ID: 922696537

View in Genome Browser
Species Human (GRCh38)
Location 1:227733751-227733773
Sequence ACCCCTCCTTCAGTTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922696537_922696547 14 Left 922696537 1:227733751-227733773 CCTGGTCCAACTGAAGGAGGGGT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 922696547 1:227733788-227733810 AAGGGATGGCACCCACTGTGAGG 0: 1
1: 0
2: 4
3: 13
4: 138
922696537_922696541 -5 Left 922696537 1:227733751-227733773 CCTGGTCCAACTGAAGGAGGGGT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 922696541 1:227733769-227733791 GGGGTGGCCCCTTGGTCTCAAGG 0: 1
1: 0
2: 2
3: 20
4: 166
922696537_922696543 0 Left 922696537 1:227733751-227733773 CCTGGTCCAACTGAAGGAGGGGT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 922696543 1:227733774-227733796 GGCCCCTTGGTCTCAAGGGATGG 0: 1
1: 0
2: 0
3: 10
4: 161
922696537_922696542 -4 Left 922696537 1:227733751-227733773 CCTGGTCCAACTGAAGGAGGGGT 0: 1
1: 0
2: 0
3: 7
4: 108
Right 922696542 1:227733770-227733792 GGGTGGCCCCTTGGTCTCAAGGG 0: 1
1: 0
2: 0
3: 8
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922696537 Original CRISPR ACCCCTCCTTCAGTTGGACC AGG (reversed) Intronic
902077669 1:13800775-13800797 AACCCTCCTTCAGTGAGAGCCGG - Intronic
902451781 1:16500926-16500948 AGCCCTCCTGCAGTTGGGCCAGG - Intergenic
902501167 1:16912739-16912761 AGCCCTCCTGCAGTTGGGCCAGG + Intronic
904428724 1:30448161-30448183 TCCCCTCCTACATTTGGTCCTGG + Intergenic
905548703 1:38818945-38818967 ACCCGTCCTTCACTGAGACCCGG + Intergenic
906780965 1:48572674-48572696 ACCCCCCCTTCAGTTCTCCCAGG - Intronic
915445785 1:155974262-155974284 ACCTCTCCTCCAGCTGTACCTGG + Intronic
915938663 1:160104317-160104339 ACCCTTGTTTCAGTTGGAACAGG - Intergenic
918178676 1:182067591-182067613 ACCACTGCCTCAGTAGGACCTGG - Intergenic
919177148 1:194033311-194033333 ACCCCTACATCAGTGTGACCTGG - Intergenic
920669399 1:207991617-207991639 TCCTCTCCTTCAGTGGGACTGGG - Intergenic
922696537 1:227733751-227733773 ACCCCTCCTTCAGTTGGACCAGG - Intronic
1065109047 10:22422194-22422216 ACACCTCTTCCAGTTGGCCCTGG - Intronic
1069423487 10:68268828-68268850 ATCCCTCCTTCAGTTGTGCTTGG - Intergenic
1070734170 10:78852138-78852160 GCCCCTCCTGCTGTTGGTCCAGG - Intergenic
1071907378 10:90188618-90188640 TCCCCTTCTTCAGTGGAACCTGG - Intergenic
1076734096 10:132451082-132451104 AGCCCTCCCTCAGCTGGCCCAGG - Intergenic
1082030490 11:47599958-47599980 GCCCCTTCTGCAGATGGACCAGG + Intergenic
1082160314 11:48882637-48882659 ACCCTTCTTTCAGTTGGCTCTGG - Intergenic
1082162052 11:48897769-48897791 ACCCTTCTTTCAGTTGGCTCTGG + Intergenic
1082167638 11:48966214-48966236 ACCCTTCTTTCAGTTGGGTCTGG + Intergenic
1082235911 11:49820436-49820458 ACCCTTCTTTCAGTTGGGTCTGG - Intergenic
1082239372 11:49854992-49855014 ACCCTTCTTTCAGTTGGGTCTGG - Intergenic
1082242775 11:49889360-49889382 ACCCTTCTTTCAGTTGGGTCTGG + Intergenic
1082657268 11:55870169-55870191 ACCCTTCTTTCAGTTGGGTCTGG + Intergenic
1082757389 11:57091677-57091699 ACTCCTCCTTCCACTGGACCTGG + Intergenic
1088503311 11:110506056-110506078 AGCCTTCCTTCAGCTGGACCTGG - Intergenic
