ID: 922702431

View in Genome Browser
Species Human (GRCh38)
Location 1:227769698-227769720
Sequence CTGTGGTTGTGGAGGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 747
Summary {0: 1, 1: 1, 2: 8, 3: 78, 4: 659}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922702422_922702431 -6 Left 922702422 1:227769681-227769703 CCCTGGCCACTGTGTCACTGTGG 0: 1
1: 0
2: 2
3: 33
4: 290
Right 922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG 0: 1
1: 1
2: 8
3: 78
4: 659
922702421_922702431 10 Left 922702421 1:227769665-227769687 CCTTCTGTCTCTGGGGCCCTGGC 0: 1
1: 0
2: 2
3: 61
4: 632
Right 922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG 0: 1
1: 1
2: 8
3: 78
4: 659
922702424_922702431 -7 Left 922702424 1:227769682-227769704 CCTGGCCACTGTGTCACTGTGGT 0: 1
1: 0
2: 0
3: 18
4: 226
Right 922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG 0: 1
1: 1
2: 8
3: 78
4: 659
922702419_922702431 11 Left 922702419 1:227769664-227769686 CCCTTCTGTCTCTGGGGCCCTGG 0: 1
1: 0
2: 5
3: 50
4: 466
Right 922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG 0: 1
1: 1
2: 8
3: 78
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922702431 Original CRISPR CTGTGGTTGTGGAGGGTGGA GGG Intronic
900384005 1:2401169-2401191 CTGTGGTTGTGGCCTGGGGAGGG + Intronic
901029785 1:6300457-6300479 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901029831 1:6300633-6300655 CTGTGTTTGTGGAGAGAGGCCGG - Intronic
901029844 1:6300696-6300718 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901029859 1:6300759-6300781 CCGTGTTTGTGGAGAGGGGAGGG - Intronic
901798619 1:11694351-11694373 CTCTGGCTGGGGAGGTTGGAGGG + Intronic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902551875 1:17224183-17224205 CTGTGGTTCTGGGAGTTGGAGGG - Intronic
902917356 1:19646641-19646663 CAGAGGGTGTGGAGGGTGGCTGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903609087 1:24596983-24597005 CTGTGGTTCTGGCAGGTGGCTGG + Intronic
903614404 1:24641734-24641756 TTGTGGTTTTGGTGGATGGAGGG + Intronic
904314355 1:29650656-29650678 CGGTGGGTGGGCAGGGTGGAGGG + Intergenic
904329528 1:29749195-29749217 CTGTGTTTGTGGTGGGGGCAGGG - Intergenic
904378759 1:30097367-30097389 CTCAGGGTGTGCAGGGTGGATGG + Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
904977842 1:34472278-34472300 TTGTGCTTGTGGAGGGTGTGTGG - Intergenic
905240299 1:36576775-36576797 CTGGGGTCGGGGAGGGAGGAGGG + Intergenic
905301478 1:36989069-36989091 CTGTGTTTGTGCAGGGAGGGAGG - Intronic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906690728 1:47791228-47791250 CTGTGGTTCTGGAGTCTGGATGG - Intronic
906882633 1:49608916-49608938 CTGTGGTGGGGGAGGGGTGATGG - Intronic
906911679 1:49958693-49958715 GTGGGGTTGGGGAGGGGGGAGGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907427801 1:54391879-54391901 CTGTGATTGAGGTGGGTGGGTGG - Intronic
907998334 1:59655424-59655446 CTGTGGTGGGGTGGGGTGGAGGG - Intronic
909048929 1:70745413-70745435 CTGGGGTTGGGGGAGGTGGAGGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
910276666 1:85456847-85456869 TTTTGGTGGTGGAGGGTGGGGGG - Intronic
910461062 1:87448452-87448474 GTGTGTTTGTTGCGGGTGGAGGG + Intergenic
910587180 1:88892798-88892820 GTGTGGTTGTGTAGTGGGGAGGG + Intergenic
910628892 1:89337074-89337096 CTGTGGATTCAGAGGGTGGAAGG + Intergenic
910644424 1:89498076-89498098 GTGTAGGGGTGGAGGGTGGATGG + Intergenic
910899825 1:92108033-92108055 TTGTGGCTGTAGAGTGTGGAAGG + Intronic
911172434 1:94783686-94783708 CTGTTGTGGTGGAGGCTGGCTGG - Intergenic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
912457479 1:109807550-109807572 CTGTGCTCCTGCAGGGTGGAAGG + Intergenic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
915484043 1:156207761-156207783 CTTAGGTGGTGAAGGGTGGAGGG + Intronic
915924399 1:160004974-160004996 CCTTGGCTGTGGAGGGGGGATGG - Intergenic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
918096856 1:181343176-181343198 CTGGGGTGGAGGAGGCTGGAGGG + Intergenic
918205046 1:182300708-182300730 GTGTGTTGGTGGAGGGTGGGTGG + Intergenic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
919972652 1:202591046-202591068 CTGTGGGTGTGGAGAGTGGGAGG + Exonic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920308754 1:205035685-205035707 CTGTGGATCTGGAGAGTGAATGG + Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922383298 1:225055677-225055699 GTGTGGTGGGGGAGGGGGGAGGG - Intronic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922603629 1:226875121-226875143 CTGTGGTCCGGGAGGGTGGTAGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923531744 1:234817534-234817556 CTTTGATGATGGAGGGTGGAGGG + Intergenic
924608016 1:245551827-245551849 CTGGGGTTGGGGAGGTTGGCAGG - Intronic
924608083 1:245552213-245552235 CTGTGACTGTGGAGGTTGGCGGG + Intronic
1062961322 10:1575672-1575694 CTGGGGTGGAGGAGGGTGGGAGG + Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1064156861 10:12909659-12909681 ATGAGGCTGTGGAGAGTGGAAGG + Intronic
1064353221 10:14595913-14595935 CTGTGGTTGTGGAGGGCCACGGG - Intronic
1064790353 10:18951493-18951515 CAGTGGCTGCGGAGGGTGTATGG - Intergenic
1065550770 10:26866711-26866733 TGGTGGTTGTGGCGGGTGCATGG - Intergenic
1065725849 10:28667367-28667389 CTGTGGCTGCGGCGGGTGGCAGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067075755 10:43180729-43180751 ATGTGGTGGTGAAGTGTGGAGGG + Intronic
1067085185 10:43234444-43234466 CACTGGTTTTGGAGGATGGAAGG + Intronic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067429139 10:46231357-46231379 CTGTGGGTGGCCAGGGTGGAGGG + Intergenic
1067514663 10:46927920-46927942 CTGAGGTTCAGGAGGTTGGAGGG + Intronic
1067570124 10:47365431-47365453 CTTTGGCTGTGGAGGGTTGCAGG - Intergenic
1067647596 10:48123893-48123915 CTGAGGTTCAGGAGGTTGGAGGG - Intergenic
1068390836 10:56394882-56394904 CTGGGGTGGGGGAGGGGGGAGGG - Intergenic
