006162-60006184 TGTTTTATGTTTAGGGAAGAAGG - Intergenic
1138906161 16:61337215-61337237 TTTGTTATAAATAAGTAATATGG + Intergenic
1138938393 16:61759324-61759346 TTTTTTAAAAAGAAGAAAGAAGG + Intronic
1139228577 16:65257805-65257827 TTATTTATAAGTAGACAAGATGG - Intergenic
1139237361 16:65354174-65354196 ATTTTTATCAATGTGGAAGATGG - Intergenic
1139250897 16:65494939-65494961 TTTTCTATAAACAGGGCAGATGG - Intergenic
1139772648 16:69291537-69291559 TTTTTTTTAAATAGAGATGGGGG - Intronic
1139833771 16:69821876-69821898 TTTTTTTTAAATAAGAAACAGGG + Intronic
1139950814 16:70668420-70668442 CTTTTTATAAATAATTAAGATGG + Intronic
1140310700 16:73845531-73845553 TTTTTTCTAAAAAATGAAGATGG - Intergenic
1140447691 16:75044536-75044558 TTTTTTTTAAATAGAGATGGGGG + Intronic
1140544025 16:75789031-75789053 TTTTTTATAAATAGAGACGGGGG + Intergenic
1140659893 16:77179167-77179189 TATTTTATAGATAGGTAAAATGG + Intergenic
1140798960 16:78467153-78467175 TTTTTTAAAAAGAAGGAAAATGG - Intronic
1141353836 16:83324409-83324431 TTGTTTAGAGATAGGAAAGAGGG - Intronic
1142340007 16:89515561-89515583 TTTTTTATAAAAAGGTCAGCCGG - Intronic
1142810182 17:2392487-2392509 TTTTTGAGAAATAGGAAGGACGG - Intronic
1143069095 17:4275204-4275226 ACTTTTATTAAAAGGGAAGAGGG - Intronic
1143178757 17:4971494-4971516 TTTTTTAAAAATAGGCATGGTGG - Intronic
1143791933 17:9304052-9304074 CTTTTTATAAATTTGGGAGATGG - Intronic
1144251389 17:13420066-13420088 TTTTTTATGAATAGGGGGCAAGG + Intergenic
1144878524 17:18417408-18417430 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1144885229 17:18453832-18453854 TTTTGTGTCAAAAGGGAAGAAGG - Intergenic
1145146989 17:20490545-20490567 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1145153711 17:20526979-20527001 TTTTGTGTCAAAAGGGAAGAAGG - Intergenic
1145177056 17:20709637-20709659 TTTTGTGTCAAAAGGGAAGAAGG + Intergenic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1146338772 17:32000836-32000858 TTTTTTATAAATAGAAACAAAGG - Exonic
1146464803 17:33077975-33077997 TTTTTTTTAAAGGGGGAAAAAGG - Intronic
1146563708 17:33893725-33893747 TATTTTATAAATAAGGATTATGG - Intronic
1146608505 17:34284165-34284187 TTTTTTATTATTAGGAAATAGGG - Intergenic
1146958547 17:36952408-36952430 TATTTAGTAAATAGGGCAGACGG + Intronic
1146987578 17:37235392-37235414 TTTTTTAAAAATTGGGGAGGTGG + Intronic
1147007999 17:37420050-37420072 TTTTTTAAAAATAGGATAGTTGG + Intronic
1147049545 17:37781760-37781782 TTTTTTAGAAGCAGGGAGGAGGG - Intergenic
1147517864 17:41139221-41139243 TTTTTTATGAATATGGAGAAGGG - Intergenic
1147601064 17:41745819-41745841 TTTTTTTTAAATAGAGATGGGGG - Intergenic
1147699614 17:42384724-42384746 TTTTTTATTTTTAGGGGAGAGGG + Intronic
1148026320 17:44591463-44591485 TTTTTTTTAAAAAGGAAGGAAGG + Intergenic
1148535047 17:48431693-48431715 TTTTTTACAAAGAAGGAAAAAGG - Intergenic
1149269721 17:54965161-54965183 TTTTTTATAAATGGCTAAGCTGG - Intronic
1150524949 17:65912687-65912709 TTTTTTAAAAATAAAGATGAAGG + Intronic
1150664135 17:67114731-67114753 GCCTTTATAAATAGGCAAGAAGG - Intronic
1150830608 17:68515253-68515275 TTGTTTTTAAACAGGGAAGTGGG - Intronic
1152096441 17:78274710-78274732 TTTTTTAAAAATAGGCAGAAGGG + Intergenic
1152506269 17:80750774-80750796 TTTTTAAACAAGAGGGAAGAGGG - Intronic
1152523675 17:80875384-80875406 ATTTTTTTAAATGGGGAAAAGGG - Intronic
1153009433 18:524686-524708 TTTTTTTTTAAAGGGGAAGAGGG + Intergenic
1153185075 18:2477442-2477464 TTTCTTATAATTATGGAAGCTGG + Intergenic
1153294823 18:3535404-3535426 TTGCTTAGAAATAGGGAAAAAGG + Intronic
1153305501 18:3627111-3627133 TTTTTTTTTAATAGAGATGAGGG + Intronic
1154165704 18:12012793-12012815 TTTTATTTAAATAGGGCCGAGGG + Intronic
1155836019 18:30585221-30585243 TTTTTTATATATACCCAAGAAGG + Intergenic
1155954465 18:31945549-31945571 TTTTTAATATATAGAGATGAGGG + Intronic
1156000595 18:32379968-32379990 TTTTTTAAAATAAAGGAAGAAGG + Intronic
1156051351 18:32938532-32938554 ATTTATATAAATAGGGAAAAAGG + Intronic
1156097631 18:33554093-33554115 TTTTTAATAAAAAAGGAAAATGG + Intergenic
1156210964 18:34942258-34942280 ATTTTTATAGATTGGGAGGAAGG - Intergenic
1156366629 18:36433793-36433815 TGTTTTAGAAATAGGTTAGAAGG + Intronic
1156580423 18:38368596-38368618 CTTTTTATAAATTGCTAAGAAGG - Intergenic
1156878132 18:42041574-42041596 TTTTTTTTACAAAGGGAAGCAGG - Intronic
1157254215 18:46123911-46123933 GTTTTTATAAATAGAGATGGGGG + Intronic
1157453252 18:47803660-47803682 TTTTTTAAAAATAAGGGATAAGG - Intergenic
1157660050 18:49433575-49433597 TTAGTTATAAATAAGGAAGTAGG + Intronic
1158004372 18:52655129-52655151 TTTTTTTTTAAGAGAGAAGAGGG + Intronic
1158122333 18:54062089-54062111 TATTTTTTAAATAAGGGAGAAGG + Intergenic
1158137102 18:54220110-54220132 TTTTTTTAAAAAAGGCAAGAGGG + Intronic
1158267731 18:55678640-55678662 CTTTTTATAGATAAGGAAGAGGG - Intergenic
1158919924 18:62180153-62180175 TTTTTTAAAAAAAGGAAAGAAGG - Intronic
1159212406 18:65342461-65342483 TTTTTTATAAATAGGTAGGTAGG + Intergenic
1159570791 18:70110222-70110244 TTTTTTTTAAAAAGGGATGGGGG - Intronic
1159763097 18:72453266-72453288 TTTTTTTTAACTAGAGAAGCAGG + Intergenic
1159910260 18:74138902-74138924 TTCTCTAGAAGTAGGGAAGACGG - Intronic
1160111843 18:76039991-76040013 GTTTTCATAATTAGGGAAGCTGG - Intergenic
1160301895 18:77689452-77689474 TTTTTTTTAACCAGGGAGGAAGG + Intergenic
1161131144 19:2589388-2589410 TTTTTTTTAAATAGCAGAGATGG + Intronic
1161536604 19:4823147-4823169 TTTTGTATATTTAGTGAAGACGG - Intronic
1162590122 19:11585970-11585992 TTTGTTTTAAATAGGGATGGAGG + Intronic
