ID: 922698025

View in Genome Browser
Species Human (GRCh38)
Location 1:227741417-227741439
Sequence TGGACCTGGCCCATGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 255}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922698025_922698033 14 Left 922698025 1:227741417-227741439 CCTTGGCTCATGGGCCAGGTCCA 0: 1
1: 0
2: 2
3: 23
4: 255
Right 922698033 1:227741454-227741476 GTAAGTGAGGTCCTGTGGGGTGG 0: 1
1: 0
2: 0
3: 21
4: 265
922698025_922698030 9 Left 922698025 1:227741417-227741439 CCTTGGCTCATGGGCCAGGTCCA 0: 1
1: 0
2: 2
3: 23
4: 255
Right 922698030 1:227741449-227741471 TTTTTGTAAGTGAGGTCCTGTGG 0: 1
1: 0
2: 4
3: 22
4: 314
922698025_922698032 11 Left 922698025 1:227741417-227741439 CCTTGGCTCATGGGCCAGGTCCA 0: 1
1: 0
2: 2
3: 23
4: 255
Right 922698032 1:227741451-227741473 TTTGTAAGTGAGGTCCTGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 188
922698025_922698031 10 Left 922698025 1:227741417-227741439 CCTTGGCTCATGGGCCAGGTCCA 0: 1
1: 0
2: 2
3: 23
4: 255
Right 922698031 1:227741450-227741472 TTTTGTAAGTGAGGTCCTGTGGG 0: 1
1: 0
2: 5
3: 45
4: 279
922698025_922698028 1 Left 922698025 1:227741417-227741439 CCTTGGCTCATGGGCCAGGTCCA 0: 1
1: 0
2: 2
3: 23
4: 255
Right 922698028 1:227741441-227741463 CTACCACATTTTTGTAAGTGAGG 0: 1
1: 0
2: 1
3: 16
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922698025 Original CRISPR TGGACCTGGCCCATGAGCCA AGG (reversed) Intronic
900337628 1:2172442-2172464 CGGGCCTGGCCCAGCAGCCAGGG + Intronic
902628135 1:17688667-17688689 AGGACCTGGCAGATGGGCCATGG + Intronic
903428188 1:23270485-23270507 TGGAAGGGGACCATGAGCCAAGG + Intergenic
903694110 1:25194998-25195020 TGCACCTGGCCGAGGAGCCGAGG + Intergenic
904131937 1:28281780-28281802 TGGACCCTGCCCCTGGGCCATGG + Exonic
904581044 1:31544538-31544560 TGCACCTGGCCCATTGGCTATGG - Intergenic
905062832 1:35154131-35154153 GGCACCCAGCCCATGAGCCACGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905998449 1:42402485-42402507 TGGAAGAGGGCCATGAGCCAAGG + Intronic
906698384 1:47840121-47840143 TGGACCAGGACCATGAGTCCTGG + Intronic
907602757 1:55787358-55787380 AGGCCCTGGCCAAGGAGCCAAGG + Intergenic
909869012 1:80714941-80714963 AGGAACTGGACCATGAGCCAAGG - Intergenic
912429049 1:109619699-109619721 CGGAACTGGCCCAAGACCCAGGG + Intronic
913712486 1:121499505-121499527 TGGACCTCTCCCATTAGCAAAGG + Intergenic
914708505 1:150191335-150191357 TGAAGCGGGGCCATGAGCCAAGG + Intergenic
916176674 1:162045871-162045893 TGGACCTGGTGCATGATACATGG + Intergenic
916189036 1:162160987-162161009 TGGAAAGGGGCCATGAGCCAAGG - Intronic
919655631 1:200194725-200194747 TGGAGTTGGCACATGGGCCATGG - Intergenic