1068394323 10:56442218-56442240 GTGGGGTGGTGGAGGGGGGAGGG - Intergenic
1068568863 10:58606412-58606434 CTGGGGTGGGGGAGGGGGGAGGG + Intronic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1069565234 10:69459630-69459652 CTGTGGGTGGAGAGGGTGGCAGG + Intronic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1069818664 10:71214251-71214273 CTTTGGCTATGGAGGGGGGAAGG - Intronic
1069880058 10:71586669-71586691 ATGTGGTTCTGGAGGATGGGAGG - Intronic
1069984178 10:72272842-72272864 CAGTGGTTGCTGAGGGTGGGTGG - Intergenic
1070050700 10:72886846-72886868 CTGAAGTTGTGGAGGTGGGAGGG - Exonic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070789717 10:79181851-79181873 CTGTGGTGGTGGTGGCTGGGAGG - Intronic
1070791301 10:79191074-79191096 CTATGGGTGTGGGAGGTGGAGGG + Intronic
1070838495 10:79467043-79467065 CAGGGGCTGGGGAGGGTGGAGGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1070923982 10:80205878-80205900 CGGTGGTGGTGGAGGGGGGAAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1072280862 10:93863956-93863978 CAGTGGTTATGGAGGATGGGAGG + Intergenic
1072368707 10:94742232-94742254 CTGTGGTTCAGGAGTGTGGTTGG + Intronic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074162916 10:110848828-110848850 GGGTGGGTGTGGGGGGTGGAGGG - Intergenic
1074672027 10:115802071-115802093 GTGTGGTGGTGGGGGGCGGAAGG - Intronic
1075427874 10:122355974-122355996 CTGGGGTTGTGCAGGCAGGATGG + Intergenic
1075454945 10:122579070-122579092 ATGTGATATTGGAGGGTGGAGGG + Intronic
1075520946 10:123143180-123143202 CGGCCGTTGTGCAGGGTGGATGG + Intergenic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077136727 11:1003258-1003280 CTGTGCTGCTGGTGGGTGGATGG + Intronic
1077280824 11:1744632-1744654 ATGTGGGTGGGGGGGGTGGATGG + Intronic
1077305574 11:1867334-1867356 GTGTGGGTGTGGTGGGTGGGTGG - Intronic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077355343 11:2114271-2114293 GTGAGGTGGTGGAGGGTGGAGGG - Intergenic
1077473474 11:2775661-2775683 CTGGGGTGGTGGGGGGTGGAAGG + Intronic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077877412 11:6319996-6320018 ATGTGGGTGTGGTAGGTGGATGG + Intronic
1078133738 11:8635432-8635454 CTGGGGTTGGGCAGGGTGGAGGG - Intronic
1078309520 11:10226471-10226493 GTGGGGTTGGGGAGGGGGGAGGG - Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078918783 11:15807244-15807266 CTGTGGCTGTGGAGGAGGGGTGG - Intergenic
1078984669 11:16581438-16581460 CAGGGCCTGTGGAGGGTGGAAGG + Intronic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080725151 11:34891306-34891328 TAGTTGTTGTTGAGGGTGGAGGG - Intronic
1081000188 11:37659739-37659761 GTGGGGTGGGGGAGGGTGGAGGG + Intergenic
1081419098 11:42851163-42851185 GGGTGGTTTTGGAGGGTGGAAGG + Intergenic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1082821176 11:57545791-57545813 CTGTGGGGCTGGAGGGTGGGTGG - Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084033741 11:66495540-66495562 CTGGGGGCGTGGAGGGTGGGTGG + Intronic
1084441150 11:69174112-69174134 TTGTGGTGGTGGAAGGTGGGGGG + Intergenic
1084889597 11:72230185-72230207 GCGTGGATGTGGAGGGTGGGCGG + Exonic
1084931808 11:72561988-72562010 CTGGGGTGGAGCAGGGTGGATGG - Intergenic
1084933740 11:72576089-72576111 TTGTGCTTGGGGTGGGTGGAGGG - Intergenic
1084944288 11:72630560-72630582 CTGGGGTTGTGGAGGGGGCATGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085757418 11:79213188-79213210 CAGTGTATGTGGAGGCTGGATGG + Intronic
1086039337 11:82456637-82456659 CTGGGGGTGTGGAGTGTGGTTGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1089096589 11:115924912-115924934 TTGGGGGTGTGGAGGGTGGGAGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1089350411 11:117818799-117818821 CTGTGGGTTTGGAGAGTGAAGGG - Intronic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090063575 11:123484669-123484691 CTGAGGTTTTGGGGGTTGGAGGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090278445 11:125435835-125435857 CTTTGGTTGTCCAAGGTGGAAGG + Intergenic
1090473074 11:126997110-126997132 CTGTGCATGTGCAGGCTGGATGG + Intronic
1091265414 11:134267155-134267177 CGCTGGATGTGGAAGGTGGAAGG + Intergenic
1091555836 12:1572840-1572862 CAGTGGCGGTGGAGGGGGGATGG + Intronic
1091783006 12:3225671-3225693 CTGTTATTGTGGAGGGCGGGGGG - Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1093623483 12:21320159-21320181 CTGGAGGTGTGGAAGGTGGAAGG - Intronic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094379893 12:29831328-29831350 CTGAGGCTGTGCAGGGTGGCAGG + Intergenic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096525332 12:52206971-52206993 GTGTGTGTGTGTAGGGTGGATGG + Intergenic
1096551379 12:52375569-52375591 CAAGGGTTGTGGAGGGGGGAGGG - Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1098791604 12:74831025-74831047 CTGTGGTTGGAGAGAGTGGTTGG + Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100797560 12:98198378-98198400 CTGAGATTTTGGAGGATGGAGGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1102198670 12:111042443-111042465 CTTTGGGGGTGGAGGGTGTAGGG - Intronic
1102471243 12:113161088-113161110 CTGTGGGTGTGGGGGTTGGGTGG + Intronic
1102796924 12:115696854-115696876 CCGTTCTTTTGGAGGGTGGATGG + Intergenic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103297296 12:119898757-119898779 CTGTTGTGGGGGTGGGTGGAGGG - Intergenic
1103606140 12:122087388-122087410 CTGGGGCTGGGGAGGGTGGGTGG + Intronic
1103619038 12:122174694-122174716 CTGTGAATGTGGCGGGTCGAAGG + Intronic
1103900339 12:124300549-124300571 CTGGGGTTGGGAAGGATGGATGG + Intronic
1103917846 12:124385186-124385208 CTGTGCTTGTGGAGGAGGGAAGG + Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104203493 12:126614762-126614784 TTGTTGTTGTGCAGGGTAGAAGG + Intergenic
1104249442 12:127077670-127077692 CTTGGGTTGTGGACTGTGGATGG - Intergenic
