ID: 922700534

View in Genome Browser
Species Human (GRCh38)
Location 1:227757070-227757092
Sequence GCCCCTGGAGCCACAGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 1, 3: 40, 4: 365}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922700534_922700541 15 Left 922700534 1:227757070-227757092 CCTTTCTCTGTGGCTCCAGGGGC 0: 1
1: 1
2: 1
3: 40
4: 365
Right 922700541 1:227757108-227757130 TTTGAGTTCTGGGATATTGCTGG 0: 34
1: 56
2: 77
3: 75
4: 266
922700534_922700540 5 Left 922700534 1:227757070-227757092 CCTTTCTCTGTGGCTCCAGGGGC 0: 1
1: 1
2: 1
3: 40
4: 365
Right 922700540 1:227757098-227757120 CATTCTCACATTTGAGTTCTGGG 0: 1
1: 6
2: 34
3: 80
4: 320
922700534_922700539 4 Left 922700534 1:227757070-227757092 CCTTTCTCTGTGGCTCCAGGGGC 0: 1
1: 1
2: 1
3: 40
4: 365
Right 922700539 1:227757097-227757119 CCATTCTCACATTTGAGTTCTGG 0: 1
1: 0
2: 8
3: 43
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922700534 Original CRISPR GCCCCTGGAGCCACAGAGAA AGG (reversed) Intronic
900172143 1:1274242-1274264 GCCCCTGGAGGCTCAGTGGAGGG + Intergenic
900527368 1:3135815-3135837 GCCCAGGGAGCCACGGGGAAGGG - Intronic
900581822 1:3413263-3413285 GCCCCTGGAGCCACAGCGGCAGG + Intronic
900764839 1:4497837-4497859 GCCCCTGATTCCACAGAGAGAGG - Intergenic
900987006 1:6078958-6078980 GCCGCTGGAGGCTCAGAGCAGGG + Intronic
901504654 1:9676885-9676907 GCCCCTGGAGCCTCTGGGATCGG - Intronic
902384692 1:16069627-16069649 GCCCCTGGAACTGGAGAGAAGGG + Intronic
902598876 1:17527466-17527488 CACCCTGGAGCCACAGGGCAGGG + Intergenic
903251861 1:22059992-22060014 GCCACTTAAGACACAGAGAATGG - Intronic
903279697 1:22243617-22243639 ACCCTGGGAGCCACAGGGAACGG - Intergenic
903327583 1:22579869-22579891 GGCCCTGGGGCCACAGTGAGAGG + Intronic
903650190 1:24917264-24917286 GCCCCTGGAGACATAGGGCAGGG + Intronic
904366184 1:30012202-30012224 GCCAGAGGAGCCACAGAGTAGGG - Intergenic
904490622 1:30856847-30856869 ACCCGTGGAGCCACAGAGCTAGG + Intergenic
905012875 1:34759098-34759120 TCCCCAGGACCCACAGAGGATGG + Intronic
905125901 1:35716083-35716105 GCCCCTGGATCCCCTGAGGAAGG - Exonic
906513508 1:46424652-46424674 GCCCCAGGTGGCAGAGAGAAGGG + Intergenic
907091560 1:51729940-51729962 TCCCCTGGAGGCACAGAGGGCGG + Intronic
907419272 1:54335968-54335990 GGCACTGGAGCCAGAGAGATGGG + Intronic
909994371 1:82260847-82260869 GCCCCTGGTGCCAAAGAGGTTGG - Intergenic
911105546 1:94128639-94128661 GCCCTGGGAGCCACAGAAAGAGG + Intergenic
912339338 1:108895843-108895865 GCCCCTGGTGCCAAAAAGATTGG + Intronic
912553623 1:110500325-110500347 CCCACAGCAGCCACAGAGAAAGG - Intergenic
913081073 1:115387726-115387748 GCCCTTGCAGCCAGAGAGAAAGG - Intergenic
913575297 1:120167002-120167024 GCCTCAGGAGCCACATAGAAAGG - Intronic
914346784 1:146806731-146806753 GCCCCTGGAGCCCCACAGGCAGG - Intergenic
914557602 1:148782642-148782664 GCCTCAGGAGCCACATAGAAAGG - Intergenic
914615232 1:149347588-149347610 GCCTCAGGAGCCACATAGAAAGG + Intergenic
915089747 1:153416207-153416229 GCCTCTGGACCCAAAGAGAATGG - Intergenic
915095762 1:153460942-153460964 GCCTCTGGACCCAAAGAGGATGG + Intergenic
915734123 1:158073965-158073987 GCCCCTGGAGCCCAAGTCAAGGG - Intronic
916260587 1:162838392-162838414 GGCCCTGGGGACACAGAGAGGGG - Intronic
919742883 1:200991190-200991212 TGGCCTGGAGCCACACAGAAGGG + Intronic
920838446 1:209533782-209533804 GCCCCTGGAGCCAGAGTCATGGG - Intergenic
921015949 1:211191080-211191102 GGCCCTTCAGCCCCAGAGAAGGG - Intergenic
921304144 1:213779026-213779048 GCCTCTGAAATCACAGAGAATGG - Intergenic
922220237 1:223552777-223552799 CCCCATGCAGCCAGAGAGAAAGG + Intronic
922349640 1:224724614-224724636 GCCCCAGGAGCCAAAGAGTGTGG - Intronic
922571756 1:226638480-226638502 GGCCCTGGAGCCCCTGTGAATGG - Intronic