1163319911 19:16568516-16568538 TTTTTTAAAAAGAGGGAATGGGG - Intronic
1163751003 19:19077715-19077737 TTTTTTGTATTTAGGAAAGATGG - Intronic
1165452512 19:35892350-35892372 TTTTTTAAAAATAAGAAAGATGG - Intronic
1165503020 19:36205212-36205234 TTTTTAAAAAATAGAGATGAGGG - Intronic
1166038832 19:40190451-40190473 TTTTTTTTAAATAGTAGAGACGG + Intergenic
1166079150 19:40432952-40432974 TTTTTTTTTAATAGAGACGAGGG + Intergenic
1166776498 19:45316027-45316049 TTTTTTATAAATAGAGACAGGGG + Intronic
1166882234 19:45936569-45936591 TTTTTTTTAAATGGGGAAATTGG + Exonic
1166955113 19:46458731-46458753 TTTTTTTTAAATAGAGATGGGGG + Intergenic
1167279745 19:48559945-48559967 TTTTTTTTAAAGAGAGATGAGGG - Intronic
1167351781 19:48979815-48979837 TTTTTTATTTTTAGGAAAGACGG + Intronic
1167553917 19:50180771-50180793 TTTTTTTAAAATAGAGATGAGGG + Intergenic
1167574485 19:50311543-50311565 TTTTTTAAAAAAGGGGAGGATGG - Intergenic
1167787893 19:51650896-51650918 TTTTTTTTAAGTAGAGATGAAGG + Intergenic
1168183737 19:54682925-54682947 TTTTTAATAAATAGCTTAGAAGG - Intronic
1168399773 19:56078811-56078833 ATTTTTTTAAATAGAGAAGCTGG - Intergenic
1168588798 19:57615717-57615739 TATTTTCCAAATAAGGAAGAGGG + Intronic
925248108 2:2402716-2402738 TTTATTGTAAATAGCTAAGAAGG - Intergenic
925436407 2:3842094-3842116 TTTTTTAAAAATAGACAATATGG + Intronic
925757064 2:7143511-7143533 TTTTATATAAATATGAAACAAGG - Intergenic
926315052 2:11703498-11703520 CTTTTCATAAATAGGCAAGGAGG + Intronic
926511752 2:13790044-13790066 TTTTTTTTGAATAGGGAAACAGG + Intergenic
927800433 2:26094187-26094209 TTTTTTTTAAGTAAGGAAAAAGG - Intronic
927825667 2:26308210-26308232 TTTTTTATAAAATGGGACGGGGG - Intronic
928004248 2:27549188-27549210 TGTTTTGTAAATGGGGAAGTTGG + Intronic
928288789 2:30019133-30019155 TTTTCTAAAAATAGTGAACATGG - Intergenic
928456262 2:31425632-31425654 TTTTTAATAAATAAAGAAGCTGG + Intergenic
928972370 2:37043917-37043939 TTTTTTTTAAATAGAAATGAAGG + Intronic
929406016 2:41641762-41641784 GTTGTTACAAATAGGAAAGATGG + Intergenic
929542606 2:42833994-42834016 TTTTTTTTAAATAGAGACGGGGG + Intergenic
929706113 2:44213926-44213948 TTCTTTATGAATGAGGAAGAAGG - Intronic
929970141 2:46567003-46567025 TTTGTTATAAAAATGGGAGATGG - Intronic
930097359 2:47575551-47575573 TTTTTTAAATATGGAGAAGATGG + Intergenic
930410104 2:51014615-51014637 TATTTTATAAATAAAAAAGAAGG + Intronic
930429916 2:51262791-51262813 TTTTCTGTAAATAGGTAAAATGG + Intergenic
930707812 2:54521682-54521704 TTTTATAGAGATAGTGAAGAAGG + Intronic
931004844 2:57837309-57837331 TTAAAAATAAATAGGGAAGAAGG + Intergenic
931348623 2:61470057-61470079 TATTTTAAAAATAGGTATGAAGG + Intronic
931396460 2:61892129-61892151 TTTTTTAAATATAGGAAAGCTGG - Intronic
933787119 2:85852169-85852191 TTTTTTAAAAATCCGGAACAGGG + Intronic
933814884 2:86058413-86058435 TTTTTTTTAAATAGAGATGGGGG + Intronic
933859750 2:86454126-86454148 TTTTTTACAAAAAGGGAGGTGGG - Intronic
934660438 2:96140744-96140766 AATTTAATAAATAGGAAAGAAGG + Intergenic
934881604 2:97986312-97986334 ATTTTTTTAAATGGGGAATAGGG + Intronic
935358787 2:102229892-102229914 TTGTTTAGAAACAGGGAACAGGG + Intronic
936033358 2:109089428-109089450 TTTTTTTTAAATAGAGATGGGGG - Intergenic
936067560 2:109343894-109343916 TTTTTTAAAAATAGGCATGGTGG - Intronic
936636930 2:114269561-114269583 TATTTTGTAAATTGGTAAGAGGG - Intergenic
936751340 2:115645621-115645643 TTTTTTTATAATAAGGAAGAAGG - Intronic
937818362 2:126279078-126279100 TTCTTGATAAATAGGAAAGATGG + Intergenic
938877341 2:135546231-135546253 TTTTTTGGATATAGGGAGGAAGG + Intronic
939119563 2:138100342-138100364 GTTTTTATAAATCAGGAAGTGGG - Intergenic
939789208 2:146550479-146550501 TTTTACACAGATAGGGAAGAGGG + Intergenic
939816454 2:146902867-146902889 TTTTTTAAAAAAAAGGGAGATGG - Intergenic
940890174 2:159027774-159027796 TTTTTTATAAATTATGCAGAAGG - Intronic
941656595 2:168151154-168151176 TCATTAATAGATAGGGAAGATGG - Intronic
942027594 2:171925843-171925865 TTTTATATAAAAAGGAAAGACGG + Intronic
942474044 2:176296618-176296640 TTGTTTTTTAATGGGGAAGAGGG - Intronic
943129082 2:183835197-183835219 TTTTTTTAAAGTAAGGAAGAAGG + Intergenic
943146719 2:184055231-184055253 ATATTTATAAATAGTAAAGAGGG - Intergenic
943175726 2:184471487-184471509 TTTTTTAAAAAAAGGTAAGAAGG + Intergenic
943406794 2:187497532-187497554 ATTTTTATAATTAGGGAAAATGG - Intronic
943918731 2:193674597-193674619 TTCTTTATACATGGAGAAGACGG + Intergenic
944286844 2:197960127-197960149 TTTTTTATTAATGTGAAAGAAGG - Intronic
944330468 2:198459708-198459730 GTTGTTATGAATAGAGAAGATGG - Intronic
944555717 2:200886127-200886149 TTTTCTATAAATAAGGATGTTGG - Intronic
944952246 2:204765059-204765081 TATTTTTTAAATAAGCAAGATGG + Intronic
945523529 2:210859750-210859772 TTCTTTATAAATAAGATAGAGGG + Intergenic
945741362 2:213666698-213666720 TTATTTATAAATATAAAAGAGGG + Intronic
946125092 2:217555708-217555730 TGTTTTATGAAAAGGAAAGATGG + Intronic
946167721 2:217875649-217875671 TTTTTTTGAAAGAGGAAAGAGGG - Intronic
946265097 2:218533894-218533916 TTTTGTAAAAACAGGGTAGAAGG + Intronic
946610500 2:221452713-221452735 TTTTTTTTTAATGGGGGAGAAGG + Intronic
946857647 2:223968630-223968652 TTTTTTATAAAGAAAGATGAAGG + Intergenic
947142174 2:227029626-227029648 TATTTCATAAATAAGGAAGCTGG - Intronic
947737202 2:232461927-232461949 TTTTTTAAAAATAAGGAGGGAGG + Intergenic
947880057 2:233500353-233500375 GTTTTTATATTTAGGGAAAACGG - Intronic
948555791 2:238810062-238810084 AATCTTAGAAATAGGGAAGAAGG - Intergenic