1104564937 12:129872092-129872114 CTGTGATTGAGGTTGGTGGAAGG - Intronic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104925478 12:132311816-132311838 CAGGGAGTGTGGAGGGTGGAGGG + Intronic
1105547020 13:21358189-21358211 CTGTGCATGTGTAGGGGGGAAGG + Intergenic
1105706686 13:22971644-22971666 CTGTGGCTGTGGGCGGTGTAGGG + Intergenic
1105729845 13:23201582-23201604 GTGTTTTTCTGGAGGGTGGAGGG - Intronic
1106175313 13:27325314-27325336 CTGTAGTTATGGCTGGTGGAAGG + Intergenic
1106476331 13:30101643-30101665 CGGAGGTGGTGGGGGGTGGAGGG - Intergenic
1106584141 13:31042856-31042878 AGGTAGGTGTGGAGGGTGGAAGG + Intergenic
1106960352 13:34990536-34990558 CTGAGGTTGTGTAGGGTAGCAGG + Intronic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1107802580 13:44123209-44123231 GTGGGGTTGGGGAGGGCGGAGGG - Intergenic
1107826648 13:44334456-44334478 CTTTGGTTTTGCAGTGTGGAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1109157489 13:58928748-58928770 CAGGGGTTGGGGAGGGTGGGAGG + Intergenic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1110333566 13:74300481-74300503 GTGTGGTAGGGGTGGGTGGATGG + Intergenic
1110383909 13:74886064-74886086 ATGTGGTGGTGGTGGGTGGGTGG + Intergenic
1110442799 13:75544103-75544125 TTGTGGTGGTGGTGGGTGGGGGG + Intronic
1110781454 13:79470552-79470574 ATGTGAATTTGGAGGGTGGAGGG - Intergenic
1111721828 13:91956023-91956045 CAGTGGCTGGGGAGGGTGGTTGG - Intronic
1111794554 13:92901467-92901489 CTGTGTTTGTGGCGGGTTGGGGG - Intergenic
1111849844 13:93559027-93559049 CAGTGGTTGTGGGGAGTGGTAGG + Intronic
1111928232 13:94485523-94485545 CTGTGTTTGTGCAAGGTTGATGG - Intergenic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113625421 13:111792772-111792794 CTTTGTTTGTGGAAGATGGAAGG - Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1114777333 14:25498659-25498681 CTGGGGTGGGGGAGGGGGGATGG + Intergenic
1115004673 14:28468004-28468026 CTGTGGTTGTGTTGGCTGGTTGG + Intergenic
1115282244 14:31677334-31677356 CTGAGGATGTGAAGGGTGGTGGG - Intronic
1115343612 14:32318613-32318635 CAGTGGTTGTGGATGGCCGACGG + Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118249170 14:64142348-64142370 CTGTGGTTATTGGGGGTGGTGGG - Intronic
1118568694 14:67171649-67171671 CTGTGTTTGTGAGGGGGGGATGG - Intronic
1119266253 14:73264693-73264715 CTGTGGGTGTGAAGAGGGGATGG - Exonic
1120736355 14:88057475-88057497 CTGTGGCTGTGGTGGGGGGTGGG + Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121008469 14:90505547-90505569 CTGTGGTCGTGAAGCATGGAAGG - Intergenic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121377988 14:93431164-93431186 CTGAGGTTGGGGCGGGTGGGGGG + Intronic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122916359 14:104860803-104860825 GGGTGGTGATGGAGGGTGGAGGG - Intergenic
1122972431 14:105157896-105157918 CTGAGGATGAGGAGGGTGGTGGG - Intronic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1123907271 15:24933314-24933336 CTGTGGCTCTGGAGGGCGGCTGG + Intronic
1124554372 15:30711305-30711327 CTGGGCTTGTGAAGGGTGGAGGG + Intronic
1124676874 15:31694372-31694394 CTGGGCTTGTGAAGGGTGGAGGG - Intronic
1126572896 15:50170498-50170520 CAGTTCTTGTGGAGGGTGGGGGG - Intronic
1127156637 15:56134761-56134783 CTGTTGTTGGGGAGGGCGGTAGG - Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128302508 15:66575402-66575424 CTGGGGTTGGTGCGGGTGGAGGG + Intergenic
1129294914 15:74594870-74594892 CTGTGGTTTGGGAGGGTTGGGGG + Intronic
1129677740 15:77641605-77641627 CTGTAATTGGGGAGGGTGTAGGG - Intronic
1129939207 15:79479141-79479163 TTGTGGTTTTTGAGGGTGGAAGG + Intergenic
1130528246 15:84725325-84725347 CTTTGGTTGTTGGGGGTGGAGGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131615863 15:94016823-94016845 CCGAGGTGGAGGAGGGTGGAAGG + Intergenic
1131668816 15:94597893-94597915 TTGTGGAAGTGGTGGGTGGATGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132345127 15:101103442-101103464 GTTGGGTTCTGGAGGGTGGAGGG - Intergenic
1132484466 16:183278-183300 CTGGAGATGTGGAGGTTGGAGGG + Intergenic
1132494349 16:253999-254021 CTGTGCTTGAGGCTGGTGGAAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133377795 16:5303622-5303644 CTGTGGTGGGGGAGAGAGGAAGG - Intergenic
1134291290 16:12904109-12904131 CTGTGGTTGCGGAAGGTGGGCGG - Intronic
1135671128 16:24376537-24376559 ATGTGATTGTGGAGGCTGGCTGG - Intergenic
1135680749 16:24454683-24454705 CATTGGTGGTGAAGGGTGGAGGG - Intergenic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1136173373 16:28501946-28501968 CTGGGGTGGTGGAGGGTGGCCGG + Intronic
1137041800 16:35620058-35620080 CTGTGGTGGAGCAGGGTGGGGGG + Intergenic
1137831231 16:51545269-51545291 CTGTGGTGGGGGAGGGTGAGTGG + Intergenic
1138069082 16:53972806-53972828 CAGTGTTTGTGGAGAGTGCAGGG + Intronic
1139891902 16:70258504-70258526 CAGTGGTGGTGGTTGGTGGAGGG - Intronic
1140132429 16:72175302-72175324 GTGTGGTTTTGGAGAGAGGAAGG + Intronic
1141048630 16:80740002-80740024 ATGTGGCTGTGGAGGGTGGTGGG + Intronic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142012050 16:87720498-87720520 CTGTGGTTGTGTGGTGAGGAGGG - Intronic
1142032889 16:87847207-87847229 CTGTGGCTCTGGGGTGTGGAGGG - Intronic
1142171497 16:88624924-88624946 CTGTGTTTCTGGAGCGTGAAGGG + Intronic
1143020906 17:3916804-3916826 CCCTGGTGGGGGAGGGTGGAGGG - Intergenic
1143106681 17:4533731-4533753 CTGTGGTTGCTGCGGATGGAGGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143432971 17:6900356-6900378 GTGTGGTGGTGGAAGGTGGGAGG + Intronic
1143583299 17:7838693-7838715 CTGCGGTTGTGCTGGGGGGAGGG - Intergenic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1144247950 17:13386061-13386083 CTGTATTTTTGGGGGGTGGATGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144729510 17:17518434-17518456 CTCTGGCTGTGGAGTGTGAATGG - Intronic