922700534 1:227757070-227757092 GCCCCTGGAGCCACAGAGAAAGG - Intronic
922793598 1:228324740-228324762 GACTCTGGAGCCACAGAGTTGGG + Intronic
922967614 1:229704242-229704264 GACCATGGAGCCTCAGGGAAGGG - Intergenic
923458496 1:234187035-234187057 TCCCCTGGATCCACAGAGCCAGG - Intronic
1062974289 10:1672180-1672202 GCCCGTGGAGACAGAGAGAGAGG - Intronic
1063377435 10:5562415-5562437 GCTCCTGGAGCCCCAGTGAGGGG + Intergenic
1063386688 10:5620379-5620401 GTCCCAGGATCCACAGAGGAAGG + Intergenic
1064749134 10:18508365-18508387 GCCCCTGAATCCACAGAGGAAGG + Intronic
1065700400 10:28419845-28419867 GCCAATGGAGCTACAGACAAAGG - Intergenic
1066057854 10:31698164-31698186 GCCCAGGGAGCCACTGAGAGAGG - Intergenic
1067520349 10:46995891-46995913 GTTCCTGGATCCACAGAGATGGG - Intronic
1067831113 10:49611533-49611555 GCCCGTGCAGCCGCCGAGAAGGG - Exonic
1068854460 10:61783300-61783322 CCTCCTGGAGCCACAGAAAAAGG + Intergenic
1069603779 10:69726916-69726938 GCCCCTGGAGCCAAGGAGTGTGG - Intergenic
1069633474 10:69911671-69911693 GAGCCTGGAGACTCAGAGAAAGG - Intronic
1070818795 10:79342738-79342760 GCCCCTGGAGACACAGAGCCAGG + Intergenic
1072822384 10:98570718-98570740 GACCCTGGCACCACAGATAAAGG + Intronic
1072898815 10:99389671-99389693 GACCCTGGAGGCCTAGAGAAGGG + Intronic
1073455487 10:103634266-103634288 GCCTTTGGAGCCAAGGAGAAAGG + Intronic
1073505607 10:103986098-103986120 GTCCCTGGTGCCAAAGAGGATGG - Intronic
1075072596 10:119328611-119328633 TTCCCTGGGGCCACAGTGAATGG - Intronic
1075885614 10:125896639-125896661 GACCATGGAGCCCCAGAGTAAGG + Exonic
1075924996 10:126244405-126244427 GACTCTGGAGCAGCAGAGAAGGG + Intronic
1076469350 10:130707909-130707931 GCCCCTGGGGCCAGAGAGACCGG - Intergenic
1076484140 10:130804989-130805011 GACCCTCCAGCCACAGAGGAAGG - Intergenic
1076729511 10:132431360-132431382 GCCCTTGGGGCCACAGAGCTAGG - Intergenic
1076847614 10:133077004-133077026 GCAGCTGGTGCCACAGAGACGGG - Intronic
1077443237 11:2578407-2578429 TCCCCTGGAACCACTGAGACAGG + Intronic
1078619497 11:12893960-12893982 GCCCCTGGGGGGACAGGGAATGG - Intronic
1078760193 11:14245512-14245534 GGCTCTGGAGCCCCAGAGCAGGG + Intronic
1079010136 11:16821067-16821089 GTCCCTGTGGCCACAGAGCATGG - Intronic
1080347813 11:31344449-31344471 GACTCTGGAGCCACAGTGACTGG + Intronic
1083310241 11:61780203-61780225 CACGCTGGAGCCACAGAAAAGGG - Exonic
1083314412 11:61805454-61805476 GCATCAGGTGCCACAGAGAAGGG - Intronic
1084216386 11:67648950-67648972 GCACCTGGAGCCTCAGCAAAGGG + Intronic
1084287427 11:68141236-68141258 CCCCCTGCAGCCACAGAGCAGGG - Intergenic
1084316997 11:68351371-68351393 ACTCCTGGAGCCACAGTGCAGGG - Intronic
1084368050 11:68716566-68716588 GCCCCAGGAGTCACAGGGCATGG - Intronic
1085067549 11:73511083-73511105 GAGCCTGGAGACACAGACAACGG + Intronic
1086053129 11:82617409-82617431 GCATCTGGGACCACAGAGAAAGG - Intergenic
1088594706 11:111432131-111432153 GTTCCTGGAGCTAGAGAGAAAGG + Intronic
1089398212 11:118149515-118149537 GCCCCTGGGCCCAGAGACAAAGG + Intronic
1089425330 11:118369239-118369261 CCCCCTCTAGTCACAGAGAATGG - Intronic
1089735403 11:120547223-120547245 TACCCTGGAGGCAGAGAGAAGGG - Intronic
1090037074 11:123258471-123258493 GCACCCTGATCCACAGAGAAAGG - Intergenic
1090423670 11:126592658-126592680 GCGCCTGGGGCCAGAGGGAAGGG + Intronic
1090467165 11:126944781-126944803 GCCCCAGGAGCAATGGAGAAGGG - Intronic
1090804475 11:130194316-130194338 TGCCCTCGGGCCACAGAGAAGGG + Intronic
1091632245 12:2170931-2170953 GCCCTTGGAGGCAGGGAGAAGGG + Intronic
1091836993 12:3592999-3593021 GCTCCTGGAACCACAGGGATGGG - Intronic
1091962793 12:4712732-4712754 GCCCCTACTGCCTCAGAGAATGG - Intronic
1092667277 12:10816546-10816568 GACCTTGGAAACACAGAGAATGG + Intergenic