948623456 2:239251224-239251246 TTATTTCTAAAAAGTGAAGATGG + Intronic
948649211 2:239429462-239429484 TTTTTAAAAAATAGAGAATATGG - Intergenic
948747080 2:240104871-240104893 TTTTTTAGAAATAGAGAATTTGG + Intergenic
1169177801 20:3533828-3533850 TTTTTTAAAAATAGATATGAGGG + Intronic
1169526431 20:6431383-6431405 GTTTTTATAAATGAAGAAGATGG - Intergenic
1169829016 20:9802401-9802423 CATTTTATAAATATGGGAGAAGG + Intronic
1169941753 20:10945444-10945466 TTTTCTAAAAACAGAGAAGATGG - Intergenic
1171287685 20:23955405-23955427 TTGTGTATAAATAGGGCAGAAGG - Intergenic
1171769686 20:29313069-29313091 TTTTTTATAAATTGTAGAGATGG + Intergenic
1172067525 20:32232292-32232314 TTTTTTTTAAATAGAGATGGGGG - Intronic
1172260528 20:33560625-33560647 TTTTTGACAAATAGGAAGGAAGG - Intronic
1172659500 20:36557911-36557933 TTTTTTAGAAAGGGGGAAAAGGG + Intergenic
1173383930 20:42571278-42571300 ATTTTTCTAAATAGGAAAGAAGG + Intronic
1173517707 20:43676920-43676942 TTGTTTTTAAATAGAGAAGAGGG + Intronic
1174073773 20:47917558-47917580 TTTTTTATAAACATGGAAATTGG + Intergenic
1174229828 20:49037419-49037441 TTTTTTAAAAATAGAGATGGGGG + Intergenic
1174246408 20:49185090-49185112 TTATTTGGAAATAGGGCAGACGG + Intronic
1174326334 20:49781717-49781739 TTTTCTTTAAACAGTGAAGAGGG + Intergenic
1174462602 20:50693410-50693432 TTTTTTAAAAAGAAGGAAGATGG - Intergenic
1174958355 20:55126822-55126844 TTTGTTTTAAAGAGGGAACAGGG + Intergenic
1175475069 20:59266577-59266599 TTTTTTTCAAATAGATAAGATGG + Intergenic
1176887062 21:14269710-14269732 TTTTTTAAAATGTGGGAAGAGGG + Intergenic
1176894057 21:14354568-14354590 TTTTTTTTTAATAGGGGAGCAGG + Intergenic
1177072463 21:16527735-16527757 TTTTGAGAAAATAGGGAAGAGGG - Intergenic
1177117197 21:17100758-17100780 TTTTTTTTAATTTAGGAAGAGGG - Intergenic
1177127661 21:17216602-17216624 TTTTTTAAAAAAAGGAAAGTTGG + Intergenic
1177150524 21:17451023-17451045 TTTTTTAAAAAAAGAGAATAAGG + Intergenic
1177380678 21:20338926-20338948 TTTTTTATTAAAAGAAAAGAAGG - Intergenic
1177492830 21:21849658-21849680 TTTTTGAAGAATAGAGAAGATGG - Intergenic
1178080755 21:29062231-29062253 TTTTTGATAGAAAAGGAAGATGG - Exonic
1178085165 21:29105026-29105048 TGTTTCCTAAAAAGGGAAGAAGG + Intronic
1178242435 21:30918185-30918207 TTTTTTACAGTTAGGGAAGCAGG + Intergenic
1178331054 21:31691767-31691789 TTTTTTTTAAATAGGCAGAAGGG - Intronic
1178331768 21:31702083-31702105 TTTATTATAAATAGGAATTATGG + Intronic
1178514263 21:33232612-33232634 TCTGTAATAAATAGGAAAGAAGG + Intronic
1178557985 21:33610552-33610574 TTATTTATAAATCAGGAGGATGG - Intronic
1178869647 21:36362253-36362275 TTTTTTTTAAATAGAGATGGGGG + Intronic
1178954467 21:37010092-37010114 TTTTTGAGAAATACAGAAGAGGG - Intronic
1179503911 21:41827291-41827313 TTTTTTTAAAAAAGGGACGAAGG + Intronic
1180315102 22:11271323-11271345 TTTTTAATAAATTGTAAAGAAGG + Intergenic
1180849066 22:19002985-19003007 TTTTTTAAAAATAGAAAAAAAGG - Intergenic
1181916507 22:26285328-26285350 TATTTTATAAATAAAGAAGTTGG - Intronic
1182229393 22:28825652-28825674 TTTTTTAAAAATAGAGATGGGGG - Intergenic
1182242170 22:28924759-28924781 TTTTTAAAAAGTAGGCAAGAGGG + Intronic
1182495064 22:30700917-30700939 TTTTTTGTATATAGTAAAGACGG - Intronic
1182597254 22:31431339-31431361 TTTTTTCTGAATAGGAAAAAGGG + Intronic
1182776322 22:32833936-32833958 ATTTTTATAATTAGGGAAAGTGG + Intronic
1182818943 22:33196601-33196623 TTTTCGCAAAATAGGGAAGAGGG + Intronic
1183552976 22:38503524-38503546 TTAATTATAAACATGGAAGACGG - Intronic
1183757782 22:39785974-39785996 TTCTTGATGAATAGGAAAGAAGG - Intronic
1184087379 22:42272991-42273013 TTTTAAATAAATAGAGATGAGGG - Intronic
1184314024 22:43668752-43668774 CATTTTATAAATAAGAAAGATGG - Intronic
1185145278 22:49131073-49131095 TTTTGTAGACATAGGGAAGCTGG - Intergenic
949227226 3:1709549-1709571 CTTTATATAAATAGGGGAAAGGG + Intergenic
949544097 3:5057531-5057553 ATTTATAGAAATACGGAAGATGG + Intergenic
949820498 3:8110977-8110999 TGTTTTATAAATAAGGAAACTGG + Intergenic
950001916 3:9663304-9663326 TTTTTTGTAAATTGGGAAAGAGG + Intronic
950161928 3:10766703-10766725 CTTTTTATAAATTGAGATGATGG + Intergenic
950826078 3:15822969-15822991 TTTTGTATAAATAGGCTAGTTGG - Intronic
950878368 3:16299828-16299850 TTTTTTAGTGACAGGGAAGAAGG + Intronic
951033991 3:17913058-17913080 GTTTTTATAAACAGTGAAGAAGG + Intronic
951081368 3:18454003-18454025 TTTTTTAGAAATAAGGAAAATGG + Intergenic
951081790 3:18459039-18459061 TGTTTTAAAAATAGAGCAGATGG + Intergenic
951374541 3:21897254-21897276 TTATTGATAAACAGGCAAGAGGG + Intronic
951521440 3:23614604-23614626 TTTATTAAAAAAAAGGAAGAAGG - Intergenic
951607254 3:24449656-24449678 TTTTTTCAAAATAGGGAAGCCGG + Intronic
951808539 3:26674461-26674483 GTTCTTATAAAAAGGAAAGAAGG + Intronic
952647789 3:35682656-35682678 TTTTTTAAAGCTAGGGAAGGAGG + Intronic
952749220 3:36811703-36811725 ATTTTTTTAAAAAAGGAAGAGGG + Intergenic
952916496 3:38249164-38249186 TTTTATATAAATAATGGAGAGGG - Intronic
954345965 3:49999555-49999577 TTTTTTATATATGGGGAGGGAGG + Intronic
955150517 3:56362291-56362313 TGTTTTATAGATAAGGAAAACGG + Intronic
955178154 3:56638045-56638067 TTTTTAAAAAATAGCCAAGAAGG - Intronic
956155275 3:66289493-66289515 TTTTGTATAAAGAGTAAAGAAGG + Intronic
956342867 3:68246288-68246310 TTTTCTATAAATTGAGAAGGTGG + Intronic
956362481 3:68463751-68463773 TTTTTTATAAATTTGGAAGGAGG + Intronic
956467409 3:69533117-69533139 TTTTTTATAAATAATGATTAAGG + Intronic
956968258 3:74489479-74489501 TTTTTTACTGATTGGGAAGAAGG - Intronic