1144867616 17:18347010-18347032 CTGTGGCTGTGGATGGTGCCGGG + Intronic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145166089 17:20614322-20614344 CTCTGGTTCAGGAGTGTGGAGGG - Intergenic
1145407274 17:22614754-22614776 CTGGGAGTGTGGAGGGTGGGAGG + Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1148861382 17:50606049-50606071 CTGTGGTGAAGGAGGCTGGAGGG + Intronic
1149131507 17:53307052-53307074 CTCTGAATGTGGAGGGTGGGAGG + Intergenic
1149524101 17:57340644-57340666 CTGTGGTTCTGGGGGATGGGAGG + Intronic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1150007670 17:61479683-61479705 CTGGGGTTGGGGAGGAGGGAAGG + Intronic
1150172121 17:63008839-63008861 GTGTGGTGGTGGGGGGTGGGGGG + Intergenic
1150829273 17:68504692-68504714 GTGTAGCGGTGGAGGGTGGAGGG + Intergenic
1151175207 17:72282433-72282455 CTGGGGATGTGGAGGGTGTGCGG - Intergenic
1151536587 17:74742309-74742331 CTGGAGTTGGGGAGGGAGGATGG + Intronic
1151566365 17:74900792-74900814 TTGTGGTTGTGTAGGGTGGTGGG + Intergenic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151824825 17:76518375-76518397 ATATGGTTCTGGAGGCTGGAAGG - Intergenic
1152040793 17:77901358-77901380 TTGCAGTTCTGGAGGGTGGAAGG - Intergenic
1152190260 17:78883806-78883828 CTGGGGTTGGGGAGGGCGGCAGG - Intronic
1152269583 17:79316170-79316192 TGGTGATGGTGGAGGGTGGAGGG + Intronic
1152433476 17:80261565-80261587 CTTTGGTTGTGGTTGGGGGATGG + Intronic
1152847921 17:82613991-82614013 CTGTGGAGGTGGAGGGTGGCTGG - Intronic
1153054523 18:933041-933063 CAGAGGTTGTGAGGGGTGGAAGG - Intergenic
1153368768 18:4289223-4289245 GTGTGTTTGTCTAGGGTGGAAGG + Intronic
1153738544 18:8098786-8098808 CAGTGATTGTGGGGGATGGAAGG - Intronic
1153777461 18:8466587-8466609 CCGTGGTTAAGGTGGGTGGAGGG - Intergenic
1153814141 18:8778699-8778721 GGGAGGTTGGGGAGGGTGGAAGG - Intronic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1154336565 18:13470760-13470782 GTGTGGCTGAGGAGGGTGGCTGG - Intronic
1154460285 18:14576641-14576663 CTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1155614756 18:27708708-27708730 CTGTGGTTTAAGAGTGTGGATGG + Intergenic
1156121875 18:33854246-33854268 CTGTGGAGGTAGAGGGTGGAGGG - Intronic
1156897737 18:42265808-42265830 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1157151231 18:45220804-45220826 TTGTGGTTCTCGAGGCTGGAAGG + Intronic
1157216955 18:45792187-45792209 CAGGGCTTGTGGGGGGTGGAGGG + Intergenic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157874190 18:51256640-51256662 ATGTGGTGGTGGGGGGAGGAGGG + Intergenic
1158312206 18:56170971-56170993 CTGGGGTTGGGGAGGGGGAAAGG + Intergenic
1158561513 18:58517587-58517609 CCGTGGTTGCGGGGGGTGGGGGG - Intronic
1158581423 18:58687299-58687321 TTCTGGATGTGGAGTGTGGAGGG + Intronic
1158672319 18:59487617-59487639 TTTTGGTGGTGGTGGGTGGAGGG - Intronic
1158906054 18:62012910-62012932 CTGTGGTTATGGAGAGAGCAGGG - Intergenic
1160527114 18:79544510-79544532 CTCTGTGTGTGGAGGGTGGGCGG + Intergenic
1160953190 19:1677285-1677307 CTGAGGATCTGGGGGGTGGAGGG + Intergenic
1161271020 19:3389341-3389363 CTGGGGTTGAGGGGAGTGGAGGG + Intronic
1161684658 19:5696816-5696838 CTGTGGCCCTGGAGGGTGCATGG - Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1162345320 19:10115130-10115152 CTGGGGTAGGGGAGGGTGGCAGG + Exonic
1162473939 19:10888641-10888663 ATGGGGTTGTGGAGGGTAGGGGG - Intronic
1162913779 19:13863881-13863903 CTGTGGTGGAGGAGGCTGAAAGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163552585 19:17973977-17973999 CGGGGGTTGTGGGGGGTGGCCGG - Exonic
1164458206 19:28426737-28426759 CTGTGGTGGTGGGGGGTGGGGGG - Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165898983 19:39159844-39159866 CAGCGTCTGTGGAGGGTGGAGGG - Intronic
1165924699 19:39320097-39320119 CGGTGGTTGCGGGGGGGGGATGG - Intergenic
1166044927 19:40224454-40224476 GTGGGGTTTGGGAGGGTGGATGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166652393 19:44584349-44584371 CTGTGGTGGTGGGGAGTGTAGGG + Intergenic
1166975537 19:46603078-46603100 CTGTGGGTGTTGTGGGTGGCAGG - Intronic
1167288063 19:48610001-48610023 CTGTTGGTGTGGGGAGTGGAGGG + Intronic
1167642119 19:50687709-50687731 CTGTGGTGGTAGAGGGTGGTGGG - Intronic
1168268537 19:55236873-55236895 CCCTGGTTGTGGCGGGTGGAGGG - Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
925570121 2:5301466-5301488 TGGTGGTGGTGGTGGGTGGAAGG - Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926309865 2:11667761-11667783 CCGTGGATGTGGAGTATGGAGGG - Intronic
926730843 2:16034375-16034397 GTGTGGTCCTGGGGGGTGGAGGG + Intergenic
927510043 2:23638771-23638793 GTGTGGTTGTGGTTTGTGGATGG + Intronic
927637243 2:24825322-24825344 CGGTGGTTGTGGCGGGGGGGGGG + Intronic
927904998 2:26849259-26849281 CTGGGTTTGAGGAGGGAGGACGG + Intronic
929073991 2:38062237-38062259 CAGTGGTTGTCGAGGGTTAAAGG - Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929456332 2:42068808-42068830 CTGTGGTTGTGGAGAAAGAAGGG + Intergenic
929815145 2:45224642-45224664 CTGTGATTGTGGGGGCTGGAGGG + Intergenic
929956123 2:46460060-46460082 CTGTGGGCCTGGAAGGTGGAAGG - Intronic
930497466 2:52165009-52165031 GTGGGGTTGTGGGGGGTGGAAGG - Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932784881 2:74591513-74591535 CTGTGGTGGGGGAGGGAGCAGGG + Intronic
933089530 2:78103967-78103989 TTCTGCTGGTGGAGGGTGGAGGG - Intergenic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933760434 2:85668489-85668511 GGGAGGTTGAGGAGGGTGGAGGG + Intronic
933796403 2:85923398-85923420 CAGTTTTTGTGTAGGGTGGATGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
936899904 2:117470701-117470723 CTGTGGTGGTGGTGGGTGGGGGG + Intergenic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937260446 2:120582739-120582761 GTGTGTTTGTGGATGGTGGCTGG - Intergenic
937596035 2:123674596-123674618 TTGCAGTTTTGGAGGGTGGAAGG - Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940622859 2:156134748-156134770 TGGTGGTGGTGGGGGGTGGAGGG - Intergenic