1093557389 12:20492371-20492393 GCCTCTGGAGCCACAGTGTCTGG + Intronic
1096124119 12:49107223-49107245 GCCCCAGGGGCCTCAAAGAAGGG + Intronic
1096817290 12:54209606-54209628 GCCCCTAGAGACATACAGAAAGG + Intergenic
1098243399 12:68490782-68490804 ATCCATGGAGCAACAGAGAAAGG + Intergenic
1098848022 12:75561821-75561843 GCGCCTGTAGTCCCAGAGAATGG - Intergenic
1101599379 12:106195735-106195757 GTCCTTGGGCCCACAGAGAATGG - Intergenic
1101599856 12:106199819-106199841 TCAGCAGGAGCCACAGAGAAGGG + Intergenic
1102955222 12:117054576-117054598 GCCCCATGGGCCACAGAGGAAGG + Intronic
1103261767 12:119594471-119594493 GCCCCCGGAGCGGCAGGGAAAGG - Intronic
1103449191 12:121016262-121016284 TCCCCTGGAGCCTGAGAGGATGG - Intronic
1104019171 12:124980379-124980401 GGACATGGAGGCACAGAGAAGGG + Intronic
1104094888 12:125548066-125548088 TCTCCTGGGGCCACAGAGAAGGG + Intronic
1104424872 12:128667926-128667948 TCCCATGGAGCAACAGAGGAAGG + Intronic
1105984615 13:25553200-25553222 GCTCCAGGAGGAACAGAGAATGG - Intronic
1107133516 13:36920341-36920363 GCTCCGGGAGCCGCAGAGGAGGG + Intronic
1107386179 13:39912095-39912117 GCCCCTGGTGCCACAGAAGGTGG - Intergenic
1107828267 13:44350341-44350363 TCCCCTGGGGTCACACAGAACGG + Intergenic
1108683516 13:52799415-52799437 TCCTCTGGAGCCCAAGAGAAAGG - Intergenic
1109181811 13:59222820-59222842 TGCCCTGGGGTCACAGAGAAGGG + Intergenic
1113626572 13:111852379-111852401 GCCCATGAAGCCACCGAGGATGG + Intergenic
1113848992 13:113407386-113407408 GCTCCTGGGGCCACAGACGACGG + Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1113960485 13:114123114-114123136 GCTCCTGGAGCCTCAGAGGAGGG + Intronic
1116069675 14:40027425-40027447 GCCACTAGAGTCACAGAGAAAGG + Intergenic
1116178630 14:41507393-41507415 GGCCCTGGGACTACAGAGAAAGG + Intergenic
1117117841 14:52534670-52534692 GCTAATGGATCCACAGAGAAGGG - Intronic
1118718371 14:68576262-68576284 GCCCCAGGGGTCACAGAGCAGGG + Intronic
1119216790 14:72875578-72875600 GCCTCTGGAGCCAGAGAGTTTGG - Intronic
1120046130 14:79808390-79808412 GCCCATGCAGCAACAGATAATGG + Intronic
1121512400 14:94522147-94522169 GCCCACAGATCCACAGAGAATGG - Intergenic
1122152611 14:99732984-99733006 GTCCCTGGAGGGACAGAGGAGGG - Intergenic
1122287015 14:100658294-100658316 GCACCTGGGGCCACAGTGCAGGG + Intergenic
1122597285 14:102902415-102902437 CCCCCTGCAGCCACAGAGACAGG + Intronic
1123196757 14:106624347-106624369 GCAACTGGAGCTTCAGAGAAGGG - Intergenic
1123205300 14:106706912-106706934 GCATCTGGAGCTTCAGAGAAGGG - Intergenic
1125349096 15:38748959-38748981 GCCCATGGAGAAACAGAGTAGGG + Intergenic
1125585382 15:40815838-40815860 GCCCCTGACTCCCCAGAGAAGGG + Intronic
1127785541 15:62351735-62351757 GCCATTGGAGCAGCAGAGAAGGG + Intergenic
1128588438 15:68872878-68872900 GCCTCTGGAGCACCAAAGAAAGG + Intronic
1128722900 15:69965337-69965359 GGCCCTGGGGCCACACAGACGGG + Intergenic
1129198054 15:73982749-73982771 ACCCCAGGGGCCCCAGAGAAGGG - Exonic
1129270164 15:74415309-74415331 CACCCAGGAGCCACAGAGCAGGG + Intronic
1129789339 15:78330500-78330522 GGACCTGGAGGCCCAGAGAAGGG - Intergenic
1130743403 15:86625196-86625218 GCCACTGAATCCACAGAGATGGG + Intronic
1131072387 15:89474430-89474452 GTCCCAGGAGCCACAGACACAGG + Intronic
1132485745 16:189903-189925 GACCCTGGGAACACAGAGAAGGG + Intronic
1132543688 16:523318-523340 GCCACTGCAGCCACAAAGAATGG + Intergenic
1132661026 16:1061603-1061625 CCACCTGGGGCCCCAGAGAAGGG - Intergenic
1133236326 16:4388935-4388957 GCCCCTGGCGCAGCAGGGAAGGG - Intronic
1133236437 16:4389389-4389411 GCCCCTGGAGCCTGAGACGAAGG + Intronic
1135100135 16:19597985-19598007 GCCCCAGCATCCACAGAGACTGG + Intronic
1135905775 16:26510461-26510483 GCCAGTCGAGCCACAGAGATGGG + Intergenic
1136267846 16:29131446-29131468 GCCCCTGGAGGCAGAGAGCCTGG - Intergenic