919984294 1:202662084-202662106 CCAACCTGGCCCAGGAGCCACGG + Intronic
920007693 1:202845346-202845368 TGAAGCTGGCTCATTAGCCAGGG - Intergenic
920655076 1:207868784-207868806 TGGCCCTGGCCCCAGAGCCTGGG + Intergenic
921211177 1:212900045-212900067 TGGACCTCCCACATGACCCATGG + Intergenic
922684955 1:227631981-227632003 AGGCCCTGGCCAAGGAGCCAAGG + Intronic
922698025 1:227741417-227741439 TGGACCTGGCCCATGAGCCAAGG - Intronic
922800494 1:228362670-228362692 TGGCCCTGGCCCCTGCCCCAGGG + Exonic
924772104 1:247087804-247087826 TGGGCCTGGCCAGGGAGCCAGGG - Intergenic
1064002882 10:11678106-11678128 TGGACCTGGCTCATGGGCTGCGG - Intergenic
1066013371 10:31214691-31214713 TGGCCCAGGCCCATGTGCCAGGG + Intergenic
1067267459 10:44757732-44757754 TGGGCCTGGCTCCTCAGCCAAGG + Intergenic
1070289086 10:75103274-75103296 TGGACCTGTCCCATCGGCCTTGG - Intronic
1070525736 10:77294402-77294424 TTGACCAGGCCCAGGTGCCATGG + Intronic
1072155091 10:92716697-92716719 CAGACCTGGCCCAGGATCCAGGG - Intergenic
1072540250 10:96393047-96393069 TGGAAGGGGACCATGAGCCAAGG + Intronic
1074156283 10:110802734-110802756 TGGAACTGGGCCAGGTGCCATGG + Intronic
1074885052 10:117686725-117686747 TGGAAATGGCCCATGACTCAAGG - Intergenic
1075539435 10:123299799-123299821 TGGACCTTGCCCGTGAGCTGTGG + Intergenic
1076487949 10:130836263-130836285 TGGACATGGACCCTGAGGCACGG + Intergenic
1076572248 10:131440609-131440631 TGGACATGACCCGAGAGCCAGGG + Intergenic
1076804316 10:132847504-132847526 TGGCCCTGACCCGTGAGCCTGGG + Intronic
1077387084 11:2275118-2275140 TGGATCTGGCCCATGGGCCTCGG + Intergenic
1078101812 11:8334494-8334516 GGGAGCTGGCCCAGGAGCCAAGG - Intergenic
1079097557 11:17520661-17520683 TGGAGCTGGCCCGTGAACAAGGG + Intronic
1081597885 11:44471792-44471814 TGGACCCAGGCCAGGAGCCATGG + Intergenic
1083636626 11:64124287-64124309 TGGACCTGTCTCTTAAGCCAGGG + Intronic
1084532042 11:69733053-69733075 TAGACCTGGCCAGTGAGTCATGG - Intergenic
1084764067 11:71296137-71296159 TGAATCTGGCTCATGAGGCAGGG - Intergenic
1084791011 11:71475138-71475160 TGGACCTGTCTCAGGGGCCATGG - Intronic
1087974560 11:104528900-104528922 TGCATGTGGCCCATGGGCCATGG + Intergenic
1088264356 11:107975321-107975343 TGGAACAGGGCCATGAGCCAAGG + Intergenic
1088875907 11:113936082-113936104 GGGACCCGGCCCAGCAGCCATGG + Intronic
1089655198 11:119942064-119942086 CTGACCTGGCCCAGGTGCCAGGG - Intergenic
1092354526 12:7783524-7783546 AAGGCCGGGCCCATGAGCCACGG - Intergenic
1093596562 12:20969252-20969274 TGGAAAAGGGCCATGAGCCAAGG - Intergenic
1093915890 12:24802135-24802157 TGGACCTGGACAATGGGCCTTGG - Intergenic
1094249212 12:28340512-28340534 TGGAAGAGGACCATGAGCCAAGG - Intronic
