ID: 922708572

View in Genome Browser
Species Human (GRCh38)
Location 1:227807525-227807547
Sequence TAATTCATGTGGAAGAGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922708572_922708574 23 Left 922708572 1:227807525-227807547 CCATTACTCTTCCACATGAATTA No data
Right 922708574 1:227807571-227807593 TGTGCATTTAAAAGCTATGTTGG No data
922708572_922708575 24 Left 922708572 1:227807525-227807547 CCATTACTCTTCCACATGAATTA No data
Right 922708575 1:227807572-227807594 GTGCATTTAAAAGCTATGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922708572 Original CRISPR TAATTCATGTGGAAGAGTAA TGG (reversed) Intergenic
No off target data available for this crispr