ID: 922697496

View in Genome Browser
Species Human (GRCh38)
Location 1:227738361-227738383
Sequence AGAAAAGCCGGCTCTACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922697496 Original CRISPR AGAAAAGCCGGCTCTACACC AGG (reversed) Intronic
903342468 1:22663062-22663084 ACAAAAGCAGGCTCCAAACCTGG - Intergenic
906137414 1:43509046-43509068 TGCAAACCTGGCTCTACACCTGG + Intergenic
906749012 1:48242257-48242279 AGCAATTCCTGCTCTACACCAGG - Intronic
918352617 1:183673033-183673055 AAAAAACACTGCTCTACACCAGG - Intronic
920521287 1:206628947-206628969 AGAAAAGCCTGCTCTTGTCCTGG - Intergenic
920790809 1:209088746-209088768 ACAAAAGTCTGCTCTAAACCTGG + Intergenic
922697496 1:227738361-227738383 AGAAAAGCCGGCTCTACACCAGG - Intronic
1063186486 10:3656645-3656667 ACAAAAGCCTACTCTCCACCAGG - Intergenic
1070701128 10:78602439-78602461 AGAAATGCCTGCTCTGCACCAGG + Intergenic
1076036471 10:127202443-127202465 AGAAAAGCCTCCTGTGCACCGGG - Intronic
1076199152 10:128544563-128544585 AGAAAGGCTGGCTCTACACTTGG - Intergenic
1076413870 10:130271186-130271208 AGGCAAGGCGGCTCTACAACTGG + Intergenic
1078030444 11:7745637-7745659 AGAAAAGTCAACTCTAGACCAGG - Intergenic
1078202256 11:9194193-9194215 AGCCAAGTCTGCTCTACACCTGG + Intronic
1079106654 11:17576378-17576400 AGAAAAGCCAGCCTGACACCAGG - Intronic
1080694574 11:34590563-34590585 AGATAAGCAGACTCTATACCTGG + Intergenic
1085150927 11:74252390-74252412 AGAAAACCCTGCTCTAGGCCAGG - Intronic
1086972780 11:93101693-93101715 AGAAAAGTCAGCTCTTGACCAGG + Intergenic
1091330147 11:134725584-134725606 AGAAAAGCAATCTCTGCACCTGG + Intergenic
1093464603 12:19437099-19437121 AGAGAAGTCTGCTCTATACCTGG + Intronic
1093500004 12:19800964-19800986 AGAAAAGCCGGTTTTACCCTAGG + Intergenic
1093964510 12:25310746-25310768 AGAACAGACGGCTCTGCAACAGG + Intergenic
1100441262 12:94619268-94619290 AGAAAATCCTGCTCTAGATCAGG - Intronic
1114588932 14:23841438-23841460 AGAAAAGTCTTCTCTACTCCTGG - Intergenic
1115197959 14:30822234-30822256 AGATAAGCAGGAACTACACCTGG - Intergenic
1115405122 14:33006329-33006351 AGGACAGCCAGCTTTACACCAGG - Intronic
1122384129 14:101332419-101332441 AGAAAAGCCGGCTCTGGCCCCGG - Intergenic
1126795784 15:52259791-52259813 GGAAAAGCTGCCTCTCCACCTGG + Intronic
1131006423 15:88982411-88982433 AGATAAGCTGGCTCTAGACAAGG + Intergenic
1146317038 17:31815459-31815481 AGAAAAGCTGCCTGTCCACCAGG - Intergenic
1149489105 17:57069198-57069220 AAAAAAACGGGCCCTACACCTGG - Intergenic
1150457583 17:65319929-65319951 AGAAAAGGTGGCTATAAACCAGG - Intergenic
1151447169 17:74174834-74174856 AGAAGAGCCTCCTCTACACTGGG + Intergenic
1152111175 17:78358549-78358571 AGAGGGGCCGGCTCAACACCAGG + Exonic
1154366993 18:13720322-13720344 ACAAAAGGCGCCTCTACAACAGG - Intronic
1154388551 18:13917100-13917122 ACAACAGCCCGCTTTACACCAGG - Intergenic
1156348107 18:36276515-36276537 TTAAAAGCCTGCTCTACACATGG + Intergenic
1157112119 18:44831036-44831058 AGAAAAGACAGCTCTATACAAGG - Intronic