941644659 2:168027077-168027099 CTGAGTTTGTTGAGGTTGGAGGG + Intronic
941720031 2:168802701-168802723 CTGCGTGTGAGGAGGGTGGAGGG + Intronic
942413812 2:175737677-175737699 GTGTGGATGTGGGGGGTGGGGGG - Intergenic
942986426 2:182148268-182148290 CTGTGTGTGTGGAGGGGGGTGGG + Intronic
943013903 2:182487646-182487668 CTGTGGTTGGGGTGTGGGGATGG + Intronic
944023885 2:195140906-195140928 CTCTGGTAGTGCAAGGTGGATGG + Intergenic
944661095 2:201922622-201922644 CGGTGGTTGTGGAGGGGAGTGGG - Intergenic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
946028299 2:216685747-216685769 CAGTGGTTGTGGCAGGGGGAAGG + Intronic
946228763 2:218278999-218279021 CTGTGGTTGGGCAGGGAGGCAGG - Intronic
946301136 2:218824584-218824606 GGGTGGTTGTGGGGGGTGGGGGG + Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946328516 2:218997143-218997165 CTGTGGATGTGGAGGGGGTAGGG - Intergenic
946370750 2:219279933-219279955 CCATGGTGGTGGCGGGTGGAGGG - Intronic
946714000 2:222534142-222534164 TTGTGTTTGTGGAGGAAGGAGGG + Intronic
947242833 2:228015067-228015089 CTGTTGTGGGGGAGGGGGGAGGG - Intronic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
948952949 2:241266670-241266692 CTGTGGTTGTGGGGCAGGGAGGG - Intronic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
949058906 2:241945266-241945288 CTCTGGTGGTGGAAGGTGAAGGG - Intergenic
1169198650 20:3697040-3697062 CTGGGGACTTGGAGGGTGGAGGG - Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169665769 20:8033716-8033738 CTGAGGTTCTGGAAGGTGGCTGG + Intergenic
1169781190 20:9312343-9312365 GTGTGTGTGTGTAGGGTGGAAGG - Intronic
1170196918 20:13698560-13698582 CTGTGCTTGTGTATGGTAGATGG - Intergenic
1170372675 20:15666763-15666785 CTGTGGTTGTGCAGGGGTGCTGG - Intronic
1170789176 20:19493806-19493828 CAGTGTTTCTGGAGTGTGGAGGG - Intronic
1170848509 20:19982458-19982480 TGGTGGCTGAGGAGGGTGGAAGG - Intronic
1171175951 20:23050737-23050759 CTGTGGATGGGCAGGGTGGGGGG + Intergenic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1173185447 20:40836755-40836777 AAGGGGTTGTGGAGGCTGGAGGG - Intergenic
1173577617 20:44123271-44123293 CTGTGGATGTGGAAGGAGGTGGG - Intronic
1173942846 20:46926710-46926732 AAGTGGCTGTGGAGGGTGGTAGG + Intronic
1173964740 20:47103663-47103685 CTGTTCTTGTGGTGGGTGGGTGG - Intronic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174250936 20:49219175-49219197 CAGTATTTGAGGAGGGTGGAAGG - Intergenic
1174394372 20:50237580-50237602 CTGTGGGTATGGATGGTGGCTGG + Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174797995 20:53538632-53538654 CTTTGGTTCTGAAGGATGGAGGG + Intergenic
1175335213 20:58191468-58191490 CTGTGGCTCTGTAGGATGGAGGG - Intergenic
1175368996 20:58474299-58474321 CTGTGGTTCAGAGGGGTGGAGGG + Intronic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175460129 20:59146185-59146207 TTGTGTGTGTGGAGGGTGGTGGG - Intergenic
1175774686 20:61645724-61645746 CTGTGGTTCTGGGTGGTTGAAGG - Intronic
1175883556 20:62274534-62274556 CTGTGGTTCTGAAGGAGGGAGGG + Intronic
1175934700 20:62509474-62509496 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175934997 20:62510276-62510298 CTGGAGGGGTGGAGGGTGGAGGG - Intergenic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176182638 20:63758123-63758145 CTCTGGATGGGGCGGGTGGAGGG - Intronic
1176184219 20:63769318-63769340 CTCTGAGGGTGGAGGGTGGAGGG + Intronic
1177067337 21:16456314-16456336 CTGTGGAGGTTGAGGGTGGGAGG - Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1177348175 21:19900317-19900339 CTGTGCATGTGTAGGGTGGAGGG - Intergenic
1178091292 21:29166161-29166183 CAGAGGTTGGGGAGGGTGGTAGG - Intronic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1179411543 21:41167383-41167405 CTGGGAGGGTGGAGGGTGGAAGG - Intergenic
1180019027 21:45108615-45108637 ATGTGGGTGTGGTGGTTGGAAGG - Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182201689 22:28578512-28578534 CTGTAGTGGTGGGGGTTGGAGGG - Intronic
1182970557 22:34570872-34570894 CTGTGGTTGTGGGAGGGGGCTGG - Intergenic
1183024286 22:35052426-35052448 CTGGGGATGGGGATGGTGGATGG - Intergenic
1183108274 22:35630051-35630073 CTGTGGTTGTGGGGTGGGGTGGG + Intronic
1183732339 22:39625691-39625713 AGGTGGTTGGGGAGGGAGGAAGG + Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185160661 22:49227403-49227425 CTGTGGTTGTCTAGGGTTGGGGG + Intergenic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949725436 3:7039193-7039215 CTGTGATTGTGGAGTTTGCATGG + Intronic
950116971 3:10457214-10457236 GTGTGGGTGTGTAGGGTGTATGG + Intronic
950158826 3:10743753-10743775 CAGTGGCGGGGGAGGGTGGAGGG - Intergenic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
951699929 3:25485920-25485942 TTGGGGTTGTGGAGTTTGGAGGG + Intronic
951908498 3:27726211-27726233 CCTTGGTTGTGGGGGGTGGGTGG - Intergenic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
952917056 3:38254598-38254620 CTTTTTTTGTGGAGGGGGGACGG + Exonic
954690460 3:52392807-52392829 CTGTGGGTGTAGTGGGTGGGGGG - Intronic
954778251 3:53039438-53039460 CAGTGGTTGTCTAGGGTGGGAGG + Intronic
955095737 3:55796067-55796089 TTGTGGTGGTTGAGGGGGGAGGG + Intronic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
956800469 3:72753468-72753490 CAGGGGTTGTGGGGGGTGGGGGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958180245 3:90050615-90050637 CTATGTGTGTGGAGGGTGGTAGG + Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959368296 3:105491140-105491162 CTGTGGCTTTAGAGGGTGCAAGG - Intronic
959724383 3:109527339-109527361 ATGGGGTGGTGGAGGGTGGAGGG + Intergenic
959752878 3:109858968-109858990 GATTGGTTGTGGGGGGTGGAGGG + Intergenic
961048764 3:123728561-123728583 TTGTTGTTTGGGAGGGTGGAGGG - Intronic
961053130 3:123764454-123764476 CTTTGGTGGTGTGGGGTGGAGGG + Intronic