1136286636 16:29248082-29248104 GGCCCTGGAGCCACAGACTCAGG - Intergenic
1137760374 16:50935516-50935538 TCCCCTGGAGCCTCAGCTAAGGG + Intergenic
1138263008 16:55639099-55639121 GGCCCTGGAGCCACCCAGGAGGG - Intergenic
1138297500 16:55899552-55899574 GCCTCTGGTGCCACAGAGAGTGG + Intronic
1138925656 16:61587729-61587751 GCCCTGGGAGTCACAGACAACGG - Intergenic
1139589884 16:67927772-67927794 GCTGCTGAAGGCACAGAGAAAGG - Exonic
1139987197 16:70908539-70908561 GCCCCTGGAGCCCCACAGACAGG + Intronic
1141097693 16:81174663-81174685 GACCCTGGGGCCCCAGAGGAAGG + Intergenic
1142242228 16:88952828-88952850 CCCCCTGGAGCCACAGCTCAAGG + Intronic
1143316386 17:6036415-6036437 GTTCCTGGAGCCACAAAGATGGG - Intronic
1143389465 17:6551819-6551841 CCCCTGGGAGCCACAGAGTAAGG + Intronic
1144233141 17:13229211-13229233 TCCACTGGATTCACAGAGAATGG - Intergenic
1146161126 17:30559927-30559949 GGCCCTGCTCCCACAGAGAAGGG + Intronic
1148147300 17:45373902-45373924 GTCCCTGGGGCCAGGGAGAAGGG - Intergenic
1149433319 17:56612387-56612409 GACCTTGGAGCCAGAGAGATGGG - Intergenic
1149863762 17:60139123-60139145 GACCCCGGAGGCACAGCGAACGG + Intergenic
1150749648 17:67848463-67848485 GCACCTGGAGGCACAGCAAAGGG + Intronic
1151266456 17:72959801-72959823 ACCACTGGAGGCACAGAGAGTGG - Intronic
1151326710 17:73384085-73384107 CCTCCTGCAGCCACAGAGCAGGG + Intronic
1152072600 17:78141195-78141217 GGCCCTGGAGCCACTGAGAGGGG - Exonic
1152231149 17:79114732-79114754 GAACCTGGAGCCCCAGAGCAGGG + Intronic
1152469162 17:80481429-80481451 GCCCCTGGACCCACAGGGTTGGG + Intergenic
1152717018 17:81905139-81905161 CCCCCAGGAGCCCAAGAGAAGGG - Exonic
1155294322 18:24371486-24371508 GCTCCAGGATCCAGAGAGAACGG - Intronic
1155510875 18:26575474-26575496 ACCCCTGGAGAGACAGAGAGAGG - Intronic
1156276136 18:35584598-35584620 GTCCCTGGTGCCAGAGAGACTGG - Intronic
1157934288 18:51856624-51856646 GCCTCTGGAGGGAGAGAGAAAGG - Intergenic
1158449353 18:57549979-57550001 GTCCGTGGTGCCACAGGGAAGGG - Exonic
1161595077 19:5147050-5147072 GCCCCGGGAGCCTCAGAGTCTGG + Intronic
1161701688 19:5799387-5799409 GCAGCTGCAGCCACAGATAAAGG - Intergenic
1162101662 19:8342817-8342839 GCCCCCGGACCCGCAGACAATGG - Intronic
1162196630 19:8989896-8989918 ACCCCTGGAGAGGCAGAGAATGG + Intergenic
1162947758 19:14054099-14054121 ACCACTGGAGGCAGAGAGAAAGG - Exonic
1163067703 19:14811317-14811339 ACACCTGGAGCCATAGAGCATGG - Intronic
1165827623 19:38714231-38714253 GACCCTGGAGGCACCGAGGAGGG - Intronic
1166372945 19:42312601-42312623 GCCCATGGAGGCACAGAGAGGGG - Intergenic
1166928994 19:46289805-46289827 GCCCAAGGAGCCACATGGAAAGG - Intergenic
1166929069 19:46290252-46290274 GCCCAAGCAGCCACAGGGAAAGG + Intergenic
1168458874 19:56538158-56538180 GCCCGTGTAGCCAGAGATAATGG + Intergenic
924972345 2:140248-140270 GTCCCCAGAGCAACAGAGAAGGG - Intergenic
925083934 2:1093075-1093097 GTCCCTGGAGCCCCTGAGTATGG + Intronic
928187446 2:29125213-29125235 GCCCCTGGTGCCAGAAAGATTGG + Intronic
928745669 2:34411597-34411619 GCCCATGTGGCCCCAGAGAAGGG + Intergenic
929571403 2:43025387-43025409 GGCAGTGGAGCCACAGAGTATGG + Intergenic
933130913 2:78673263-78673285 GTAACTGGAGCCTCAGAGAATGG - Intergenic
933140998 2:78792760-78792782 GCAACTGGAGCCACAGACAATGG - Intergenic
933722811 2:85409262-85409284 GCCCCAGGAGGCAGAGAGCAGGG + Intronic
933739783 2:85524396-85524418 CCTCCAGGATCCACAGAGAAAGG + Intergenic
933856395 2:86418429-86418451 GCCTCTTGGGGCACAGAGAAAGG + Intergenic
934502099 2:94869784-94869806 GCTCCTGGGGCCACAGATCAGGG + Intergenic
934512226 2:94954550-94954572 GCACCTGGAGCTCCAGGGAAGGG - Intergenic
934759323 2:96844725-96844747 GCCCCTCCAGCCACAGGAAAGGG + Intronic
935691946 2:105740186-105740208 GACCCTGTAGGGACAGAGAATGG - Intergenic
