ID: 922706631

View in Genome Browser
Species Human (GRCh38)
Location 1:227793898-227793920
Sequence ATCCCTGGGAAGCCAGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922706622_922706631 15 Left 922706622 1:227793860-227793882 CCTCATGCCTTCCGAGGAGGCCT No data
Right 922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG No data
922706625_922706631 -5 Left 922706625 1:227793880-227793902 CCTGAGCCAAAAGCCAGCATCCC No data
Right 922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG No data
922706623_922706631 8 Left 922706623 1:227793867-227793889 CCTTCCGAGGAGGCCTGAGCCAA No data
Right 922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG No data
922706624_922706631 4 Left 922706624 1:227793871-227793893 CCGAGGAGGCCTGAGCCAAAAGC No data
Right 922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG No data
922706621_922706631 16 Left 922706621 1:227793859-227793881 CCCTCATGCCTTCCGAGGAGGCC No data
Right 922706631 1:227793898-227793920 ATCCCTGGGAAGCCAGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922706631 Original CRISPR ATCCCTGGGAAGCCAGGCCA TGG Intergenic
No off target data available for this crispr