957132822 3:76243930-76243952 TTTTTTTTAATTTGGGAAGAAGG + Intronic
958813154 3:98886161-98886183 TTTTTTAAAAATTGGAAAGTCGG - Intronic
958948906 3:100396026-100396048 TTTTTTTTAAATCAGGAAAATGG + Intronic
959182458 3:102998902-102998924 TTATTTTTAAGTAGTGAAGAGGG - Intergenic
959234702 3:103705123-103705145 TTTTTCATTTATAGGGAGGAGGG - Intergenic
959308660 3:104701567-104701589 TTTTTAGTAAATAAGGTAGAGGG + Intergenic
959320127 3:104862883-104862905 TTTTTTATAAATAAAGAAGCTGG - Intergenic
959370981 3:105525478-105525500 TCTTTTTTAATTAGGGAAGAAGG + Intronic
959370987 3:105525559-105525581 ATTAAAATAAATAGGGAAGAAGG + Intronic
959371423 3:105531732-105531754 TGCTTTATAAATAGTGAATATGG - Intronic
960221647 3:115118531-115118553 TTTTTTTAAAATAGGGGAGCAGG - Intronic
960296254 3:115948260-115948282 TCTTAAATAAATAGAGAAGAAGG - Intronic
960391321 3:117080837-117080859 TTTCTTTGTAATAGGGAAGAAGG + Intronic
960426720 3:117517261-117517283 TTTATTATAAAAAGGGGACAAGG - Intergenic
960659844 3:120045490-120045512 TTTTTTTTAAATAAGGAAGAGGG - Intronic
960906547 3:122607426-122607448 TTATCTATAAATATGGATGATGG + Intronic
960985117 3:123273849-123273871 TTTCTTGTAAATAGGGAAGTTGG + Exonic
961135262 3:124504282-124504304 TTTTTTAAACAGAAGGAAGAGGG - Intronic
961266877 3:125650241-125650263 TTTTTTTTAAATAGAGATGTGGG - Intergenic
961993253 3:131214799-131214821 TTTTTTATATATAGGACAGCAGG - Intronic
962049599 3:131798895-131798917 TTTTTTTTAAAAAGTGAAGATGG - Intronic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962735907 3:138325088-138325110 TTTTTTCTGGGTAGGGAAGAAGG - Intronic
962929490 3:140023559-140023581 TGTTTTACAAATAGGGAACCAGG - Intronic
963036889 3:141038234-141038256 TTCTTTACAAAGAGGGAAGCAGG - Intergenic
963051391 3:141146868-141146890 TTTTTTAAAAAAAGAGAAAATGG - Intronic
963128289 3:141835043-141835065 TTTTTTAAAAAGAGAGGAGAGGG - Intergenic
963826639 3:149962495-149962517 TTTTATAAAAAAGGGGAAGAGGG - Intronic
963838508 3:150080830-150080852 TTATTTTTAAATAGTGAATATGG + Intergenic
963873941 3:150452143-150452165 TTTTTTAAAAATAGAGATCAAGG + Intronic
964506232 3:157403026-157403048 TTTTTGATAAATAATGAAGAAGG + Intronic
964685305 3:159389037-159389059 TTTTATCTAAATAGGGTATATGG + Intronic
964853964 3:161125488-161125510 TTTTTTTATAATAGGGGAGAGGG + Intronic
964928661 3:161988318-161988340 TTTTCTAAAACTAGGGAATATGG + Intergenic
965457070 3:168914849-168914871 TTTGTTAGAAATAGCAAAGAGGG + Intergenic
965470471 3:169084309-169084331 TTGTTTAAAACTAGGGAAAAAGG - Exonic
965505129 3:169507017-169507039 TTTCTTATGATTAGTGAAGAGGG - Intronic
965528053 3:169742252-169742274 CTTGTTATAAATAGGAAAGCTGG + Intergenic
965876171 3:173323519-173323541 TTTTTTAAAAATAAGTAAAAGGG - Intergenic
965938602 3:174147105-174147127 TTTTCTATAACTGGGGATGACGG - Intronic
965991599 3:174825659-174825681 TGTTTAAGGAATAGGGAAGAAGG - Intronic
966282358 3:178246760-178246782 TTTTTTATAAACAATGATGAAGG - Intergenic
966508429 3:180733478-180733500 AGTTTTATTAATAAGGAAGAAGG - Intronic
967360536 3:188625254-188625276 TTTCTTATGAATGGGCAAGATGG - Intronic
967899493 3:194434990-194435012 TTTTTTCTCAATGGGGAAGGAGG + Intronic
967911907 3:194549449-194549471 TTTTTTTTAAATAATGGAGATGG - Intergenic
968205617 3:196797290-196797312 TTTTGTATAATTAGTAAAGACGG - Intronic
968450351 4:673181-673203 TTGTTTAAAAATGGGGAAGCTGG - Intronic
968855876 4:3121572-3121594 TATTTTATAAATAGGGGAGTTGG + Intronic
970153496 4:13116957-13116979 TTTTTTATTTTTAGTGAAGATGG + Intergenic
970295566 4:14625655-14625677 TCTTTTGTTAATATGGAAGATGG + Intergenic
970653490 4:18203682-18203704 TTTTTTCTTAAAAGGGATGAAGG - Intergenic
971193424 4:24448804-24448826 CTTTATAAAATTAGGGAAGAAGG + Intergenic
971344401 4:25798655-25798677 TTTTGTATTTTTAGGGAAGACGG - Intronic
971453729 4:26823890-26823912 TTCTGTATAAAGAAGGAAGAGGG - Intergenic
971515374 4:27479699-27479721 TTTTTACAAAATAGGGAGGAAGG - Intergenic
971592778 4:28490059-28490081 TGTTTTATAAATTAGGAAGGTGG + Intergenic
971855549 4:32038889-32038911 TTATTTATCAAAAAGGAAGAAGG + Intergenic
972036662 4:34531347-34531369 TTTTTTAAAAATAAGTAAGTTGG + Intergenic
972063205 4:34907038-34907060 TTTTTAACAAAAAGGGAAAAGGG - Intergenic
972163182 4:36250028-36250050 TTTTTTAAAAAAAGGGCAGTAGG - Intergenic
972471713 4:39411811-39411833 TTTTCTTTAAATAGAGAAGGGGG - Intronic
972561562 4:40233292-40233314 CTATTTACAATTAGGGAAGAGGG + Intronic
972586399 4:40441120-40441142 TTTTTTAAAAATAGAGATGGAGG + Intronic
972841987 4:42941889-42941911 TTTTTTTTAAAGAGGGAAAATGG - Intronic
972983798 4:44739333-44739355 TATTTTATATGTTGGGAAGAAGG + Intergenic
973701625 4:53543031-53543053 TTGTTTTTAAATAGAGATGAGGG + Intronic
974142413 4:57903995-57904017 TGTTTTTTAAATAGACAAGAAGG + Intergenic
974442466 4:61937927-61937949 TTTTGTTTTAATAGAGAAGAGGG + Intronic
974543633 4:63271844-63271866 TTTTTTATCATGAGGGAATATGG + Intergenic
974842380 4:67312785-67312807 ATTTCTATAAAAAGGGCAGATGG - Intergenic
975229948 4:71921313-71921335 TTTTTTAAAAATAAACAAGATGG + Intergenic
975356754 4:73415037-73415059 TTTTGTATGAATATGCAAGAAGG + Exonic
975507760 4:75158017-75158039 TTTTGTATAAATTGGGTTGAGGG - Intergenic
975539613 4:75493636-75493658 TTTTTTTTAAATAATGAAAAAGG + Intronic
975626459 4:76353969-76353991 TTTATTGTAAATAAGGTAGAAGG + Intronic
975711103 4:77160368-77160390 TTTTTTTTAAATAGAGATGGAGG + Intronic
975953279 4:79801779-79801801 ATTTTTATAAATATTGAACATGG + Intergenic
975990405 4:80254013-80254035 TTATTTATTAATAAGGCAGAGGG - Intergenic
