ID: 922707962

View in Genome Browser
Species Human (GRCh38)
Location 1:227800351-227800373
Sequence AAGGAGAAGGAGAAGGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922707962_922707970 21 Left 922707962 1:227800351-227800373 CCCCCCTCCTTCTCCTTCTCCTT No data
Right 922707970 1:227800395-227800417 TTCTTCTTCCTCTGTCACCCAGG No data
922707962_922707971 25 Left 922707962 1:227800351-227800373 CCCCCCTCCTTCTCCTTCTCCTT No data
Right 922707971 1:227800399-227800421 TCTTCCTCTGTCACCCAGGCTGG 0: 468
1: 33436
2: 114170
3: 175711
4: 175107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922707962 Original CRISPR AAGGAGAAGGAGAAGGAGGG GGG (reversed) Intergenic
No off target data available for this crispr