ID: 922688282

View in Genome Browser
Species Human (GRCh38)
Location 1:227665043-227665065
Sequence TGGTATAATCCCCATTGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922688282_922688286 1 Left 922688282 1:227665043-227665065 CCTACCCAATGGGGATTATACCA 0: 1
1: 0
2: 1
3: 5
4: 71
Right 922688286 1:227665067-227665089 CATCTTCCTAGAAAATTCTTCGG 0: 1
1: 1
2: 0
3: 36
4: 335
922688282_922688287 2 Left 922688282 1:227665043-227665065 CCTACCCAATGGGGATTATACCA 0: 1
1: 0
2: 1
3: 5
4: 71
Right 922688287 1:227665068-227665090 ATCTTCCTAGAAAATTCTTCGGG 0: 1
1: 0
2: 3
3: 25
4: 323
922688282_922688289 25 Left 922688282 1:227665043-227665065 CCTACCCAATGGGGATTATACCA 0: 1
1: 0
2: 1
3: 5
4: 71
Right 922688289 1:227665091-227665113 TACAAATGAGACAAAACTCATGG 0: 1
1: 0
2: 1
3: 28
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922688282 Original CRISPR TGGTATAATCCCCATTGGGT AGG (reversed) Intronic
901664656 1:10819497-10819519 TGGTAGAAGCCCCATTGGGTGGG + Intergenic
908257553 1:62315407-62315429 TGCCATAATCCCCAATGTGTAGG - Intronic
914938239 1:151999564-151999586 AGGAATAAGCCCCATTGTGTGGG + Intergenic
918314736 1:183313779-183313801 AGGTATATTTCCCATTGGCTGGG - Intronic
921667619 1:217891532-217891554 TGGAATAATTCCCATTGTGGTGG + Intergenic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
924546032 1:245028934-245028956 TGGTATGATTCCCATGGAGTGGG + Intronic
1064818869 10:19300704-19300726 TGTTTTAATCCACATTGAGTTGG - Intronic
1066689288 10:38010780-38010802 TGGGGTAAGCCCCAGTGGGTTGG + Exonic
1070898011 10:80001991-80002013 TGGTAAAATCCCTGTTGGGAAGG - Intergenic
1079119400 11:17671215-17671237 TGGTCTAAACCCATTTGGGTTGG + Intergenic
1079392972 11:20038309-20038331 TGGTTTACTACTCATTGGGTAGG + Intronic
1081523219 11:43903090-43903112 TGGTATAATTTCCATTGATTAGG + Intronic
1082085554 11:48046730-48046752 TGTAATAATCCACATAGGGTAGG - Intronic
1084371421 11:68747196-68747218 TAGCATAATTACCATTGGGTTGG + Exonic
1104468237 12:129007432-129007454 TTGTATTATGCCCATTGTGTAGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106665627 13:31847377-31847399 TGGAAGAATCCCCCTTGGGGAGG + Intergenic
1106977053 13:35231665-35231687 TTGTTTAATCCTCACTGGGTAGG + Intronic
1111376669 13:87388357-87388379 TGGATTAATCCACATTTGGTTGG + Intergenic
1112884376 13:104150728-104150750 TGGTAAAATCTCCATGGGTTAGG - Intergenic
1120209437 14:81620425-81620447 TGGTATATTTTCCATTGTGTAGG + Intergenic
1120763005 14:88302975-88302997 TGGTATTATCCTTATTGGCTTGG - Intronic
1121006413 14:90493418-90493440 TCGTCTAATCCCCATTGTGATGG + Intergenic
1134832141 16:17332208-17332230 GGGTGTTATCCCCATAGGGTGGG + Intronic
1138592927 16:58012345-58012367 TGGTTTAAGCCACTTTGGGTTGG - Intronic
1151174772 17:72278201-72278223 TGGTATAATCATCAATGGATTGG + Intergenic
1155431373 18:25762992-25763014 TTGTATAATCCCCATAGATTTGG - Intergenic
1155951321 18:31916328-31916350 TGGTATAAACCACTTGGGGTAGG + Exonic
1168541805 19:57218799-57218821 TTGTTTAATTTCCATTGGGTGGG + Exonic
931916798 2:66964945-66964967 CTGTATAATACCCATAGGGTTGG + Intergenic
934098660 2:88630346-88630368 TAGTATAATCCCTTTTAGGTGGG - Intergenic