1162000643 19:7742872-7742894 AGAAAAACAAGCTCTACACCAGG + Exonic
934861754 2:97769493-97769515 AGAAAACCCTGCTCCACAGCTGG - Intronic
945368381 2:208985045-208985067 AGAAAAACTGGTTATACACCAGG - Intergenic
948165046 2:235854540-235854562 GGCAAAGCCAGCTCTACAGCAGG + Intronic
948489564 2:238303762-238303784 AGAAAAGCCGTTTCTAGCCCTGG + Intergenic
949049930 2:241892253-241892275 AGAAATGCCCTCTGTACACCAGG + Intergenic
1168787314 20:551086-551108 AGCAGAGCCTGCTCTCCACCTGG - Intergenic
1175913676 20:62416003-62416025 AGAAAAGCCGGGCCCACTCCTGG + Intronic
1179383493 21:40920841-40920863 AGAAAAGAAGGCTCTGCAACAGG + Intergenic
1182101225 22:27658945-27658967 AGGAAAGCCTACTCTTCACCAGG - Intergenic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1185152094 22:49169647-49169669 AGAAAATCCGTCTCCACTCCGGG + Intergenic
952173347 3:30834181-30834203 ACAAAAGTTGGCTGTACACCAGG + Intronic
960003586 3:112759399-112759421 AGATAATCAGGCTCTAGACCAGG + Intronic
961001658 3:123378293-123378315 AGAACAGCAGGGTCTACACCAGG + Intronic
963800515 3:149671227-149671249 AGAAGAAACGGGTCTACACCTGG + Intronic
968958683 4:3731704-3731726 AGAAAAACCCGCTCAACAGCAGG - Intergenic
971172369 4:24246812-24246834 AGAAAAGCAGGCTCTAGAGCAGG - Intergenic
978622980 4:110652701-110652723 ACACAAGCAGGCTCTTCACCAGG + Intergenic
987108111 5:14660794-14660816 AGAAGAGAAGGCTCTACAACAGG - Intergenic
993825920 5:92686404-92686426 AGAAAAGACAGCTGTCCACCTGG + Intergenic
998342580 5:141431368-141431390 AGAAAAGGCTGCTCACCACCTGG + Exonic
1000239238 5:159394144-159394166 AGATAAGCAGGCACCACACCTGG + Intergenic
1001213157 5:169829825-169829847 AAAAAAGCAGGCTCTAAACAAGG - Intronic
1007220521 6:40275328-40275350 GGAAAAGTCTCCTCTACACCTGG - Intergenic
1007313575 6:40966105-40966127 AGAAAAGCAGGCTCTATTCATGG + Intergenic
1013362756 6:109410022-109410044 AGAGAAGCGGGCCCTACACGAGG - Intronic
1014587657 6:123219843-123219865 AGTAAAGCCGGCCCTGCACAAGG + Intronic
1019557811 7:1641324-1641346 AGAACAGCCGGCTGTTCCCCAGG + Intergenic
1024186557 7:46954191-46954213 TGAAACGCTTGCTCTACACCAGG - Intergenic
1024720582 7:52133626-52133648 AGAAGCTCAGGCTCTACACCTGG + Intergenic
1026061987 7:67034612-67034634 AGAAAAGCAGTCTGTAGACCAGG - Intronic
1026716363 7:72792828-72792850 AGAAAAGCAGTCTGTAGACCAGG + Intronic
1031991515 7:128202025-128202047 GGAAAAGCAGGCTCTTCGCCTGG + Intergenic
1033568808 7:142606807-142606829 ACAAAAGCCAGCTCTACAATTGG - Intergenic
1037152375 8:15653586-15653608 AGACAAGGCAGTTCTACACCAGG - Intronic
1048639043 8:136332413-136332435 ATAAATGCCAGCTCTTCACCTGG - Intergenic
1050113697 9:2241965-2241987 AGAAAAGCAGGCGCTGCTCCCGG - Intergenic
1053800450 9:41760702-41760724 AGAGAAGCCGCTTCTACATCAGG + Intergenic
1054188880 9:61972854-61972876 AGAGAAGCCGCTTCTACATCAGG + Intergenic
1057648187 9:96896717-96896739 ATAAAAGCAGGCTCTGCAACAGG + Intergenic
1062476374 9:136729387-136729409 AGACAAGCTGGCTCTGCCCCGGG + Intergenic
1190014616 X:46816307-46816329 AGAAGAGCTGGCTCTAAACTGGG + Intergenic