936941432 2:117888464-117888486 GGTCCTGGAACCACAGAGACTGG + Intergenic
938229412 2:129645659-129645681 GCCCTTGTTGCCACTGAGAATGG - Intergenic
939614615 2:144348344-144348366 GTCCCTGGATCCACTGATAATGG + Intergenic
940419611 2:153464285-153464307 GCACCTGGAGGCACAGTGATGGG - Intergenic
940639661 2:156333119-156333141 GCACCTGGAGCCGCACGGAATGG + Intronic
942708398 2:178802819-178802841 GTCCCTGTAACCACAGAGGAGGG - Intronic
942911795 2:181252840-181252862 GCTTCTGGAGACACAGAGAAGGG + Intergenic
944880796 2:204011082-204011104 GCCCCTGCAGCCACATGGGATGG - Intergenic
946146481 2:217734998-217735020 GTCCCTGGTGCCACAAAGATTGG - Intronic
946289074 2:218729381-218729403 GTTCCTGGGACCACAGAGAAGGG - Intronic
947671442 2:231939026-231939048 GCCTCTGGGGCCCCAGAGATGGG - Intergenic
948556362 2:238814013-238814035 GGCCCTGGAGATACAGACAAGGG - Intergenic
948822738 2:240558097-240558119 GCCCCTGAAGTCACAGAGGGCGG - Intronic
1168801663 20:647265-647287 GCCCCATGAGACAGAGAGAAAGG + Exonic
1169064860 20:2689411-2689433 GAGCCTGCAGCCCCAGAGAAGGG - Intergenic
1169281050 20:4267225-4267247 GCCTCTGGAGGTACAGATAAAGG + Intergenic
1170057767 20:12225779-12225801 TTCCCTGGAACCCCAGAGAATGG + Intergenic
1170724076 20:18910399-18910421 TCCCCTGGATCCACAGACACTGG - Intergenic
1171045727 20:21808322-21808344 GCTCCAGGAGCCACAGTGACTGG + Intergenic
1172133681 20:32673226-32673248 GCCCCTGGAGCCACAGAGGCAGG + Intergenic
1172311623 20:33922642-33922664 GCCACTGGAGGCACAGAGGATGG + Intergenic
1172437752 20:34942091-34942113 GCACCTGGAGGCCCAGAGTAAGG - Intronic
1172633500 20:36394206-36394228 GCCCCTGGAGCCTGGGAGATGGG - Intronic
1175245129 20:57577730-57577752 GCCCCTGGAGCCTGAGACACAGG - Intergenic
1175398317 20:58683421-58683443 GCTCTTGGGGCCACAGAAAAGGG - Intronic
1175463397 20:59172275-59172297 GCCACGGGAGCAACAGGGAATGG - Intergenic
1175739308 20:61409475-61409497 TTCCCTGGAGCCACTGGGAAGGG + Intronic
1175905623 20:62378050-62378072 GGCCCTGGGGCCACAGTGAATGG - Intergenic
1175981159 20:62739374-62739396 GCCCCTGGAATCACACAGAAGGG + Intronic
1175985469 20:62762208-62762230 GGTCCAGGAGCCCCAGAGAAGGG - Exonic
1176116366 20:63433239-63433261 GCCCCTCGGGCAGCAGAGAAGGG - Intronic
1176366021 21:6033527-6033549 GCCCCAGGATCCCGAGAGAAAGG + Intergenic
1178466635 21:32854211-32854233 GCAACTGGAGCCTCAGACAATGG - Intergenic
1178804140 21:35824484-35824506 GACCCTGGAGCCAGACAGACTGG + Intronic
1179063274 21:38000306-38000328 GCCGCTGCTGCCACCGAGAATGG - Intronic
1179424034 21:41258914-41258936 CCACCTGCTGCCACAGAGAAAGG - Intronic
1179757496 21:43505018-43505040 GCCCCAGGATCCCGAGAGAAAGG - Intergenic
1180052175 21:45336206-45336228 GCCCCTGGAGCCTTAGTGCAGGG + Intergenic
1180285644 22:10742175-10742197 GACCATGGAGCCCCAGAGTAAGG + Intergenic
1181115638 22:20631330-20631352 CCCCCAGGACCCATAGAGAAAGG - Intergenic
1181372733 22:22431281-22431303 GCCACAGGATCCACAGAGGAAGG + Intergenic
1181618671 22:24072464-24072486 GCTGCTGGTGGCACAGAGAATGG - Exonic
1182023275 22:27098656-27098678 GCCTTTGGAGCTAGAGAGAAGGG + Intergenic
1182178387 22:28317846-28317868 GCTCCTATAGTCACAGAGAAGGG + Intronic
1182713131 22:32334965-32334987 GACCGTGGAGGCTCAGAGAAGGG + Intergenic
1183013021 22:34962888-34962910 GCCCGTGGAGGCCCAGAGACGGG - Intergenic
1183214027 22:36467697-36467719 GCCCCAGGAGCCAGACAGGAGGG + Exonic
1183323018 22:37176553-37176575 GCCGCAGGAGCCAGAGAGGAAGG - Intergenic
1184111487 22:42398143-42398165 GCACCTGGAGACACAGGAAATGG + Intronic
1184587787 22:45459493-45459515 GTGCCTAGAGCCACAGAGGAGGG + Intergenic
1185221208 22:49630063-49630085 GGCCCTTGAGCCACAGAGGGTGG + Intronic
1185223814 22:49642074-49642096 CCCCCTGGACCCACAGACAGTGG - Intronic