961070892 3:123925320-123925342 CTGGGGTTGTGGTGGATGTAAGG + Intronic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961872634 3:129999902-129999924 TTGGGGGGGTGGAGGGTGGAGGG - Intergenic
961924262 3:130460714-130460736 TTGTGGTTGAGGTGGGTGGTAGG + Intronic
962343338 3:134602828-134602850 CTGTGGCTGTGCAGGTGGGAGGG - Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963878673 3:150503935-150503957 CAGTGACTGTGAAGGGTGGATGG - Intergenic
964240599 3:154589021-154589043 CTCTGGCTGTGGAGCGTGGGAGG + Intergenic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964542646 3:157796718-157796740 CTGTGGGTGAGTATGGTGGAAGG - Intergenic
965341931 3:167502187-167502209 CAGTGGTGGTGGAAGGTGAAGGG - Intronic
965530930 3:169769274-169769296 CTGGGGCTGGGGAGGGTGGGTGG - Intronic
965541678 3:169877762-169877784 CTCGGGTTTTGGAGGCTGGATGG - Intergenic
966758599 3:183394408-183394430 GTCTGGTTGTGGAGGTAGGAGGG - Intronic
968077123 3:195822129-195822151 CTGGGGTTGTTCTGGGTGGAGGG + Intergenic
968519153 4:1027935-1027957 CTGGAGTAGGGGAGGGTGGAAGG + Intergenic
968533037 4:1105318-1105340 CTGGGGATGTGGTGGGTGGCTGG - Intronic
968562536 4:1292121-1292143 CCGGGGTTGTGGAAGGTGGGGGG + Intronic
968758914 4:2431664-2431686 ATGAGGTTGGGGAGGGTGTACGG - Intronic
968913889 4:3488839-3488861 CTGTGGATGTGGAAGGGGCAGGG + Intronic
969016749 4:4108381-4108403 CTGTGGGGCTGGAGCGTGGAGGG + Intergenic
969054162 4:4391132-4391154 CTTTGGCTCTGGTGGGTGGAAGG + Intronic
969167423 4:5329186-5329208 CTGTGATGGTGGAGGGTGCAGGG - Intronic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
970415937 4:15856901-15856923 CTGGGGTTGTGGAAGGTGTGTGG + Intergenic
971485634 4:27157141-27157163 CAGTGGCTGTGGAGAGTGGGGGG - Intergenic
971944872 4:33261392-33261414 CTGTGGTTGTGGGCAGTAGAAGG - Intergenic
972469605 4:39391210-39391232 CTGTGGTGATGGAGGCTGAAGGG - Intergenic
972945176 4:44244838-44244860 CTGTAGTTGTGGGGGGGGGGGGG + Intronic
973345167 4:49047356-49047378 CTATGCTGGTGGAGGGAGGATGG + Intronic
974725551 4:65794413-65794435 CTGTGGCTTTGCAGGGTGTAGGG + Intergenic
976184548 4:82430779-82430801 CTGCTGTTGGGGAGGGCGGAGGG - Exonic
977308416 4:95354359-95354381 CTGTGTTTTTGGAATGTGGAGGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977697871 4:99987005-99987027 TTGTCGTTGTGGTAGGTGGAGGG + Intergenic
978267096 4:106839588-106839610 GTGAGGTTGTGCAGGGTGGCAGG + Intergenic
978852225 4:113352929-113352951 CTGTGGTGGTGGTGGTGGGAGGG - Intronic
979177160 4:117679385-117679407 CTGTGGTGGGGAAGTGTGGAAGG + Intergenic
979312539 4:119220865-119220887 ATGTGGGTGTGGTTGGTGGATGG + Intronic
979382986 4:120030490-120030512 CAGGGGTTGTGGAGAGTTGAGGG - Intergenic
979626734 4:122853350-122853372 CTCTGATTCTGGAGGGTGGAGGG - Intronic
979791669 4:124790541-124790563 ATGTGGTTTTAGAGGGTGGGAGG + Intergenic
979984322 4:127295618-127295640 CTGTGGTTTTGCAGGGTACAGGG + Intergenic
981141537 4:141275209-141275231 ATTTGGTTGTGGAGAGTAGAAGG - Intergenic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
981552865 4:145959444-145959466 TGGTGGTGGTGGTGGGTGGATGG + Intergenic
982452237 4:155566805-155566827 CTGTGGGTGGGGAGTGTGGCTGG - Intergenic
983442832 4:167809503-167809525 CTCTGGAGGTGGTGGGTGGAAGG - Intergenic
983855939 4:172644889-172644911 CTGCCATTGTGGTGGGTGGATGG + Intronic
984886430 4:184454148-184454170 CTGTGGATGTGGAGTGTGGGAGG - Intronic
984931470 4:184851262-184851284 CTGTGCTGGTGAAGGGTGGATGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985063368 4:186099403-186099425 GTGGGGTGGTGGAGGGGGGAGGG - Intergenic
985318048 4:188679255-188679277 TTATGGTTCTGGAGGCTGGAAGG - Intergenic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987626413 5:20406427-20406449 CTGTTGTGGGGGAGGGGGGAGGG + Intronic
987716145 5:21574141-21574163 CTGTGGTGGTGGAGGGGGTGGGG + Intergenic
988923851 5:35969476-35969498 CTTTGGTGGTGGTGGGTGGATGG - Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989411248 5:41122175-41122197 CTTTGGTTGTGAAGAGTGGGAGG - Intergenic
990210579 5:53479146-53479168 TTGCAGTTGTGGAGGGGGGAAGG + Intergenic
990953360 5:61320179-61320201 TTGGGGTTGTGGGGGGTGGGTGG + Intergenic
991519508 5:67480065-67480087 CTTTGGTTGCTCAGGGTGGATGG + Intergenic
992370200 5:76135812-76135834 CAGTGGTTGTTGAGGGGGGCAGG + Intronic
992950176 5:81850852-81850874 CTGTCGTGGGGGTGGGTGGACGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993680698 5:90874163-90874185 CTGTGGCTGTGCTGGGTGAACGG - Intronic
993807744 5:92433485-92433507 GTGTGGTGGTGGTGGGTGGGTGG - Intergenic
994106229 5:95952300-95952322 CTTTGAGGGTGGAGGGTGGAAGG + Intronic
995554493 5:113313495-113313517 CGGTGGTTGGGGAGGAAGGAGGG + Intronic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
995782913 5:115796956-115796978 GTGTGTTTGTGGAGGATTGAGGG + Intergenic
995925592 5:117369699-117369721 CTGTGGCTTTGTAGGGTGCAGGG - Intergenic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997056674 5:130452208-130452230 CTGTGGCTTTAGAGGGTGGAAGG - Intergenic
997536358 5:134625304-134625326 CACTGCTGGTGGAGGGTGGAAGG - Intronic
997668019 5:135647931-135647953 CTGTGGTTGTAGAGAGAGGAAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
997825808 5:137106117-137106139 CTCTGGTTGTGGTGGGGGGTGGG - Intronic
997976853 5:138445941-138445963 CTGTGGGGGTTGAGGGTAGAGGG + Exonic
998406131 5:141875888-141875910 CTGTGTTTGTAGGGGGTGGGGGG - Intronic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
999075463 5:148791398-148791420 CTGTGGATGTGGGTGGGGGATGG - Intergenic
999200249 5:149811186-149811208 CTGTGGGTGTGGACTATGGAGGG - Intronic
999268799 5:150284471-150284493 GTGTGCTTGTGGAGGGAGGTGGG + Intronic
999745595 5:154589605-154589627 CTCTGGGTGTCGATGGTGGAAGG - Intergenic
999980100 5:156949777-156949799 TTGTGTTTGTGGTGGGTGGTGGG + Intronic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000260168 5:159580605-159580627 GTGTGGCTGTGGAGTGTGGCAGG - Intergenic