976361208 4:84180628-84180650 TTTTCTATAAAAAGAGAAGGCGG + Intergenic
976416083 4:84777048-84777070 CTGTTTATACACAGGGAAGAAGG + Intronic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
977351678 4:95896488-95896510 TTTTTCATAGCTGGGGAAGAGGG + Intergenic
977504486 4:97884417-97884439 CTTTTTATAAAAAGAGAAAAAGG + Intronic
977776897 4:100931433-100931455 TAATTTAAAAATAGGGAAGCAGG + Intergenic
977905566 4:102474367-102474389 TTTTTTAAAAAAGGGTAAGAAGG + Intergenic
978043692 4:104100157-104100179 TTTTGTATTATTAGGAAAGATGG - Intergenic
978353827 4:107849026-107849048 TTTTTTTTACATATGGAAGTCGG + Intronic
978416178 4:108478633-108478655 TTTTTTAGAAATAAGTAAGAAGG - Intergenic
979309380 4:119184236-119184258 CTTTTTCTAAATAAGGAATATGG - Intronic
979489923 4:121314101-121314123 TTATTTATAAATACAGAATAAGG + Intergenic
979562999 4:122121174-122121196 TTTGTTAAAAATAGGGGTGAGGG + Intergenic
980182692 4:129421506-129421528 TGTTTTACATATAGTGAAGAAGG + Intergenic
980218956 4:129889994-129890016 TTTTTAAAAAAGAAGGAAGAGGG - Intergenic
980227508 4:130005614-130005636 TATTTTATTAATAGGGAAGCAGG - Intergenic
981059697 4:140409675-140409697 TTTTTCAGAAATATTGAAGAGGG + Intronic
981060895 4:140424642-140424664 TAATTTATAAGGAGGGAAGAGGG - Intronic
981115056 4:140980211-140980233 TTTTGTATTTTTAGGGAAGATGG + Intronic
981413698 4:144463133-144463155 TTTTATATAAATTGGGAAAATGG + Intergenic
981760166 4:148185514-148185536 TTTTTTTTTAATAGGCAATATGG + Intronic
982457039 4:155622666-155622688 GTTTTTAAAAATTGAGAAGAGGG - Intergenic
982462754 4:155691499-155691521 ATTTTCATAAATAAGGAAAAAGG - Intronic
983088560 4:163476977-163476999 TGTCTTCTAAATAGGGGAGAAGG - Intergenic
983374363 4:166905582-166905604 TTTCTTATAAATTGGGACTAAGG + Intronic
984928639 4:184827293-184827315 TTTTTTCTAGATCTGGAAGATGG - Intergenic
985963305 5:3320201-3320223 TCTCTGATAAAAAGGGAAGACGG + Intergenic
986118841 5:4810613-4810635 ATTTGTTTAGATAGGGAAGAAGG + Intergenic
986168888 5:5299516-5299538 TTTTTTTTTAATGGGGAAGAGGG + Intronic
986578474 5:9236938-9236960 TCTTTTATAAATACAGAAGGGGG + Intronic
986877476 5:12129096-12129118 TTTTATATGAAAAGTGAAGAAGG - Intergenic
987181550 5:15373096-15373118 TTTTTTAGATTTAAGGAAGATGG - Intergenic
987258004 5:16177448-16177470 TTTTTTCTAAAAAGGCAAGTTGG - Intronic
987276073 5:16364057-16364079 TTTCTTAAAAATAGGAAAGAGGG + Intergenic
987577276 5:19745889-19745911 TATTTTTTAAAAATGGAAGATGG - Intronic
987833143 5:23124777-23124799 TTTTTTATAAAGTGTAAAGAAGG + Intergenic
987997332 5:25301465-25301487 TTATTTTAAAATTGGGAAGACGG - Intergenic
988813665 5:34809617-34809639 TTTTTTCTAAACTGGGAAGAAGG + Intronic
988839568 5:35070503-35070525 TTTTTCATAAAGTGGGAAGGAGG - Intronic
988997024 5:36724616-36724638 TTTGTTGAAAATAAGGAAGAGGG + Intergenic
989062337 5:37421836-37421858 TTTTTCAGAAATAGGAAAAATGG + Intronic
989145964 5:38250443-38250465 TTTTTCTTAAAGAGGGAAGTAGG - Intergenic
989314640 5:40063524-40063546 TTTTTAAAAAATAGAAAAGAAGG - Intergenic
989386382 5:40858648-40858670 TTTATAATAAAGAGGGAACATGG - Intronic
990767866 5:59207267-59207289 TTTAATATACAGAGGGAAGAGGG + Intronic
991307939 5:65201026-65201048 TCTTTTATACAATGGGAAGAAGG + Intronic
991485775 5:67135062-67135084 ATTTACATAAATAGGGAAAATGG + Intronic
991733357 5:69609994-69610016 TTTTTTTTAAATAGGAGACAAGG - Intergenic
992153322 5:73927769-73927791 ATTTCTAGAAATATGGAAGAGGG + Intronic
992607671 5:78476068-78476090 TTCAATATAAATAGGGAAAAAGG - Exonic
992653206 5:78882178-78882200 TTTTACACAAATAGGGCAGAGGG + Intronic
992700138 5:79333815-79333837 TTTTTTTTAAATAGAGATGGGGG - Intergenic
992961475 5:81960219-81960241 TTTTCTAAAAGTGGGGAAGAGGG - Intergenic
993134612 5:83943376-83943398 TTTTAGGGAAATAGGGAAGAGGG + Exonic
994105454 5:95943252-95943274 TTTTTTTTAAATAGAGATGGAGG - Intronic
994271925 5:97787803-97787825 TTTTTTTAAAATAAGGAGGAAGG - Intergenic
994657210 5:102608812-102608834 TTTTGAATAAATAGGGAATGAGG + Intergenic
994745906 5:103678025-103678047 TTTCTTATTCATAGGGAAAAAGG + Intergenic
994819193 5:104627206-104627228 TTTGTTAGAAATGGGAAAGATGG + Intergenic
994872108 5:105364816-105364838 TTTTTTAAAAATTGGAGAGAAGG + Intergenic
995187575 5:109288297-109288319 TTTTTTAATAATATGAAAGATGG - Intergenic
995308370 5:110681383-110681405 TATTGAATAATTAGGGAAGAGGG - Intronic
996020073 5:118580955-118580977 TTTTTTTCAAAAAAGGAAGAAGG + Intergenic
996075246 5:119185227-119185249 TTTTTGATAAATAGGGGGAAAGG - Intronic
996309321 5:122085554-122085576 TTTTCTATAAACAAGGAAAAAGG + Intergenic
996311826 5:122114961-122114983 TGCTTTATAAATTGGGAGGAAGG - Intergenic
996859838 5:128052746-128052768 TTTTTTATCAATAAGGAACTTGG - Intergenic
997008377 5:129847776-129847798 GTTTACAGAAATAGGGAAGATGG - Intergenic
997035210 5:130182535-130182557 GATTTTATAAATAGGGCATAAGG - Intronic
997548989 5:134735954-134735976 TTGTTTTTAAATAGAGAAGGGGG + Intergenic
998493770 5:142569247-142569269 TTTTTTAAAAGTGGGGTAGAAGG - Intergenic
998772281 5:145559611-145559633 TTTCTTAGAAATAAGGAGGAGGG - Intronic
998936850 5:147237959-147237981 TTTTTTAAAAATACGCAATAAGG + Intronic
999011290 5:148043566-148043588 TATTTTATAAATAAGAAAAATGG + Intronic
999400201 5:151258521-151258543 GCTTTTATAGATAGGGAAGTGGG + Intronic
999747140 5:154600941-154600963 TCTTTTAAAAATGGGGAAGATGG - Intergenic
999753344 5:154646661-154646683 TGTTTTGTAAACAGGGATGAAGG + Intergenic
999784417 5:154878623-154878645 ATTTTTCCAAATAGGGTAGATGG - Intergenic