1185328597 22:50240364-50240386 GGACCTGGAGACACAGGGAAGGG + Exonic
1185360250 22:50402407-50402429 GCCCCAGGAGCCATAAGGAAGGG + Intronic
949164934 3:928335-928357 GGCACTGGAGACACAGATAAAGG - Intergenic
950100613 3:10354511-10354533 GCCCTCGGAGTCACAGACAACGG - Intronic
952900467 3:38108785-38108807 CCACCTGCGGCCACAGAGAATGG - Intronic
953386084 3:42506325-42506347 GCCAAAGGAGCCACAGTGAAGGG - Intronic
953647503 3:44768804-44768826 GCAACTGGAGCCTCAGATAATGG - Intronic
954228740 3:49199874-49199896 GCCCCGGGAGCCAGAGTGAGCGG + Intronic
954392881 3:50276613-50276635 GCCCCTGGAGTCGCGGAGAAAGG + Exonic
954621114 3:51996063-51996085 GGTCCTGGAGAAACAGAGAAGGG - Intergenic
954699560 3:52444103-52444125 GGTCCTGGGGCCACAGAGAAGGG - Intronic
955044973 3:55351099-55351121 GCCCCTGAAGGCAAAGGGAAGGG - Intergenic
955890400 3:63644492-63644514 GCCTCTGGGGGCATAGAGAAAGG - Intergenic
956289670 3:67648285-67648307 GACCCTGAAGCCAGAGAGAGAGG + Intronic
956412770 3:68995556-68995578 ACTCCAGCAGCCACAGAGAAGGG + Intronic
958798842 3:98733268-98733290 GATCCTGGAGCCCCAGTGAAGGG + Intronic
958855155 3:99376380-99376402 GCCCCTGGCGCAGCAGGGAAGGG + Intergenic
959254173 3:103989575-103989597 GCAACTGGAGCCTCAGACAATGG - Intergenic
960088408 3:113614602-113614624 GCCCGAGGGGCCACAGAGAAAGG - Intronic
960153700 3:114276459-114276481 TCCTCTGAAGCCAAAGAGAAAGG - Intergenic
961330408 3:126134911-126134933 GCCCCTGGAACCACAGGGCCTGG - Intronic
961664193 3:128486167-128486189 GCCCCTGGGTACACAGAGAGTGG + Exonic
961768277 3:129229089-129229111 GGCACTGCAGCCACAGAGAGAGG - Intergenic
961868504 3:129971837-129971859 GCCCATGGAACCAGAGAGGATGG - Intergenic
962256528 3:133873520-133873542 GCCCCAGCCGCCACAGAGGAGGG + Intronic
963555877 3:146787792-146787814 GCACCTGGAGACGTAGAGAAGGG - Intergenic
964261109 3:154838201-154838223 GTCACTGTAGCCAAAGAGAAAGG - Intergenic
964498929 3:157326864-157326886 GCTCCTGAAGCCAGACAGAAAGG + Intronic
964549165 3:157867801-157867823 TCACCTGGCACCACAGAGAAAGG + Intergenic
964849713 3:161081944-161081966 GGCCCCGGGGCCACAGACAATGG + Intergenic
965547019 3:169926636-169926658 GACACTGGAGCCATAGAGGAAGG - Exonic
966818055 3:183905357-183905379 ACCCCTGGGGCCACAGAGCAAGG + Intergenic
967105508 3:186252062-186252084 GTTCCCCGAGCCACAGAGAAGGG + Intronic
967449344 3:189605448-189605470 GACTCTGGAGGCACAAAGAAAGG - Intergenic
968292646 3:197550661-197550683 GGCCCTGAAGCCACAGAGAGAGG + Intronic
968648225 4:1750271-1750293 GCCTCTGGACCCTCAAAGAAAGG + Intergenic
969053542 4:4388072-4388094 GCCCCTGGGGCCACGGGGCAAGG - Intronic
969090985 4:4693877-4693899 GCCCCTGCAGCCAGAGAGAGGGG + Intergenic
969235203 4:5860832-5860854 GCCACTGGGGCCACAGAAGATGG - Intronic
969705700 4:8790010-8790032 CCTCCTAGAGCCACAGAGCATGG + Intergenic
969834686 4:9831042-9831064 GCCAGTAGAGCCACAGACAACGG - Intronic
969904454 4:10381410-10381432 GATCCTGGAGCCCCAGAGGATGG + Intergenic
970509927 4:16771756-16771778 GTTACTGGAGGCACAGAGAAGGG - Intronic
972710966 4:41594546-41594568 GCCACTGGAGCAAGCGAGAAGGG - Intronic
974100026 4:57406283-57406305 TCCCCTGGAGCAAAAGAGGATGG - Intergenic
975756664 4:77578274-77578296 GCAACTGGAGCCACAGATGATGG + Intronic
977885213 4:102245371-102245393 GGACCTGGTGCCACAGAGCAGGG - Intergenic
980052206 4:128049709-128049731 GACACTGAAACCACAGAGAAGGG + Intergenic
981669849 4:147274854-147274876 GAGCCTGGAGCCACAGAGATTGG + Intergenic
981952294 4:150423511-150423533 TGTCCTGGAGCCACAGAGACTGG + Intronic
982331716 4:154188135-154188157 TGCACAGGAGCCACAGAGAACGG - Intergenic
983085304 4:163435861-163435883 GCCCCTGGAGCCAGACTGACTGG + Intergenic
984951278 4:185009549-185009571 GCCCCTGGAGCCCCAGAAGCTGG + Intergenic
986128417 5:4905058-4905080 GCCCCTGTGGCCAAAGAAAAAGG + Intergenic