1090057760 11:123438256-123438278 AGCCTTGCTTCTGTTGGACCAGG - Intergenic
1090234913 11:125140046-125140068 CCCCCTCCTTCATGTGGAGCTGG + Intergenic
1090379203 11:126313321-126313343 ACCCCTCCCTCAGGAGGTCCGGG - Intronic
1090411365 11:126512042-126512064 GCCCCTCCCTCAGTTGGCTCTGG + Intronic
1091652113 12:2318455-2318477 AGGCCTCCATCCGTTGGACCTGG + Intronic
1091665339 12:2414844-2414866 ACCCTGGCTTCAGTTGGACAGGG + Intronic
1092055818 12:5507208-5507230 ACCCATCCTTCAGGAGGCCCCGG + Intronic
1092104974 12:5914852-5914874 ACCCCTCCCTCAGGTGCCCCTGG + Intronic
1094493592 12:30976197-30976219 ACCCCTCATGCTGTGGGACCTGG + Intronic
1096659260 12:53113546-53113568 GCCCAACCTTCAGTTTGACCTGG - Intronic
1099070032 12:78034403-78034425 ACTGCTCATTCAGTTGGACTCGG - Intronic
1101578219 12:106017535-106017557 ACCCATATTTCAGTAGGACCTGG + Intergenic
1103520795 12:121536200-121536222 ACCTCGCTTTCAGGTGGACCGGG + Intronic
1104195659 12:126534850-126534872 TCTCCTACTTCAGTTGGAGCTGG + Intergenic
1106407236 13:29484588-29484610 GGCCCTCCTTCACTTGGTCCAGG - Intronic
1106457978 13:29944262-29944284 ACCCCTCCTTCTGGCTGACCAGG + Intergenic
1108455781 13:50612154-50612176 ACCCCTCATTCCTCTGGACCTGG + Intronic
1110117151 13:71833216-71833238 ACCCATCCCTCAGTGGGTCCTGG - Intronic
1113900679 13:113795129-113795151 ACCTCTCCTTCTGTTGCAGCTGG + Exonic
1115641438 14:35337916-35337938 ACCTCTCCTTCATTAGGAGCAGG - Intergenic
1116293565 14:43074364-43074386 ACCCCTCCATCAGTGTGACCTGG + Intergenic
1119587268 14:75848106-75848128 CCCCTTCCTTCAGTTGGCCAAGG - Intronic
1121626918 14:95392329-95392351 ACCCCAGCTTCAGTTGAGCCCGG + Intergenic
1122540709 14:102496313-102496335 TCCCACCCCTCAGTTGGACCAGG - Intronic
1126243439 15:46473283-46473305 ACTGCTCCTTCAGTTGGAATTGG + Intergenic
1126849905 15:52790473-52790495 CCCCCTCCTTCATTTGTACCGGG - Intronic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1127678277 15:61266492-61266514 ACCCCCACTTTTGTTGGACCTGG + Intergenic
1128684249 15:69671951-69671973 ACCCCTCCTTCACTCAGAACAGG + Intergenic
1130684381 15:86024044-86024066 ACTCCTCATTCTGTTGGACTTGG - Intergenic
1141860168 16:86710972-86710994 CCCCTTCCTTCAGATGGAGCAGG + Intergenic
1143868197 17:9939338-9939360 AGACCTCCTTGAGTGGGACCTGG - Intronic
1144086129 17:11810233-11810255 ACCATTCCTACAGATGGACCTGG + Exonic
1146789941 17:35745486-35745508 ATCCCTCCTTAAAGTGGACCTGG - Exonic
1148797204 17:50202735-50202757 GCCCCTTCTCCAGTTGTACCTGG + Intergenic
1152317354 17:79588912-79588934 CCCCGTCCTGCACTTGGACCTGG + Intergenic
1152717092 17:81905438-81905460 ACTCCTTCTCCAGGTGGACCTGG - Exonic
1153603347 18:6805122-6805144 ACCCCTCTTTCAGCTGGGCATGG - Intronic
1156207572 18:34903104-34903126 ACTCATCCTTCAGTTAGGCCTGG - Intergenic
1160188020 18:76690661-76690683 TCCCCTCACCCAGTTGGACCTGG + Intergenic
1160903871 19:1443002-1443024 CCCTCTCCTTGAGCTGGACCTGG - Intergenic
1161591171 19:5129768-5129790 CCCCCTCCTCCAGATGGAGCAGG + Intronic
1162664909 19:12202279-12202301 ACCCCTCCTTCAATTGATGCTGG + Intergenic
1163751414 19:19080436-19080458 CCTCTTCCTTCATTTGGACCAGG + Intronic