1095283669 12:40385194-40385216 AGGCCCTGGCCAAGGAGCCAAGG - Intergenic
1097934769 12:65234145-65234167 TGGATCTGGCCCATAAGCCATGG - Intronic
1100557837 12:95714713-95714735 TGGAGCTGGCCCTTGACACATGG + Intronic
1103070160 12:117934771-117934793 TGCACCAGGCCGGTGAGCCATGG - Intronic
1103614601 12:122144124-122144146 TGCACCTGGCCCAGGAGCCCAGG - Exonic
1103802759 12:123549991-123550013 AGGCCCTGGCCAAGGAGCCAAGG - Intergenic
1104015382 12:124958338-124958360 TGGAGCTGACTCAAGAGCCAGGG + Intronic
1104943045 12:132403861-132403883 AGGACCTCGCCCAGGAGCCAGGG + Intergenic
1105706410 13:22970231-22970253 TTCACCTGGTCCATGACCCAAGG + Intergenic
1105978675 13:25496303-25496325 TGGAGGTGGCACATGAGCCAGGG - Intronic
1106399288 13:29412939-29412961 TGGAACTGGGCCATGAGTCCAGG - Intronic
1108317830 13:49255154-49255176 TGGAAGGGGCCCATGAGCCAAGG - Intronic
1108878015 13:55072524-55072546 TTCACCTGACTCATGAGCCAAGG + Intergenic
1109979162 13:69883880-69883902 TGGAGCTGTCCCAGGAGACATGG - Intronic
1110436323 13:75481580-75481602 CGGATCTCGGCCATGAGCCAGGG + Exonic
1110730694 13:78876266-78876288 TGGACGGGGCCCATGTTCCAGGG + Intergenic
1114389071 14:22286394-22286416 TGGAAGAGGGCCATGAGCCAAGG - Intergenic
1116676588 14:47913928-47913950 TGGACTTGACCCATGGGCCGTGG + Intergenic
1116796810 14:49399974-49399996 TGGAAGTGGGACATGAGCCATGG + Intergenic
1118564397 14:67123713-67123735 TGTACGTGGTCCATGGGCCACGG - Intronic
1119680363 14:76587867-76587889 TGGAATGGGGCCATGAGCCAAGG - Intergenic
1119937315 14:78603785-78603807 TAGACTAGCCCCATGAGCCATGG + Intronic
1121340158 14:93100223-93100245 TGGACCTGGAGCATGAGGGATGG + Intronic
1121922364 14:97894034-97894056 GGGACTTGTCCCATGAGTCAGGG + Intergenic
1122006622 14:98710123-98710145 TGGATTTGGCCCACGGGCCATGG + Intergenic
1123035333 14:105469646-105469668 TGGGCCTGGCACAGGGGCCATGG - Intronic
1202853558 14_GL000225v1_random:36607-36629 TGGCCCTGGCCCAGGAGACGCGG + Intergenic
1123938331 15:25204746-25204768 GTGTCCTGGTCCATGAGCCAGGG + Intergenic
1123948495 15:25250378-25250400 TTGCCCTGGCCCATGCCCCATGG + Intergenic
1124018369 15:25897866-25897888 TGGACCTGGGACTTCAGCCAGGG - Intergenic
1125368048 15:38940279-38940301 TGGACCAGTCCCATGATCCAAGG - Intergenic
1127881204 15:63159811-63159833 TGGAAGAGGGCCATGAGCCAAGG + Intergenic
1129509501 15:76110339-76110361 TGCATGTGGCCCATGGGCCATGG - Intronic
1130796066 15:87210793-87210815 TGGAGCTGGCCTATGAGCCAAGG + Intergenic
1131319851 15:91376928-91376950 TGGAACTGGTGCATGGGCCACGG + Intergenic
1132262059 15:100434305-100434327 TGGGCCTGTCACATGTGCCAAGG + Intronic
1132393108 15:101453277-101453299 TGGCCCTGCCCCATGTGCCCAGG + Intronic