999831246 5:155322357-155322379 TATTTTTAAAATAGGGGAGAAGG - Intergenic
999900526 5:156081692-156081714 ATATTTATAAAAAGGGAACATGG - Intronic
999991594 5:157055117-157055139 TTTTTTCTTAATAGGGAAAGAGG - Intronic
999994231 5:157076864-157076886 TTTTTTAAAAATAGAGATGGGGG - Intergenic
1000006706 5:157192143-157192165 TCTTTTATACATAGGTGAGATGG + Intronic
1000102149 5:158026315-158026337 TTTTCTATAAATGGGGATGGAGG + Intergenic
1000369623 5:160522028-160522050 TTCTTTTTAAATAGGGCACAGGG - Intergenic
1000397914 5:160795576-160795598 TTTTTTTTAATTTGGGAAAAGGG + Intronic
1000561171 5:162791245-162791267 TTTTTTAAAAGTTTGGAAGATGG + Intergenic
1000703167 5:164478125-164478147 TTTTTTTAAAACAGGGAAGTTGG + Intergenic
1000781209 5:165484232-165484254 TGTTTTATAAGCAGGGAAGTTGG + Intergenic
1000903927 5:166939915-166939937 TATTTTATCAAGAGGGAAAAAGG - Intergenic
1001352890 5:170988292-170988314 TTTTTTTTAAGTAAGGGAGAGGG + Intronic
1001370813 5:171199059-171199081 TTTTTTTTAAATAGAGAAGAGGG - Intronic
1002587591 5:180260851-180260873 TTTTTCATAAAAAAGAAAGATGG - Intronic
1002678385 5:180937928-180937950 TTTTTTTTAAATGGGGAAAGGGG - Intronic
1003266577 6:4570005-4570027 AATTTTATAAATAGGGATAAAGG - Intergenic
1003339927 6:5210235-5210257 GTTTCTGTAAATAGAGAAGAAGG + Intronic
1003417901 6:5929292-5929314 TTTTTTAGAAACAGAGTAGAGGG - Intergenic
1004315478 6:14583470-14583492 ATTTTTAAAAATAGAGAAAAAGG - Intergenic
1004321128 6:14632587-14632609 TTTTTAATAAATGAGGAAGAAGG + Intergenic
1004976790 6:20976490-20976512 TTTTTTAAAAATTGGGGAGGAGG - Intronic
1005082572 6:21971607-21971629 ATTTTTATAAAGCGGGGAGAGGG + Intergenic
1005217730 6:23551383-23551405 TCTCTTTGAAATAGGGAAGATGG - Intergenic
1005382761 6:25254111-25254133 TTTTGTAGAAATAGAAAAGATGG - Intergenic
1007099434 6:39235146-39235168 TTTTTAAAAAATAGTGAAAATGG + Intergenic
1008104568 6:47428234-47428256 TTTTTTTTAAATAGAGATGGGGG + Intergenic
1008126140 6:47670725-47670747 TTTTTTTTAAATAAGGGAGAGGG + Intronic
1008187996 6:48418684-48418706 TTTCTTATAAATTGGGCTGAGGG + Intergenic
1008666134 6:53718325-53718347 TTGTATAAAAATGGGGAAGATGG + Intergenic
1008803235 6:55395986-55396008 TTATCTATAAATAGAGCAGATGG + Intronic
1008850728 6:56017929-56017951 TTATTTACAAATATGGAGGAAGG + Intergenic
1008933652 6:56966405-56966427 TTTTTTATAAATATGAGGGAAGG + Intronic
1009560068 6:65228662-65228684 TTTTATAGAAATAGGCAAGATGG + Intronic
1009858807 6:69298122-69298144 TTTCATCTAAATAGGGGAGAAGG + Intronic
1010076703 6:71806571-71806593 TTTTGTATTAATTGGAAAGATGG - Intergenic
1010241460 6:73619515-73619537 TTTTTTTTAAATAGTAGAGATGG - Intronic
1010296236 6:74199912-74199934 TTTTTTAAAGAAAGGGAAGGAGG - Intergenic
1010497399 6:76551178-76551200 TCTTTTAAAAATCTGGAAGAAGG - Intergenic
1011217010 6:85015658-85015680 TTTTTTTAAAATTGGGAAGCAGG - Intergenic
1011384319 6:86778593-86778615 TTTTTTTTAGTTAGGGTAGATGG - Intergenic
1012447784 6:99324228-99324250 CTTTTTTTAAAAAGGGAAAAAGG - Intronic
1012604096 6:101135280-101135302 TTTTTTATGAATGTGGTAGACGG - Intergenic
1012690054 6:102299194-102299216 TTCTTTAGAAATAAGGATGAGGG - Intergenic
1012869227 6:104654359-104654381 TTTATTTTAAATAGGGAAAAAGG - Intergenic
1013202089 6:107908208-107908230 TTTTTTTTAAAGAGGGATGGAGG + Intronic
1013358461 6:109369825-109369847 TTTTTTAAAAATATGGAGGGAGG + Intronic
1013502311 6:110765055-110765077 TTTTTTTTAATTTGGGAAGTGGG + Intronic
1013988101 6:116220609-116220631 TTTTGCATAAATAGCCAAGAAGG - Intronic
1014009684 6:116461780-116461802 TTTTTTTTTTAAAGGGAAGAGGG - Intronic
1014178448 6:118355829-118355851 TTATTTATATATAGGGGGGAGGG - Intergenic
1014601501 6:123418712-123418734 TTCTTTATAAACCGAGAAGATGG - Intronic
1014816773 6:125944334-125944356 TTTTTTTTAAATCAGGAACAAGG - Intergenic
1015121286 6:129704272-129704294 TTTTGTATATTTAGTGAAGATGG - Intronic
1015330213 6:131969017-131969039 CTTTTTATAGATGGGGATGAGGG + Intergenic
1015972246 6:138753602-138753624 TGTGTTATTGATAGGGAAGAGGG - Intronic
1016134401 6:140521089-140521111 TACTTTATAAATAAGGATGAAGG - Intergenic
1016612302 6:146004546-146004568 ATTTTGAAAAATAGGGAGGAAGG + Intergenic
1016855146 6:148661468-148661490 ATTTTTAAAAATGGTGAAGAGGG + Intergenic
1017248676 6:152256246-152256268 TTTTTTATTTTTAGTGAAGACGG - Intronic
1017347811 6:153405196-153405218 ATTTTTGTTAATAGAGAAGAAGG - Intergenic
1017540792 6:155400368-155400390 TTTTTTTTAAATAGGGTTTAGGG - Intronic
1017861190 6:158398607-158398629 TTTTTTAAAAATTAGTAAGAAGG - Intronic
1017886805 6:158606507-158606529 GTTCTTAAAAAGAGGGAAGATGG + Intronic
1018735530 6:166684862-166684884 CTTATTATAAATTGGAAAGAAGG - Intronic
1019555458 7:1627586-1627608 TTTTTTAAAAAAAGGAAAGCAGG - Intergenic
1020192898 7:6014050-6014072 ATTTATACAAATAGGGAAAAGGG - Intronic
1020488643 7:8750730-8750752 TTTTGTATAACAATGGAAGAAGG - Intronic
1020980302 7:15058722-15058744 TTTTTTATATTTAGTGGAGACGG + Intergenic
1021048408 7:15952247-15952269 TTTTATATGAATAGGAAAGAAGG - Intergenic
1021228308 7:18054612-18054634 TTTTTTTTAAATAGGGTATCAGG + Intergenic
1021423488 7:20471967-20471989 TTTGTTGGAAATGGGGAAGAAGG - Intergenic
1021570663 7:22061837-22061859 TTTTTTTAAATTGGGGAAGATGG - Intergenic
1021650181 7:22825360-22825382 TTTTTTTTAAGTAGAGATGAGGG + Intergenic
1022843658 7:34189604-34189626 TTATTTATAAATAAGGAACATGG - Intergenic
1022937324 7:35192119-35192141 TTTTTACTAAATGGGGAAAATGG - Intergenic
1023068873 7:36407953-36407975 TTTTTTATAAATACGTAACCTGG - Exonic
