ID: 922693543

View in Genome Browser
Species Human (GRCh38)
Location 1:227713608-227713630
Sequence CCGTGGGTTGCACAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922693543_922693554 14 Left 922693543 1:227713608-227713630 CCACAAAACTGTGCAACCCACGG No data
Right 922693554 1:227713645-227713667 CTCGGGAGCCCACGCCACTGGGG No data
922693543_922693548 -4 Left 922693543 1:227713608-227713630 CCACAAAACTGTGCAACCCACGG No data
Right 922693548 1:227713627-227713649 ACGGATCGGAAGATCCCACTCGG No data
922693543_922693555 20 Left 922693543 1:227713608-227713630 CCACAAAACTGTGCAACCCACGG No data
Right 922693555 1:227713651-227713673 AGCCCACGCCACTGGGGCCTTGG No data
922693543_922693549 -3 Left 922693543 1:227713608-227713630 CCACAAAACTGTGCAACCCACGG No data
Right 922693549 1:227713628-227713650 CGGATCGGAAGATCCCACTCGGG No data
922693543_922693552 12 Left 922693543 1:227713608-227713630 CCACAAAACTGTGCAACCCACGG No data
Right 922693552 1:227713643-227713665 CACTCGGGAGCCCACGCCACTGG No data
922693543_922693553 13 Left 922693543 1:227713608-227713630 CCACAAAACTGTGCAACCCACGG No data
Right 922693553 1:227713644-227713666 ACTCGGGAGCCCACGCCACTGGG No data
922693543_922693556 21 Left 922693543 1:227713608-227713630 CCACAAAACTGTGCAACCCACGG No data
Right 922693556 1:227713652-227713674 GCCCACGCCACTGGGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922693543 Original CRISPR CCGTGGGTTGCACAGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr