ID: 922691025

View in Genome Browser
Species Human (GRCh38)
Location 1:227691198-227691220
Sequence CTAGGTCTACACTACAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922691022_922691025 4 Left 922691022 1:227691171-227691193 CCACAGGTCTATTTATTCATCTC No data
Right 922691025 1:227691198-227691220 CTAGGTCTACACTACAGGATTGG No data
922691021_922691025 12 Left 922691021 1:227691163-227691185 CCTTAACTCCACAGGTCTATTTA No data
Right 922691025 1:227691198-227691220 CTAGGTCTACACTACAGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922691025 Original CRISPR CTAGGTCTACACTACAGGAT TGG Intergenic
No off target data available for this crispr