1132550622 16:552546-552568 TGGGCCTGGGGCATGAGCCTGGG - Intronic
1132589033 16:718354-718376 GGTCCCTGGCCCTTGAGCCATGG - Exonic
1132692968 16:1189875-1189897 TGGACTGGGCTCACGAGCCAGGG - Intronic
1136232086 16:28892448-28892470 TGGGTCTCGCCCAGGAGCCAAGG - Intronic
1136687615 16:32004302-32004324 GGGACCCTGCCCATGAGGCAGGG + Intergenic
1136881559 16:33905936-33905958 GGGACCCTGCCCATGAGGCAGGG - Intergenic
1139775816 16:69316552-69316574 TGGATCTGACCCACAAGCCATGG + Intronic
1141436991 16:84005509-84005531 TGGGCTGGGCCCCTGAGCCAAGG + Intergenic
1141693022 16:85607116-85607138 CAGAGCTGGCCCAGGAGCCATGG - Intergenic
1141803305 16:86325130-86325152 TGGTCATGGCCTGTGAGCCAGGG + Intergenic
1203090455 16_KI270728v1_random:1209510-1209532 GGGACCCTGCCCATGAGGCAGGG + Intergenic
1143108038 17:4539160-4539182 TGGACATGGCCCTGGAGCCAGGG + Intronic
1143769001 17:9156014-9156036 TGGTCCTTACCCAGGAGCCATGG + Intronic
1144229629 17:13188656-13188678 TGTACCTGTACCATGAGCTATGG + Intergenic
1144501169 17:15787328-15787350 AGGACTTGGACCAGGAGCCACGG + Intergenic
1144520832 17:15951348-15951370 GGGACGTGGCCCATGGGCCCTGG + Intronic
1144794245 17:17880390-17880412 TGGACCTGGGCCAAGGCCCAAGG + Intronic
1145102337 17:20087581-20087603 TGGCCCTGCCCCACCAGCCAGGG - Intronic
1145163336 17:20590002-20590024 AGGACTTGGACCAGGAGCCACGG + Intergenic
1147148599 17:38499971-38499993 GGGACCCTGCCCATGAGGCAGGG + Intronic
1147877596 17:43632502-43632524 TGGCCGAGGCCCATGAGCCTGGG - Intergenic
1148827394 17:50404155-50404177 AGGCCCTGGCCAAGGAGCCAAGG + Intergenic
1149612601 17:57968490-57968512 AGGCCCTTGCCCATGAGCCAAGG - Intergenic
1151138512 17:71970303-71970325 TGGATCTGGCCCACCAGCAAGGG + Intergenic
1152925251 17:83084699-83084721 TGCACCTGCACCAAGAGCCATGG - Intronic
1155364470 18:25036224-25036246 TGGACCCGGGGCATGGGCCACGG + Intergenic
1155698009 18:28707114-28707136 TGGACTAGGCCCCTGAGCCTTGG + Intergenic
1156381025 18:36561361-36561383 TGGAGCTGACCCATGTGACAAGG - Intronic
1156476731 18:37410214-37410236 TGGGCCTGGAACAGGAGCCAGGG - Intronic
1157284461 18:46368029-46368051 TGGGCCTGGCCCCAGAACCATGG + Intronic
1158922503 18:62208974-62208996 TGGAGGAGGGCCATGAGCCAAGG - Intronic
1159558407 18:69968679-69968701 TGGAGTGGGGCCATGAGCCAAGG - Intergenic
1159876384 18:73815785-73815807 TGGTCCTGGCCCAAGAACTAAGG + Intergenic
1160064839 18:75565035-75565057 TGGACCTGGTGCACGTGCCAGGG + Intergenic
1161442452 19:4299967-4299989 TGCACCCGGCCCATGAACCCAGG - Intronic
1162587381 19:11568638-11568660 TGATCCTGGCCCATGAGGCAGGG - Intronic
1163190402 19:15673054-15673076 TGGCCCTGGCCCCTGATCTAGGG - Exonic