1000540012 5:162527956-162527978 CTGTTATTGTGGAGAGAGGAAGG + Intergenic
1000990151 5:167903529-167903551 GGGTGGGGGTGGAGGGTGGAAGG + Intronic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002192045 5:177483462-177483484 CTGTGGTGGTGGAGGGAGTGGGG + Exonic
1002457275 5:179352588-179352610 CAAAGGTGGTGGAGGGTGGAAGG + Intergenic
1002466625 5:179411931-179411953 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466707 5:179412117-179412139 CGGTTGTGGGGGAGGGTGGAAGG - Intergenic
1002466717 5:179412141-179412163 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002466826 5:179412392-179412414 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466927 5:179412622-179412644 CGGTGGTGGGGGAGGGAGGAAGG - Intergenic
1002466977 5:179412739-179412761 CGGTGGGGGGGGAGGGTGGAAGG - Intergenic
1002910968 6:1490800-1490822 CTGTAGATGGGGTGGGTGGAGGG - Intergenic
1003110752 6:3250380-3250402 CTGTGCTTGTGAAGGGTGAGTGG + Intronic
1003582837 6:7358111-7358133 CTTTGGTTGTGGAGGTTGACGGG - Intronic
1003901600 6:10660033-10660055 CAGTAGATGTGGAGGGTGCACGG + Intergenic
1005222077 6:23598233-23598255 CTGGGGTGGGGGAGGGGGGAAGG + Intergenic
1005822227 6:29607416-29607438 GTGTGGAAGTAGAGGGTGGATGG - Intronic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006880237 6:37332598-37332620 ATTTGGTAGTGGAGGGTGGGGGG + Exonic
1007229358 6:40337749-40337771 CAGGGGTTGTGGTGGGGGGATGG - Intergenic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007732322 6:43954699-43954721 GTGGGGTGGGGGAGGGTGGAGGG - Intergenic
1007896708 6:45369554-45369576 CTTTGGTGGAGGAGAGTGGAGGG - Intronic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1008551131 6:52632185-52632207 TTGTGGTTGCTGAGAGTGGAGGG - Intergenic
1008605665 6:53137107-53137129 CTGTGGTTTGGGAAGGGGGAAGG + Intronic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1010347022 6:74824148-74824170 GTGGGGTGGTGGAGGGTGGAGGG - Intergenic
1011031413 6:82927877-82927899 CAGTAGTTGTGGGGGGAGGAAGG + Intronic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011493375 6:87915348-87915370 ATGTGTGTGTGGAGGGTGGGAGG + Intergenic
1011566558 6:88679703-88679725 CTGTGCTTGTGGAGTATGTAAGG + Intronic
1014041996 6:116838750-116838772 CTGGGGTGGAGGAGGGGGGAGGG + Intergenic
1014813152 6:125907393-125907415 CTGTGTTTGGGGAGTGTGAAGGG - Intronic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015480246 6:133700638-133700660 CTGGGATTGGGGAGGGTGGGAGG - Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1016915912 6:149244342-149244364 CGGTGGCGGTGGAGGGTGGGTGG + Intronic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1018549716 6:164981782-164981804 CTGTGTTTGTACAGGGTAGAAGG - Intergenic
1018829584 6:167433056-167433078 TGGTGGTGGTGGAGTGTGGATGG + Intergenic
1018829802 6:167433999-167434021 TGGTGGTTGTAGAGTGTGGATGG + Intergenic
1018829856 6:167434253-167434275 TGGTGGTTGTAGAGTGTGGATGG + Intergenic
1018829937 6:167434610-167434632 TGGTGGTTGTAGAGTGTGGATGG + Intergenic
1018829953 6:167434688-167434710 TGGTGGTTGTAGAGTGTGGATGG + Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019286976 7:228527-228549 TGGGGGCTGTGGAGGGTGGAAGG + Exonic
1019299608 7:296501-296523 CTGTGCTCGGGGAGGATGGAGGG - Intergenic
1019323597 7:426469-426491 GAGTGTTGGTGGAGGGTGGAGGG - Intergenic
1019341419 7:510645-510667 CTGTGGTGGTGGATGCAGGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1022461970 7:30617809-30617831 GTTTGGTGGTGGAGGCTGGAGGG - Intronic
1022468382 7:30666432-30666454 CAGGGGTTGGGTAGGGTGGAGGG - Intronic
1023275862 7:38517993-38518015 GTGAGCCTGTGGAGGGTGGAGGG - Intronic
1023849295 7:44141207-44141229 CTGTGCTTGTGTTGGGTTGAGGG - Intronic
1024081713 7:45862160-45862182 CTGTGTTTGTTGAGTGTGTAGGG - Intergenic
1024729190 7:52235710-52235732 CTGAGGTTGTGCAGGGTAGCAGG - Intergenic
1025709407 7:63893063-63893085 CTGAGGTCCTGGAGGCTGGAGGG + Intergenic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027533605 7:79367406-79367428 GAGTGATTTTGGAGGGTGGAAGG + Intronic
1028009334 7:85620640-85620662 CTGGGGCTTTGGGGGGTGGAGGG + Intergenic
1028865893 7:95711043-95711065 ATGTGGTAGTGAAGTGTGGAAGG - Intergenic
1029126026 7:98295750-98295772 GTGTGCTTGGGGTGGGTGGAGGG - Intronic
1029457754 7:100679638-100679660 CTGGGGTTGGGGTGGGTGCAGGG - Exonic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1031311692 7:120207128-120207150 CAGTGGTCGGGGAGGGTGGCAGG - Intergenic
1032023364 7:128422137-128422159 CTGTGTTTGTGGTGTGTGGGGGG + Intergenic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1032195614 7:129786631-129786653 CTCTCGTTGCGCAGGGTGGAGGG + Intergenic
1032345831 7:131115674-131115696 CTGCGGTGGTGGAGAGTGGTGGG - Intronic
1032616438 7:133477315-133477337 CAGGGGTTAGGGAGGGTGGAGGG - Intronic
1033116824 7:138632710-138632732 AGGGGGTTGTGGAGGGAGGATGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035213387 7:157345947-157345969 CTGAGCTTCTGTAGGGTGGAGGG + Intronic
1035225034 7:157428156-157428178 CTGCAGTTGAGGAGGGAGGAGGG + Intergenic
1035309635 7:157957255-157957277 CTGTTGCTGTGGAGAGGGGATGG - Intronic
1035636047 8:1145180-1145202 CTGTGTTTCTGGATGGTGGCTGG - Intergenic
1035643540 8:1201237-1201259 GTGTGATTGTGGAGGCTGGCAGG + Intergenic
1036142981 8:6225463-6225485 CTGGGCTTGTGGAGGGTGGCAGG - Intergenic
1036508729 8:9380869-9380891 CTGTGGTTGCAGAGGATGTATGG + Intergenic
1036924802 8:12893969-12893991 TTGTGGTGGTGGTGGGTGGTGGG - Intergenic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037674706 8:21043276-21043298 GTGGGGTGGTGGAAGGTGGAGGG - Intergenic
1037675034 8:21044014-21044036 GGGTGGTGGTGGAAGGTGGAGGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1038314761 8:26474810-26474832 CTGTGGTTGTCAGGGATGGAGGG - Intronic
1038418458 8:27415251-27415273 GGGTGGTGGTGGTGGGTGGATGG + Intronic