936846080 2:116835101-116835123 TGTTTTGATCCCCATTTGGTTGG + Intergenic
939737249 2:145862956-145862978 TGGTATTAAAGCCATTGGGTTGG - Intergenic
941683222 2:168421324-168421346 TGGAATAATCGCCATTTGGTGGG + Intergenic
944015947 2:195037399-195037421 TGGTATAAACCCCTTTGGTTTGG + Intergenic
944737012 2:202576186-202576208 TGGAATAATAGACATTGGGTGGG - Intergenic
945489896 2:210442689-210442711 TGGTAAACTCACCATTGGTTTGG - Intronic
945621009 2:212137067-212137089 TTCTATAATCTCCAGTGGGTTGG + Intronic
946430817 2:219626660-219626682 TGTTATGATTCCCATTTGGTCGG - Intergenic
1169618492 20:7477405-7477427 TGGCATAATCCCAGGTGGGTGGG - Intergenic
1173393753 20:42658999-42659021 TTGTATAATCTCCATGTGGTGGG + Intronic
1180243029 21:46524469-46524491 TGGTCTTATCTCCTTTGGGTCGG + Intronic
954959489 3:54551441-54551463 TGATTTAATACCCTTTGGGTGGG + Intronic
955690426 3:61585411-61585433 TGGTACTATAGCCATTGGGTGGG + Intronic
960421115 3:117446866-117446888 TGTTATAATCCCAAATGGCTTGG + Intergenic
961961523 3:130860560-130860582 TGGTATTATCCCCATTTTGTGGG + Intronic
962912206 3:139863249-139863271 TGGGATAATGCCTATTGTGTAGG - Intergenic
972839412 4:42913686-42913708 TGATATTTTCCCCATTGGCTTGG - Intronic
973852823 4:54977789-54977811 TGGCAGAATCCCCCATGGGTTGG + Intergenic
980560993 4:134475468-134475490 TGGAAAAAGCACCATTGGGTTGG + Intergenic
985906616 5:2842617-2842639 TGGGAGATTCCCCATCGGGTAGG - Intergenic
989575878 5:42987629-42987651 TGGTTTATTCCCAGTTGGGTAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
999912908 5:156224968-156224990 AGGTATATTTCCCATTAGGTTGG + Intronic
1000308398 5:160017504-160017526 TGAAATAATCCCCATTGTGTTGG - Intronic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1006115669 6:31774989-31775011 GGGCATAATCCCCATAGGATTGG - Intronic
1016628312 6:146198558-146198580 TGAAAAAATCACCATTGGGTAGG + Intronic
1018811727 6:167303095-167303117 TGGAATGAACCCCTTTGGGTGGG + Intronic
1019006777 6:168804627-168804649 TGGTACAAACTCCATTGTGTTGG - Intergenic
1019564236 7:1671632-1671654 TGGGGGAAACCCCATTGGGTTGG + Intergenic
1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG + Intronic
1032794159 7:135264095-135264117 TGGAAAAATCACCATTGGATTGG + Intergenic
1040022220 8:42750921-42750943 TGGTATAATTACCATTGTGTTGG - Intergenic
1052440015 9:28484227-28484249 TGGTATACTCCACATTGAATGGG - Intronic
1056106391 9:83350803-83350825 CTGTAGAATCCCCATTGGTTGGG - Intronic
1057275807 9:93675489-93675511 TGGCATCTTCCCCCTTGGGTGGG + Intronic
1059027612 9:110652498-110652520 TGGTATAATACCTATGAGGTAGG - Intergenic
1185850835 X:3484967-3484989 TGGCATATTCTTCATTGGGTGGG - Intergenic
1187410869 X:19049491-19049513 CGCTATCATCCCCATTGGGGTGG - Intronic
1189287454 X:39861603-39861625 TGGACAAATCCCCATTGTGTGGG + Intergenic
1189336021 X:40171482-40171504 AGGTTTAATCCCCATGGGGGGGG + Intronic
1191117479 X:56866792-56866814 TGATATGCTCCCCAGTGGGTAGG - Intergenic
1192134532 X:68584547-68584569 TGGCCTAATCCCCATGAGGTTGG - Intergenic
1195235543 X:102893950-102893972 TGGTACAATCCCTGTTGGGGGGG - Intergenic
1198510331 X:137344020-137344042 TGGTAGAATTGTCATTGGGTTGG - Intergenic
1201519435 Y:14857132-14857154 TGGTAAAATCCTGGTTGGGTTGG - Intergenic