1163612718 19:18309530-18309552 TGGTCCTTGGCCATGAGCCGAGG - Intronic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1165765691 19:38349555-38349577 TGGACCCCAACCATGAGCCAGGG - Intronic
1168266582 19:55226932-55226954 TGGGCCTGGCTGAGGAGCCAGGG + Exonic
925125883 2:1455506-1455528 TGGACCTAGCCTGTGAGACAGGG + Intronic
925742586 2:7018939-7018961 TGGATTTGGCCCACTAGCCATGG - Intronic
926441062 2:12889374-12889396 TGGACCCTGCCTCTGAGCCATGG - Intergenic
926893143 2:17655850-17655872 TGGACCAGACACAGGAGCCAAGG - Exonic
927200570 2:20575689-20575711 CGGGCCTGGCCCATGTGCCTGGG + Intronic
927275932 2:21262485-21262507 TGGAATTGGGCCATGAGACATGG - Intergenic
927574506 2:24190172-24190194 TGGACCTGGTGCCTCAGCCATGG + Intronic
927783284 2:25955770-25955792 TGGATGTGGGCCATGGGCCATGG - Intronic
928476227 2:31630175-31630197 AGGCCCTGGCCAAGGAGCCAAGG - Intergenic
928490456 2:31778024-31778046 GTGATCTGGCCCATGAGACAGGG + Intergenic
929561942 2:42961567-42961589 GGGACCAGGACCATGAGTCAGGG - Intergenic
930631344 2:53757888-53757910 AGGCCCTGGCCAAGGAGCCAAGG - Intronic
930870514 2:56166341-56166363 TGCATGTGGCCCATGGGCCATGG + Intergenic
932778084 2:74540479-74540501 TGGACCAGGACCAAGAACCAAGG + Intronic
932806739 2:74791074-74791096 TGGATTTGGCCCATATGCCATGG + Intergenic
933733537 2:85476872-85476894 CACACCTGGCCCATGAGACAAGG + Intergenic
933837575 2:86258260-86258282 TGGATTTGGCCCATGGGCCAGGG - Intronic
933849836 2:86357051-86357073 TGCATGTGGCCCATGGGCCACGG + Intergenic
934672226 2:96221999-96222021 AGGCCCTGGCCAAGGAGCCAAGG + Intergenic
936164107 2:110105246-110105268 TGGGCCTGGCCAAGGGGCCAAGG + Intronic
937120461 2:119437094-119437116 TGGGCCAGGCCCATGTGCCCGGG + Exonic
939493906 2:142906293-142906315 AGGCCCTGGCCAAGGAGCCAAGG + Intronic
942234847 2:173893802-173893824 TGGACTTGGCCCATGTTCCCAGG + Intergenic
942580501 2:177411844-177411866 AGGCCCTGGCCAAGGAGCCAAGG + Intronic
943525663 2:189014179-189014201 TGGAACTGGCTCATGAACCAAGG - Intergenic
944385864 2:199164130-199164152 TGGATCTGGCTCATAAGCCTAGG + Intergenic
944669209 2:201981275-201981297 TGGCCCTGACCCAGGGGCCAGGG + Intergenic
946686600 2:222277568-222277590 TGCATATGGCCCGTGAGCCACGG - Intronic
947353095 2:229266917-229266939 TAGCCCTGGCCCATCAGGCAGGG - Intronic
947367579 2:229412927-229412949 TGGACAAGGGCCAAGAGCCATGG + Intronic
1170766162 20:19291422-19291444 TGGCCGTGGCCCACTAGCCAGGG - Intronic
1171886335 20:30654626-30654648 TTGACCAGGCCTATGAGCAACGG + Intergenic
1172555866 20:35840793-35840815 TGGACCTGGCCACTAACCCAAGG + Intronic
1173947142 20:46960612-46960634 TGGATTTGGCCTATGAGACATGG - Intronic
1175916734 20:62429507-62429529 GGTCCCTGGCCAATGAGCCAGGG - Intergenic