986199626 5:5569470-5569492 TCCCCAGGAGCCACAGAGACCGG - Intergenic
987116889 5:14732808-14732830 GGCCCTGGAGCCACAGGGCTTGG - Intronic
987222520 5:15804887-15804909 GCCCCTGGTGCCAAAAAGATTGG + Intronic
988381515 5:30502662-30502684 GCACCTGTAGCCCCAGATAAAGG + Intergenic
988530327 5:32021877-32021899 GCCCCAGGAGCTAAAGAGGAGGG - Intronic
990558713 5:56962619-56962641 GCAACTGGAGACACAGAGAGAGG + Intronic
990645118 5:57835112-57835134 ACCCCAGGAGCCAGAGAGAATGG - Intergenic
994397497 5:99237613-99237635 GGCCCAGGAGACAGAGAGAAGGG + Intergenic
995306648 5:110658934-110658956 TCCACTGAAGCCACAAAGAAAGG + Intronic
995478219 5:112569258-112569280 GCCCCTGGAGTATCACAGAAAGG - Intergenic
996620560 5:125496879-125496901 GCCTCTACAGCCACAGAGAGAGG + Intergenic
997372496 5:133370858-133370880 CCCCATGGAGCAACAGGGAAAGG + Intronic
997613865 5:135233055-135233077 GACCCAGCAGCAACAGAGAACGG - Intronic
998600003 5:143575818-143575840 GCCTCCTGAGGCACAGAGAAAGG - Intergenic
998948760 5:147370116-147370138 GTCCCTGGTTCCACAGAGTATGG - Intronic
1001719912 5:173848381-173848403 GTCCCTGGAACCAAAGAGGAAGG + Intergenic
1002503698 5:179664530-179664552 GCCCCTGGAGCCACAGAGCAAGG - Intergenic
1004847551 6:19662098-19662120 GATTCTGGAGCAACAGAGAAAGG + Intergenic
1006815753 6:36848775-36848797 GCCGCTGGAGCAGGAGAGAAAGG - Intergenic
1007473796 6:42106463-42106485 TCTCCTGGAGCCACAGAGATAGG + Exonic
1007663874 6:43503124-43503146 GCCCCTGGAACCTCAGGGGATGG + Intronic
1008050358 6:46894629-46894651 GACTTTGGAGCCAGAGAGAATGG + Intronic
1008055719 6:46944099-46944121 GTCCCTGGTGCCAAAGAGGATGG - Intronic
1008368121 6:50706227-50706249 GCCACTGGAGCTACAGAGCCAGG - Intergenic
1008627833 6:53335295-53335317 GGCCCTGGGGCCACAGGGACAGG - Intronic
1009241860 6:61194230-61194252 GCAACTGGAGCCTCAGAAAATGG - Intergenic
1009725244 6:67529832-67529854 GCAACTGGAGCCTCAGATAATGG - Intergenic
1010897092 6:81377963-81377985 GCATCTGGAGCTTCAGAGAAGGG - Intergenic
1012928793 6:105295280-105295302 GCCTCTGCAACCCCAGAGAAAGG + Intronic
1013079929 6:106803294-106803316 GCCCCTGTGGCCACAGTGAGAGG + Intergenic
1013279118 6:108618361-108618383 GCACCAGGAGCCACAGAAGAAGG + Intronic
1013433326 6:110075973-110075995 GCCCATGGAGTCAGAGAGAAGGG - Intergenic
1013732569 6:113185644-113185666 TCCCCAGGAGCCACACAGCAAGG - Intergenic
1015539603 6:134300590-134300612 GGCCCTGGAGATAAAGAGAAAGG + Intronic
1015619534 6:135116653-135116675 GCTCCTGGAGCCCCTGAGAAAGG - Intergenic
1017562815 6:155648405-155648427 GCCCCTGGAGCCCCAGCCACAGG + Intergenic
1018812476 6:167307931-167307953 CCCCCTGCTGCCACAGAGGAAGG - Intronic
1019293640 7:262423-262445 GAACGTGGAGCCACAGCGAAGGG + Intergenic
1019773580 7:2898871-2898893 GTCCCTGGAACCACAGGGATGGG - Intergenic
1021214858 7:17903032-17903054 GTCCCTGGTGCCACAGAGGTTGG + Intronic
1021243990 7:18239375-18239397 GCCCCTGCAACCACATAGCATGG + Intronic
1021541803 7:21767927-21767949 CCCCCTTTGGCCACAGAGAAAGG + Intronic
1022182894 7:27939481-27939503 GCCCCTGGATCTGGAGAGAAGGG + Intronic
1022573632 7:31476784-31476806 GGCCCTGTAACCCCAGAGAAAGG + Intergenic
1023515354 7:40996288-40996310 GCATCTGGAGGCTCAGAGAAGGG + Intergenic
1023845093 7:44116052-44116074 GCCTCAGGAGGCACAAAGAAGGG - Intronic
1024639963 7:51320508-51320530 GCCCCTTCATCCACAGAGCATGG + Intergenic
1025942049 7:66082030-66082052 GAGCCTGGGGCCACAGGGAAGGG - Intronic
1027252863 7:76409938-76409960 GTCCCAGGAGCCACAGTGTATGG + Intronic
1027693781 7:81382495-81382517 TCAACAGGAGCCACAGAGAATGG + Intergenic
1030108817 7:106009273-106009295 GCCCCTGGAACTGCAGAGGAGGG - Intronic
1030385507 7:108863474-108863496 GACCCTGAAGCCCCAGAGCAGGG - Intergenic
1033456845 7:141510867-141510889 GCCCAAAGAGCCACAAAGAAGGG + Intergenic