1039081324 8:33737035-33737057 ATCCAGTTGTGGAGGGTGGAGGG + Intergenic
1039444538 8:37620686-37620708 CTGGGGGTGGGGAGGGTGAAGGG - Intergenic
1040932278 8:52747770-52747792 CTGTGGGCGTGGAGGTTGCAGGG - Intergenic
1041117561 8:54554670-54554692 CTGTGGTTGCCGAGGGAGGGAGG + Intergenic
1041682192 8:60605072-60605094 CTGAGGCTGTGCAGGGTGGTGGG - Intronic
1042072362 8:64949739-64949761 CTGAGGTTGTACAGGGTGGTGGG + Intergenic
1042713719 8:71748061-71748083 TGGTGATTGGGGAGGGTGGAGGG - Intergenic
1043211417 8:77523566-77523588 CTTGTGTGGTGGAGGGTGGAAGG + Intergenic
1043255382 8:78130247-78130269 CTGAGGTTGTGGATGCTGAATGG + Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1047773464 8:128049453-128049475 CTGTGGCTCTGTAGGGTGAAGGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1049172778 8:141172241-141172263 CTGTGGGTGTGCACGGTGGTGGG + Intronic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049217356 8:141414393-141414415 CTGTAGTGGTGGAAGGTGGCTGG + Intronic
1049354816 8:142182438-142182460 CTGTGGCTGTGGACGGTGAGAGG + Intergenic
1049359014 8:142203005-142203027 CTGTGACTGTGCAGGGTGAACGG + Intergenic
1049376639 8:142292474-142292496 CTGTGGAGGTGGTGGGTGGCGGG + Intronic
1049611011 8:143555330-143555352 ATGTGGCGGTGAAGGGTGGAGGG + Intronic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050402658 9:5272210-5272232 CTGTGGTTATGACTGGTGGATGG + Intergenic
1050437756 9:5628582-5628604 CTGTGGCTGTGGTGGGCGGTAGG - Intergenic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051055568 9:12981009-12981031 CCATGTTTATGGAGGGTGGAGGG - Intergenic
1051318577 9:15872738-15872760 CTGTGGTTCAGAAGGGTAGAAGG + Intronic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1056077807 9:83059604-83059626 GTGTGGGTGTTGAGGGTGGAGGG - Intronic
1056485077 9:87047737-87047759 CTGTTGTGGGGGAGGGGGGAAGG + Intergenic
1056735022 9:89201994-89202016 TTGGGGTTGGAGAGGGTGGATGG - Intergenic
1056942239 9:90965504-90965526 CTGTGATTGTGGAGCCTGGAAGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057249888 9:93492665-93492687 GTGGGGTGGTGGAGGGTGGCTGG + Intronic
1057270052 9:93645503-93645525 CTGTGGCTGTGGGAGGTGGGTGG + Intronic
1057620378 9:96629294-96629316 CTGTAGTTGTGGAAGGGTGAAGG + Intergenic
1058626464 9:106938751-106938773 CTGTGGTTGTGGCAGGTTGTTGG + Intronic
1058781517 9:108341239-108341261 TTGTGGTTGTGGTGGGTGGTTGG + Intergenic
1058840516 9:108903218-108903240 GTGGGGTGGGGGAGGGTGGAGGG - Intronic
1059446682 9:114342502-114342524 CTGTGGTTGGGGCGGGGGGTTGG - Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1060246151 9:121947929-121947951 CCGTGCTTTTGGAGGATGGAAGG + Intronic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1060937938 9:127526812-127526834 CTGTGGCTGTCGAGGGTGGGAGG + Intronic
1061012416 9:127963506-127963528 CAGTGGCTGTGGTGGGTGCAGGG - Intronic
1061076512 9:128344707-128344729 CTGTGGTCATGGTGGGTCGAGGG + Intronic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061296874 9:129681686-129681708 TTCTGGTTTTGGGGGGTGGAGGG - Intronic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061420757 9:130471891-130471913 TTTTGGTTGTGGGGGGTGGGGGG + Intronic
1062287343 9:135779028-135779050 CTGTGGTTGTGGGGGTTTCAGGG - Intronic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1187223396 X:17352783-17352805 TTGTGCGGGTGGAGGGTGGAGGG - Intergenic
1187478088 X:19629469-19629491 CTGGGGTAGTGAAGGATGGAGGG - Intronic
1188448302 X:30281181-30281203 ATGAGGTTGGGGAGGGGGGAGGG - Intergenic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189411828 X:40779539-40779561 CTCTGCTTGTGGAAAGTGGAGGG - Intergenic
1190119754 X:47650395-47650417 CTCTGGGCCTGGAGGGTGGAGGG - Intronic
1190176238 X:48152579-48152601 CAGGGGTTGGGGATGGTGGATGG + Intergenic
1191182309 X:57576702-57576724 CTGTAGTTTTGGAGTGTGTATGG + Intergenic
1192036984 X:67574307-67574329 CTGTTGTTTTAGAGGGTGGGAGG - Intronic
1192221235 X:69198703-69198725 CTGAGGTTGGGAATGGTGGAGGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194042009 X:88952558-88952580 ATGAGGTTGGGGAGGGGGGAGGG + Intergenic
1194206323 X:91015589-91015611 CTGAGGTTGTACAGGGTGGCGGG + Intergenic
1194517112 X:94868237-94868259 GTGTGGTGGGGGAGGGGGGAGGG + Intergenic
1194558549 X:95393105-95393127 CTGGGGTGGGGGAGGGGGGAGGG + Intergenic
1194706052 X:97177126-97177148 CCATGGATATGGAGGGTGGAGGG + Intronic
1194876956 X:99201183-99201205 CTGTGGCTTCAGAGGGTGGAAGG + Intergenic
1195001131 X:100644534-100644556 TTGGGGTAGTGGAGTGTGGAGGG - Intronic
1195047055 X:101063731-101063753 GTCTGGTGGTGGAGGGTGGAGGG - Intergenic
1195309829 X:103621394-103621416 CTAGGGTTGGGGAGGATGGAGGG + Intronic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195679288 X:107531719-107531741 GTGTGGTAGCAGAGGGTGGAGGG - Intronic
1196196895 X:112846278-112846300 GTGTGGTTGGGAAGGGTGGAAGG - Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1197264423 X:124352835-124352857 CAGAGGTTGGGAAGGGTGGAAGG + Intronic
1197346317 X:125327926-125327948 CTGTGGTTGAGGAAGGGGGCAGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1198037595 X:132817062-132817084 CTGTGATTGTGAAGAGTGTATGG - Intronic
1199209801 X:145194625-145194647 CTGTGGTTGTGTAGCATTGAAGG - Intergenic
1199487388 X:148362841-148362863 CTGTAGATGTGGTGGGTGGAGGG + Intergenic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic
1199708160 X:150449118-150449140 CAGTGGTTGGGCAGGGTGGGGGG + Intronic
1200303918 X:155006330-155006352 CTCTGGTTCTGGTGGCTGGAGGG - Intronic
1200317468 X:155148576-155148598 CTCTGGTTCTGGTGGCTGGAGGG + Intergenic
1201427104 Y:13863779-13863801 CTCTCGTTGTGCAGGCTGGAGGG + Intergenic
1201721065 Y:17097926-17097948 GTGTGGTGGGGGAGGGGGGAGGG - Intergenic
1201771557 Y:17621421-17621443 CTGGGGTTGTGGGGGGGGCAGGG - Intergenic
1201829998 Y:18284565-18284587 CTGGGGTTGTGGGGGGGGCAGGG + Intergenic