1176034713 20:63030597-63030619 TGGAGCTGGACCCAGAGCCAGGG + Intergenic
1176201489 20:63862807-63862829 AGGCCCTGGCCCACCAGCCATGG - Exonic
1177377671 21:20294383-20294405 TGGAAGGGGGCCATGAGCCAAGG - Intergenic
1177900876 21:26913755-26913777 GGGACCTGCCCCATCAGCCTAGG - Intergenic
1179998519 21:44984872-44984894 TGGACCTGGCCTTTGCCCCACGG + Intergenic
1181001508 22:19989833-19989855 TGGAGCTGTCCCAGCAGCCACGG - Intronic
1181043847 22:20205398-20205420 TGGACGGGGCCAACGAGCCATGG - Intergenic
1181784138 22:25214045-25214067 TGCACCTGGCCCAAAAGCAAAGG - Intergenic
1184617284 22:45646576-45646598 ATGGCCTGGACCATGAGCCAAGG - Intergenic
1184785026 22:46667552-46667574 TGGTCCTGCCCCATGGGCCGGGG - Intronic
1185320029 22:50196352-50196374 TGGGCCTGAGCCATGAGCCCTGG - Intronic
949929344 3:9066285-9066307 TGAACAAGGCCCAGGAGCCATGG - Intronic
951405893 3:22296874-22296896 CTGGCCTGGCCCATTAGCCATGG - Intronic
954096764 3:48334911-48334933 AGGGCCTGGCCAAGGAGCCAAGG + Intergenic
955527772 3:59838621-59838643 TGGAGCTGGCATATGAGCCCAGG - Intronic
958853801 3:99360184-99360206 TGAAAGGGGCCCATGAGCCAAGG + Intergenic
961591475 3:127984813-127984835 TGGACCTGGTCTGTAAGCCAGGG + Exonic
962131857 3:132687999-132688021 TGGACTTGGCCTATGGGCAATGG + Intronic
962340756 3:134581050-134581072 TGGATGGGGGCCATGAGCCAAGG + Intergenic
962899646 3:139748746-139748768 TGCATGTGGCCCATGAACCATGG + Intergenic
962956318 3:140270308-140270330 TGCACCTGGCCCCAGAGCCTGGG + Intronic
965055037 3:163700625-163700647 AGGCCCTGGCCAAGGAGCCAAGG + Intergenic
965824924 3:172720616-172720638 AGGCCCTGGCCAAGGAGCCAAGG - Intergenic
968024402 3:195427145-195427167 TGGAAAGGGGCCATGAGCCAAGG + Intronic
968391419 4:196150-196172 AGGCCCTGGCCAAGGAGCCAAGG + Intergenic
968530997 4:1091621-1091643 TGCACCGGGCCAGTGAGCCATGG - Intronic
969567380 4:7986593-7986615 TGGGCCTGGACCCTGAGCCAGGG + Intronic
969644946 4:8422686-8422708 AGGCCCTGGCCAAGGAGCCAAGG + Intronic
970435050 4:16025357-16025379 TGGACCTGGACAAAGAACCATGG - Intronic
970949976 4:21743312-21743334 TGAACAGGGGCCATGAGCCAAGG - Intronic
971377335 4:26065702-26065724 TGGTCCTGGCCCCTGGGTCATGG - Intergenic
974351374 4:60751301-60751323 TGGACCTGGTCCCTAGGCCAAGG + Intergenic
975548341 4:75584283-75584305 AGGAAGTGGGCCATGAGCCAAGG + Intronic
977628910 4:99219754-99219776 TGGACCTGGGTCTTGACCCAAGG + Intergenic
978945169 4:114486701-114486723 TGGATTTGGCCCATGGGCCATGG + Intergenic
978971835 4:114817235-114817257 AGGCTCTGGCCCATGGGCCATGG + Intergenic
980082319 4:128357198-128357220 TGGAGGAGGGCCATGAGCCAAGG + Intergenic
980444013 4:132883597-132883619 AGGCCCTGGCCAAAGAGCCAAGG - Intergenic