1023360764 7:39413102-39413124 TCTTTTAAAAATAAGCAAGAAGG - Intronic
1023382167 7:39619885-39619907 TTTTTTTTTAATAGAGATGAGGG + Intergenic
1024912488 7:54461287-54461309 GTTTTTATAAAAAGGAAAAAAGG - Intergenic
1025818754 7:64944310-64944332 ATTTTCATAAAGAGGGAAGGGGG + Intergenic
1026228831 7:68465904-68465926 TTTTTTATATATAGAGATGGGGG - Intergenic
1026338127 7:69412214-69412236 TTTTGTAGAGATAGGGAGGAGGG - Intergenic
1026447171 7:70495079-70495101 TTTTATATAAATAGACAAGTAGG + Intronic
1027227282 7:76251755-76251777 TTTTTTTTAAATAGAGATGGGGG - Intronic
1027262224 7:76473001-76473023 TTTTTAATAAATAGAGATGGGGG + Intronic
1027271092 7:76519345-76519367 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027313604 7:76971098-76971120 TTTTTAATAAATAGAGATGGGGG + Intergenic
1027320855 7:77009280-77009302 TTTTTTAAAAAGAGGGAAGAAGG + Intergenic
1027408198 7:77885267-77885289 ATTTTTTTAAATAGAGATGAGGG + Intronic
1027613965 7:80398523-80398545 ATTTTTATAAAAAGGAAAGTTGG + Intronic
1027661260 7:80990619-80990641 TATTTTTTAAATAGAGATGAGGG - Intergenic
1027919718 7:84377604-84377626 TATTTTGTAAATAAGGAATAAGG + Intronic
1028018894 7:85746138-85746160 TTTTTCCTAAATAAGGAAGGGGG + Intergenic
1028282945 7:88955084-88955106 TTTTTTTTAAATAGAGACAAGGG - Intronic
1028293579 7:89098760-89098782 TTCTTTTTAAATGGGGATGAAGG + Intronic
1028354546 7:89889559-89889581 TTTTTTGTAAATAGTTAAAAAGG - Intergenic
1028372801 7:90113484-90113506 TTTTTACTAAATGGGGAAAATGG + Intergenic
1028453377 7:91011261-91011283 TACTTAATAAATAGGGGAGAGGG + Intronic
1028484387 7:91342205-91342227 TTTTTTATAAATAAGTAACTGGG - Intergenic
1028931648 7:96419796-96419818 TTTTGTCTAAGTAGGGAAGGTGG + Intergenic
1029058493 7:97771889-97771911 TATTTTTTAAATACGGAAGGAGG + Intergenic
1029081940 7:97981773-97981795 TTTTTTTTAAATAGAGATGGGGG - Intergenic
1029651146 7:101893179-101893201 TTTTTTTAAAATAGAGATGAGGG + Intronic
1029833485 7:103284760-103284782 TTTTTACTAAATGGGGAAAATGG - Intergenic
1030001723 7:105071629-105071651 TTTTTTTTAAGTAGAGAACAGGG + Intronic
1030270586 7:107664627-107664649 ATTTTTTTAAAAAGGGATGAGGG - Intronic
1030854737 7:114540934-114540956 TATTTTATAGATTGGGTAGAAGG + Intronic
1032105498 7:129025583-129025605 TTTTTTATAAAAATGGGACAGGG + Intronic
1032232448 7:130087027-130087049 TTTTTTATAGTTAAGGAAGCTGG + Intronic
1032614310 7:133450013-133450035 TTTTTTTTAAAGAGGGGACAAGG - Intronic
1032641783 7:133778006-133778028 TTTTTTTAAAAAATGGAAGACGG - Intronic
1033003539 7:137534929-137534951 TTTTATATAAAGAGGGAATTTGG + Intronic
1033117155 7:138635402-138635424 TTTTTTTTAAATAGAGATGGGGG + Intronic
1033397021 7:140985094-140985116 TTAGTTATAAATAGGGAAAGTGG + Intergenic
1033419141 7:141190482-141190504 TTTTTTTTATATAGAGATGAAGG + Intronic
1033525456 7:142209206-142209228 TTCTTCATAATTATGGAAGAGGG + Intronic
1033884591 7:145929618-145929640 TTTTTTTTTAATGTGGAAGATGG - Intergenic
1034294987 7:149964243-149964265 TTTTTGATGAATAAGGAATAGGG + Intergenic
1034611431 7:152373877-152373899 TTTTTTTTAAAAAGGGACAAAGG + Intronic
1034811074 7:154132703-154132725 TTTTTGATGAATAAGGAATAGGG - Intronic
1034934741 7:155191484-155191506 TTTCTTATACATAGGATAGATGG - Intergenic
1035055528 7:156032634-156032656 TATTTTAAAAATAGAGAAGGAGG + Intergenic
1037035821 8:14165407-14165429 TGTTTTCTAAATATGGAAGCTGG - Intronic
1037395292 8:18435267-18435289 TTATATATATATAGGGAAGCTGG - Intergenic
1037725187 8:21477537-21477559 CATTTTATAAATAGGGAAACTGG + Intergenic
1038134070 8:24766921-24766943 TTTTTTTTAATGAGGGAATAAGG - Intergenic
1038773073 8:30502149-30502171 TTTTTTTTAAATAAGGATGCTGG + Intronic
1038873468 8:31521482-31521504 TTTTTTAGAAACAGGGTAGGGGG + Intergenic
1038966718 8:32581634-32581656 TTTTATAGAAACATGGAAGAGGG + Intronic
1039263174 8:35795180-35795202 TTTTTGAAAAATAAGTAAGATGG - Intronic
1039449659 8:37661832-37661854 TTTTTTGGAGATAGGGATGAGGG - Intergenic
1039551549 8:38446708-38446730 TTTTTTATAAATAATGAAGAAGG - Intronic
1039654768 8:39390969-39390991 TTTTAAATAAATAGGGAAAATGG - Intergenic
1039715648 8:40105802-40105824 ATTTTTATAAATATGCAAGAAGG + Intergenic
1040391021 8:46950625-46950647 TTTTTTAGAAAGAGGAGAGAAGG - Intergenic
1041352248 8:56958972-56958994 GTTTTTAAAAATAGGAAATAAGG - Exonic
1042265313 8:66902381-66902403 TTTTTTTTAAATTGAGAAGGGGG - Intronic
1042345543 8:67723337-67723359 TTTTATTTAAATAGAGACGAGGG + Intronic
1043117265 8:76273807-76273829 TTTTTGAAAAATAGTAAAGAAGG + Intergenic
1043448157 8:80339667-80339689 TATTTTAAAAATAAGGAATATGG - Intergenic
1043889233 8:85638086-85638108 TTTCTTAAAAACTGGGAAGAGGG - Intergenic
1044132254 8:88538788-88538810 TTTCTTATTAATGTGGAAGATGG - Intergenic
1044584291 8:93855177-93855199 TTTTTTCTAAAAAGCTAAGAAGG + Intergenic
1044834147 8:96279442-96279464 TTTTTTTTAAATTTAGAAGATGG - Intronic
1044838667 8:96319214-96319236 TGTTTTCTAAAAAGGCAAGAAGG - Intronic
1045028740 8:98115561-98115583 TTTTTTTTAAATAGAGATGGGGG + Intronic
1045408179 8:101888588-101888610 TTTTTTTTTAATAGAGATGAGGG + Intronic
1045821068 8:106338610-106338632 TTTTTTAAAAAGTGGGAATAAGG - Intronic
1046015596 8:108601113-108601135 TTTTTTATAAAAAAAGAAGAAGG + Intergenic
1046080655 8:109366620-109366642 TTTTTAATAAATAGAGCAGGAGG + Intronic
1046270592 8:111891322-111891344 TTTTTTTTTAATAGAGATGAAGG + Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1047071063 8:121344132-121344154 TTTTCTATAAAAAGGAGAGATGG - Intergenic
1047406584 8:124590373-124590395 TTTTTTAAAAATAGTGATGCTGG - Intronic