1035472325 7:159118356-159118378 GCTCCTTGAGACACAGAAAATGG - Intronic
1036279875 8:7391571-7391593 GCTCCTGGAGGCACAGACATTGG - Intergenic
1036341647 8:7920312-7920334 GCTCCTGGAGGCACAGACACTGG + Intergenic
1036586224 8:10126387-10126409 GTCCCTGGTGCCACAGAGCTTGG - Intronic
1039552512 8:38453299-38453321 TCCCCTGGAGGCCCAGGGAAAGG + Intronic
1039901764 8:41757843-41757865 GCCCAGGGCCCCACAGAGAAGGG - Intronic
1039901917 8:41758750-41758772 GCCCCTGAAACCTCAGAGCAGGG - Intronic
1040629807 8:49197219-49197241 GTCCCTGGAGCCAAAAAGACTGG + Intergenic
1041564550 8:59261946-59261968 GTACCTGGAGCCAAGGAGAAAGG - Intergenic
1042577664 8:70238773-70238795 GCACCTGGAGCTGCTGAGAACGG - Intronic
1044617309 8:94155550-94155572 GCCTCTGGGGCCACAGTGATGGG - Intronic
1047714980 8:127587175-127587197 GCCCCTGAAGTCACACTGAAGGG - Intergenic
1048346652 8:133580966-133580988 TCAGCTGGAGCTACAGAGAATGG - Intergenic
1048400943 8:134069917-134069939 GCCTGTGAAGCCACAGTGAATGG - Intergenic
1049740918 8:144240474-144240496 GCCCCTGCAGCCACAGCACATGG + Intronic
1050571062 9:6939524-6939546 GTCCCTGGTGCCAGAAAGAATGG + Intronic
1051528982 9:18078816-18078838 GCCCCTGGACCCTCAAAAAAAGG + Intergenic
1052378453 9:27742855-27742877 ACAACTGGACCCACAGAGAATGG - Intergenic
1053347068 9:37385648-37385670 TCCCCTGGAGCCACTGAGGCAGG - Intergenic
1053431123 9:38042499-38042521 GCCCCAGGAGGCAGAGAGACTGG - Intronic
1054793696 9:69278954-69278976 TTCCCTGGAGCAAAAGAGAATGG + Intergenic
1054872813 9:70064544-70064566 GCACTTGGAGACAAAGAGAAGGG + Intronic
1055846368 9:80568513-80568535 GCCCCTGGTGCCAAAAAGATTGG - Intergenic
1056707508 9:88964758-88964780 TCCCCTTCAGCCCCAGAGAAGGG + Intergenic
1058525032 9:105849323-105849345 ACCACTGGAGCCACAGATGATGG - Intergenic
1059705229 9:116816728-116816750 GCCTGTGCAGCCCCAGAGAAAGG + Intronic
1059960416 9:119559243-119559265 GCAGCTGGAGCCACAGGGAAAGG + Intergenic
1060103383 9:120858653-120858675 GCCTCAGGAGGCTCAGAGAATGG - Intronic
1060540199 9:124424115-124424137 GTCCCTGGAGCTCGAGAGAAGGG + Intergenic
1060939417 9:127535122-127535144 GGCCCTGGAGCCACGGCCAAAGG - Intronic
1061752140 9:132786466-132786488 TCCCCTGGACCCCCAGAGAGGGG + Intronic
1061964400 9:134004883-134004905 GGCCCTGGAGGGACAGAGAAGGG - Intergenic
1062004581 9:134232858-134232880 GTCCCTGAAGCCACAGAGCCTGG + Intergenic
1062315433 9:135964852-135964874 CCCTCTGGAGCCACAGGGGAGGG + Intergenic
1062338732 9:136084096-136084118 GTCCCTGGAGCCACTGAGTGAGG - Intronic
1062449689 9:136610281-136610303 GCCCTGGGAGCCCCAGAGGACGG - Intergenic
1062450320 9:136612720-136612742 GACCCAGGAGCAGCAGAGAAAGG - Intergenic
1062460376 9:136660320-136660342 GCTCCTGGAGCCTCAGAGGCAGG - Intronic
1062467067 9:136686225-136686247 GCCCCTGGAACCACGGGGAAGGG + Intronic
1186543298 X:10422821-10422843 GCCCAAGCAGCCACAGAGAGAGG - Intergenic
1188948997 X:36345265-36345287 ATCCCTGGTGCCACAGAGACTGG - Intronic
1190408324 X:50109941-50109963 CCCCATGGAGGCACTGAGAAAGG + Intergenic
1190460481 X:50668314-50668336 GCCTCTGACACCACAGAGAAGGG - Intronic
1191875043 X:65787650-65787672 GCCCCTGGAGGCGCAGGGGAAGG - Intergenic
1192676277 X:73199878-73199900 GTCCCTGGACCTAGAGAGAAAGG - Intergenic
1193062006 X:77216807-77216829 GCAACTTGACCCACAGAGAATGG + Intergenic
1193360341 X:80573031-80573053 ACCCCTGACGGCACAGAGAAAGG - Intergenic
1195630339 X:107049234-107049256 GGCACTGGAGCCTCAGAGGATGG - Intergenic
1200184675 X:154174650-154174672 GCCCATGGAAACCCAGAGAACGG + Intergenic
1200190328 X:154211788-154211810 GCCCATGGAAACCCAGAGAACGG + Intergenic
1200196079 X:154249590-154249612 GCCCATGGAAACCCAGAGAACGG + Intergenic
1200201734 X:154286708-154286730 GCCCATGGAAACCCAGAGAACGG + Intronic