981402438 4:144329142-144329164 TGGAAGAGGACCATGAGCCAAGG + Intergenic
982348590 4:154389290-154389312 TGGATCTGGGCCATGTGCCATGG + Intronic
982377365 4:154708033-154708055 TGGGCCTGGCACATGAGAGAAGG + Intronic
983667231 4:170195773-170195795 AGGCCCTGGCCAAGGAGCCAAGG + Intergenic
984116820 4:175691925-175691947 TGGACAGGGACCATGAGCCAAGG + Intronic
987075754 5:14380359-14380381 TGGACCTGGTGCAGGAGCGAGGG - Intronic
988740328 5:34063478-34063500 AGGCCCTGGCCAAGGAGCCAAGG + Intronic
988932841 5:36053835-36053857 TGGAAGGGGGCCATGAGCCAGGG - Intronic
991418002 5:66411382-66411404 TGGAAGGGGGCCATGAGCCAAGG + Intergenic
994471786 5:100216753-100216775 TGGACCTTCCCAGTGAGCCAGGG + Intergenic
998112456 5:139512692-139512714 TGGACCTGGAACAGGAGGCAAGG - Intergenic
999309240 5:150541065-150541087 TGGTTTTGGCCCATGAGTCACGG - Intronic
1001081002 5:168667395-168667417 TTGACCTGGCCCAGGGGCCAGGG + Intronic
1003283544 6:4714318-4714340 TGGAGCTGGGCCTTGAGCCCAGG - Intronic
1003309922 6:4961663-4961685 TAGGACAGGCCCATGAGCCAAGG + Intergenic
1003418249 6:5932579-5932601 TGGAAGGGGGCCATGAGCCAAGG - Intergenic
1005276893 6:24229279-24229301 TGGATGGGGGCCATGAGCCAAGG - Intronic
1005708937 6:28485163-28485185 TTGGCCTGACCCATGAGACAGGG + Intergenic
1008304578 6:49886068-49886090 TGGCCCAGGACCAGGAGCCAAGG + Intergenic
1011190116 6:84719581-84719603 AGGCCCTGGCCAAGGAGCCAAGG + Intronic
1011433129 6:87309226-87309248 CGTACCTGGCCCATGAGTCAGGG - Intronic
1012864389 6:104600453-104600475 AGGACTTGCCCCATGACCCAAGG - Intergenic
1013765105 6:113565109-113565131 TGGGCCTGGCCCCTCATCCAGGG + Intergenic
1014426586 6:121314161-121314183 TGGAAGTAGGCCATGAGCCAAGG - Intronic
1018051027 6:160008150-160008172 TGTATGTGGCCCATGGGCCACGG + Intronic
1018461984 6:164007254-164007276 TGTACCTGGCTCATGAGTCCAGG + Intergenic
1018537536 6:164837476-164837498 TGGAAGGGGGCCATGAGCCAAGG - Intergenic
1018969816 6:168519305-168519327 AGCACCTGGCCCAGGAGCCCAGG - Intronic
1019082172 6:169442098-169442120 CGAACCTGGCCCATGGGGCAGGG - Intergenic
1019228090 6:170532004-170532026 TGCACCTGGCCCAAGAGCTTGGG - Intergenic
1020086466 7:5313301-5313323 GGGACCTCGCCCAGGAGCCCGGG - Exonic
1020143396 7:5624616-5624638 GAGGCCTGGCCCAGGAGCCAAGG - Intronic
1022255202 7:28649236-28649258 TGAATTTGGCCCATGGGCCATGG - Intronic
1022500225 7:30878095-30878117 TGGACCTGGACTCAGAGCCAGGG + Intronic
1023878933 7:44307697-44307719 TGGAGGTGGCCCATTAGCCTAGG + Intronic
1025264006 7:57440707-57440729 TGGGCCTGGCAGAGGAGCCAGGG + Intergenic
1025635233 7:63315401-63315423 TGGGCCTGGCAGAGGAGCCAGGG - Intergenic
1025647462 7:63432769-63432791 TGGGCCTGGCAGAGGAGCCAGGG + Intergenic