1047427101 8:124756499-124756521 TGTTTTATAAATAAGGATGAAGG + Intergenic
1047479538 8:125268054-125268076 TTTTTTTTAAATAGAGATGAGGG - Intronic
1048873763 8:138820629-138820651 TTTTTTACAATCAAGGAAGAAGG + Intronic
1049124120 8:140770798-140770820 TCCTTTATAAAGAGGCAAGAGGG + Intronic
1050294655 9:4193663-4193685 TTTTGAATAACTAGGGAAGATGG + Intronic
1050932789 9:11350677-11350699 TTGTTCATAAATAGTGCAGATGG - Intergenic
1051113527 9:13667696-13667718 ATTTTTAGAAATAGGATAGAAGG - Intergenic
1051506614 9:17834182-17834204 TTTTCTAAAAACAGGGAAAAGGG - Intergenic
1051603898 9:18901134-18901156 TTTTTTTTAAATAAAGAAAAAGG - Intronic
1051807496 9:21011837-21011859 TTTTTTTTAAATGGGGGAAAGGG + Intronic
1051812029 9:21060139-21060161 TTTTATTTAACTAGGGCAGATGG + Intergenic
1052575347 9:30283434-30283456 TTGTCTCTAATTAGGGAAGAAGG + Intergenic
1052858989 9:33425143-33425165 TTTCTTGTAATTAGGGAAAAGGG - Intergenic
1052926872 9:34024494-34024516 CTTTTTATGAATAGGGAATTAGG - Intronic
1053068825 9:35088713-35088735 TTTTTTTTAAATAGTAGAGACGG + Exonic
1053089127 9:35257287-35257309 TTTTTTATAAATATAAAAAATGG - Intronic
1053451816 9:38199922-38199944 TTCTCTATAAAAAGGAAAGAAGG + Intergenic
1053504130 9:38626782-38626804 TTTTTAATATAAATGGAAGATGG + Intergenic
1053528074 9:38849358-38849380 ATTTTTATAAAGAGAGGAGATGG + Intergenic
1054200296 9:62073791-62073813 ATTTTTATAAAGAGAGGAGATGG + Intergenic
1054638059 9:67514573-67514595 ATTTTTATAAAGAGAGGAGATGG - Intergenic
1054935194 9:70679666-70679688 TATTTTATAAATAAGGAAATTGG - Intronic
1055648167 9:78380345-78380367 TGTTTTATAAATAATCAAGATGG - Intergenic
1055728366 9:79256183-79256205 TTTTTTTTAAAAAGGGGAGGCGG + Intergenic
1055790771 9:79920705-79920727 TTTGTTATAAATATGGAAGTGGG + Intergenic
1055926202 9:81512337-81512359 TTTTTTAAAAAGAGGGCAGGAGG + Intergenic
1056004946 9:82258996-82259018 TTATCTATATATAGGTAAGAAGG - Intergenic
1056120339 9:83481542-83481564 ATTTTAAAAAATATGGAAGAGGG + Intronic
1056480213 9:86995774-86995796 TTATTTATACAGAGGGAGGAGGG - Intergenic
1057095189 9:92300390-92300412 TCATTTATAAATAGACAAGAGGG - Intronic
1057152246 9:92806812-92806834 TTTTTAATATAAATGGAAGATGG - Intergenic
1057374568 9:94508005-94508027 TTTTGTGTAAATATGGAACAAGG - Intergenic
1057457140 9:95224718-95224740 TTTTTAATATATAGGAATGAGGG + Intronic
1057568708 9:96187052-96187074 TTTTTTAAAAAAAGAGAGGATGG - Intergenic
1057750237 9:97786956-97786978 TACTTTATAAATAGGGAATAAGG - Intergenic
1057925089 9:99139184-99139206 TTTTTTTTAAATAGGAAAGCTGG - Intronic
1058738072 9:107914558-107914580 ATTTTTAAAAATAAGGAACACGG - Intergenic
1058891426 9:109364556-109364578 TTTTTTAAAAATAGAGACGGGGG - Intergenic
1059265812 9:113029375-113029397 TTTTCTATAAAGTGGTAAGAAGG - Intergenic
1059316682 9:113431508-113431530 TTTTTTATAATCAGGAAAGTTGG + Intergenic
1059824478 9:118012668-118012690 TTTTTTAAAAAAAGGCAAAAAGG + Intergenic
1060139237 9:121192216-121192238 TTTTTTTTAAACAGGGGACATGG - Exonic
1060899478 9:127245046-127245068 TTAGTGATAAAGAGGGAAGACGG - Intronic
1061223431 9:129266015-129266037 TTTTGTTTAAATGGTGAAGATGG - Intergenic
1186409220 X:9331425-9331447 TTTTTTTTAAATAAGGGAGAAGG - Intergenic
1187167294 X:16815833-16815855 TTTTTTTTAATTGGGGAAAATGG + Intronic
1187573766 X:20532476-20532498 TTTTTTCTAACTGGGGAATATGG + Intergenic
1188192228 X:27186134-27186156 TTTCTTATAAATGGTGATGATGG - Intergenic
1188979685 X:36715896-36715918 TTTGGTATACATTGGGAAGAGGG + Intergenic
1189533632 X:41912934-41912956 CTTTTTATAAATGAGGAAGCAGG + Intronic
1189910387 X:45805036-45805058 TTTCTTATGAAAAGGAAAGATGG + Intergenic
1190027126 X:46934733-46934755 TTTCTTATAAACATAGAAGAAGG - Intronic
1190886369 X:54534051-54534073 TTTTTTTTCAATAGAGATGAGGG + Intronic
1192474260 X:71426158-71426180 TTTTTTGTAAATAGAGATGGGGG + Intronic
1192577093 X:72251683-72251705 TTTTTTCGAGGTAGGGAAGAAGG + Intronic
1192840244 X:74847748-74847770 CTTTTTAAAAATAATGAAGAAGG - Intronic
1193264396 X:79451643-79451665 TTTCTTATAAATAAGGAAAAGGG - Intergenic
1193534556 X:82697038-82697060 ATTTTTAAAAATATGGAACACGG - Intergenic
1193572315 X:83159869-83159891 TTTTTTATAAATGGCCAAGGGGG - Intergenic
1193750005 X:85329639-85329661 TTTTTTAAAAAAAGAGAATAAGG + Intronic
1193843248 X:86435816-86435838 TTATTTGTAAAAAGGGGAGACGG - Intronic
1194234537 X:91365963-91365985 TTATTTTTAATTAGGGAAGAAGG + Intergenic
1194425115 X:93727488-93727510 TTATTTCCAAAAAGGGAAGATGG + Intergenic
1195219053 X:102729212-102729234 TTTTTTTTAAAAAATGAAGAAGG - Intronic
1195246808 X:103002367-103002389 TGTTTTATAGAATGGGAAGATGG - Intergenic
1196732940 X:118959617-118959639 TTCTTTAGAAATTGGCAAGATGG + Intergenic
1196745520 X:119068566-119068588 TTTGTTATAAACTTGGAAGAGGG + Intergenic
1196992243 X:121343281-121343303 TTTCTTCAAAATAGGGAAGGAGG + Intergenic
1197242198 X:124132167-124132189 TTATTAATAAATAGGGAAATAGG - Intronic
1197474873 X:126909587-126909609 TTTTGTATAAATTGTAAAGAAGG - Intergenic
1197652541 X:129081553-129081575 TTTTTTATTAATAGGAGACAAGG + Intergenic
1198237826 X:134752250-134752272 TTTTTTTTAGAGAGGGAAGTGGG + Intronic
1198656537 X:138920029-138920051 TTTTTTAAAAATTAAGAAGAGGG + Intronic
1198924973 X:141779657-141779679 TTTTTTATATATACTGAGGAAGG + Intergenic
1199067544 X:143437776-143437798 ATTTTTATAAATAGTAAAGGCGG + Intergenic
1200873971 Y:8133669-8133691 TTTTTTTTAAACACAGAAGATGG + Intergenic
1201663803 Y:16426801-16426823 ATCTATATATATAGGGAAGAAGG - Intergenic