1166294331 19:41881537-41881559 ACCAGTCCTTCAGTTGGTCTGGG - Intergenic
1166829289 19:45629033-45629055 ACCCACCCTTCTGTTGGGCCTGG + Intronic
927736320 2:25525847-25525869 ACCCCTCCTTCAGAGGTTCCAGG - Intronic
930326150 2:49921428-49921450 ACCACTGCTCCAGTTGCACCAGG + Exonic
931068833 2:58621335-58621357 AGCCCTTCTTCAGTTGCTCCAGG + Intergenic
934052686 2:88223605-88223627 TCCACTCCTTCATTGGGACCTGG + Intergenic
943432953 2:187826981-187827003 ACCACTATTTCAGTAGGACCTGG + Intergenic
946171752 2:217899768-217899790 TCCCCTCCTTCCCTTAGACCTGG - Intronic
946566585 2:220972292-220972314 ACCCCTCCTTAAATTGATCCTGG + Intergenic
948570437 2:238914104-238914126 CCCCCTCTTTCAGATGGTCCTGG - Intergenic
1170922462 20:20691709-20691731 CCCCTTCCTTCTGATGGACCAGG - Intronic
1175299337 20:57931958-57931980 ACACCTGCTTCAGCTGGGCCTGG - Intergenic
1179343503 21:40534518-40534540 ACCCCGCCTTGATGTGGACCTGG + Intronic
1179708184 21:43194457-43194479 CCCACTCCTTCAGGTGGCCCAGG - Intergenic
1180038771 21:45265069-45265091 TGCCCTCCGTCAGGTGGACCCGG - Exonic
1181424221 22:22822667-22822689 ACCCCACCCTCACTTGGGCCTGG - Intronic
1183484985 22:38083867-38083889 GCCCCTCCTCCACTAGGACCAGG + Intronic
1183880713 22:40825991-40826013 ACCCGTATTTCAGTAGGACCTGG - Exonic
1184781498 22:46651904-46651926 AGCCCTCCTTTAGTGGGTCCAGG - Intronic
957521476 3:81324048-81324070 ACCCTTGCTTCAGTAGAACCTGG + Intergenic
960630769 3:119728332-119728354 ACCCCTGATTCAGTAGGTCCTGG - Intronic
960720970 3:120624026-120624048 ACCAGTCCCTGAGTTGGACCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
980133221 4:128835716-128835738 GCCTCTCCTTCACTTGGACATGG - Intronic
980739171 4:136928766-136928788 ACCTCTCCTTCTGTTGTTCCTGG - Intergenic
981913620 4:150010240-150010262 ACCAGTCCTTCTGTTAGACCAGG - Intergenic
982229310 4:153193998-153194020 ACGCCTCATTCAGTTTGTCCAGG - Intronic
982628085 4:157793446-157793468 ACTCCTCCTATAGTTGGACCTGG - Intergenic
984908863 4:184653221-184653243 CCCCCTCCTTCAGCTGCTCCTGG + Intronic
986733695 5:10653074-10653096 ACCCTTCTTTCAGTTGGGTCTGG - Intergenic
995857379 5:116607693-116607715 ACCCCACCCTCAGTGGGAACAGG + Intergenic
998471586 5:142387922-142387944 ACTCCTGCCTCAGTTGAACCCGG - Intergenic
1006570797 6:35002335-35002357 AGCCCTGCTTCAGTTACACCCGG + Intronic
1008060331 6:46990158-46990180 ACCCCTCCTCCACTTTGCCCAGG + Intergenic
1008076785 6:47153945-47153967 ACCTCTCCTTCAGTGGGTTCTGG + Intergenic
1015900749 6:138063217-138063239 ACTCCTGCTCCAGTTTGACCTGG - Intergenic
1021844778 7:24753964-24753986 ATCCTTCATTCATTTGGACCTGG - Intronic
1023513340 7:40976601-40976623 ACCCCTCCTTCAATTTTTCCAGG + Intergenic
1028419035 7:90611666-90611688 ACCCATCATTCTGTTGGAGCAGG - Intronic
1032588304 7:133168855-133168877 ACCCATATTTCAGTAGGACCTGG - Intergenic
1048615197 8:136066735-136066757 ACCCCTCCTTTATTTGTAGCAGG + Intergenic
1060490921 9:124083513-124083535 ACCCCTACTTCAGCTGGCCCTGG + Intergenic
1189850122 X:45169506-45169528 ACCTCTCCTCCAGCTGGCCCAGG + Intronic
1190438267 X:50449289-50449311 TCCCCTCCTTAAGTGGAACCTGG + Intronic
1201244189 Y:11986877-11986899 ACCCCTCCTGCAGCTGGGCAGGG + Intergenic