1028136473 7:87228206-87228228 TGCATGTGGCCCATGGGCCACGG + Intergenic
1029112224 7:98218173-98218195 GGGTCCTGGCCCCTGAGTCAGGG + Intronic
1029424084 7:100485861-100485883 TGGGCCTTGCCAAAGAGCCAGGG + Intronic
1029507232 7:100969699-100969721 TGGACCTGGAGCATCAGCCCAGG - Intronic
1031239422 7:119219240-119219262 TGGACCTTGACCATGACCCTGGG + Intergenic
1031681963 7:124686479-124686501 TGATGCTGGTCCATGAGCCAAGG + Intergenic
1034004821 7:147459639-147459661 AGGAAATGGGCCATGAGCCAAGG + Intronic
1034381673 7:150701489-150701511 TGGAACTGGGCCATAAGCCAAGG - Intergenic
1035358766 7:158296068-158296090 TGGACCTTTCCCATGGGCCTAGG + Intronic
1038169603 8:25117067-25117089 TGGACCTGGCTCAAGAGGCTGGG + Intergenic
1044189359 8:89296781-89296803 TGGAAGGGGACCATGAGCCAAGG - Intergenic
1047444196 8:124905294-124905316 AGGTCCTGGCCAAGGAGCCAAGG + Intergenic
1049093529 8:140534562-140534584 TGGACCCGGCCCACAGGCCACGG + Intronic
1049163981 8:141115551-141115573 TGGACCTGGCCCTTGGCCCCGGG + Intergenic
1049483711 8:142840357-142840379 TAGAGCTGGCCAAGGAGCCATGG + Intronic
1049724534 8:144139506-144139528 GGGAGCTGGCCCCAGAGCCATGG + Exonic
1051563644 9:18471333-18471355 TAGAACTGGCCATTGAGCCACGG - Intergenic
1052991396 9:34521188-34521210 TGGACCCGGCCCCTGACCCTTGG + Exonic
1053199853 9:36144921-36144943 TTGACTTGGCCCAGGAGACATGG + Intronic
1055382295 9:75721756-75721778 TGGTCCTTGCCCTTGGGCCATGG - Intergenic
1056110303 9:83388504-83388526 GGGACCCACCCCATGAGCCAGGG + Intronic
1059942484 9:119371107-119371129 TGAACCTGGACCAGAAGCCAAGG - Intergenic
1061043835 9:128153879-128153901 TGGACATGGCCCCTCACCCACGG - Intergenic
1061622103 9:131817362-131817384 TGGAACTGGACCCTGAGCCAGGG + Intergenic
1061763654 9:132868066-132868088 TTGGCCTGGCCCCTGACCCAAGG + Intronic
1062492089 9:136810242-136810264 TGGACCTTGCCCAGGACCCTCGG - Intronic
1062530184 9:136996273-136996295 TGGGCTGGGCCCAGGAGCCAAGG + Intronic
1186171221 X:6879147-6879169 TGGTCCTGGGCCATGAGGAATGG - Intergenic
1186746546 X:12575802-12575824 TGAAAGGGGCCCATGAGCCAAGG + Intronic
1188918967 X:35948183-35948205 TGCATGTGGCCCATGGGCCATGG + Intronic
1190753772 X:53383284-53383306 AGGGCCTGGCCCCTGTGCCAAGG + Intronic
1192146732 X:68687726-68687748 TGGCCCTGACCCAGGAGCCTTGG + Intronic
1198127489 X:133660369-133660391 TGTTCCTGCCCCATGATCCATGG - Intronic
1199670817 X:150146783-150146805 AGGAGCTGGGCCCTGAGCCAGGG + Intergenic
1199921236 X:152405836-152405858 TGGATCTTGCCCAAGGGCCATGG - Intronic
1200951426 Y:8902952-8902974 TGGCTCTGGCCCAGGAGCCGGGG + Intergenic
1201724152 Y:17135265-17135287 AGGCCCTGGCCAAGGAGCCAAGG - Intergenic