ID: 922710695

View in Genome Browser
Species Human (GRCh38)
Location 1:227828757-227828779
Sequence TGTCCCTACATAACCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 148}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922710695_922710707 6 Left 922710695 1:227828757-227828779 CCCCCCAGGGTTATGTAGGGACA 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922710707 1:227828786-227828808 CCACCTTGCTGGGAATCCTGGGG 0: 2
1: 4
2: 6
3: 48
4: 244
922710695_922710705 5 Left 922710695 1:227828757-227828779 CCCCCCAGGGTTATGTAGGGACA 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922710705 1:227828785-227828807 CCCACCTTGCTGGGAATCCTGGG 0: 1
1: 6
2: 7
3: 45
4: 242
922710695_922710710 28 Left 922710695 1:227828757-227828779 CCCCCCAGGGTTATGTAGGGACA 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922710710 1:227828808-227828830 GCCAGAGTATACAAAACTCCTGG 0: 1
1: 7
2: 33
3: 55
4: 208
922710695_922710702 -4 Left 922710695 1:227828757-227828779 CCCCCCAGGGTTATGTAGGGACA 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922710702 1:227828776-227828798 GACAGGTTTCCCACCTTGCTGGG 0: 1
1: 0
2: 4
3: 18
4: 172
922710695_922710712 29 Left 922710695 1:227828757-227828779 CCCCCCAGGGTTATGTAGGGACA 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922710712 1:227828809-227828831 CCAGAGTATACAAAACTCCTGGG 0: 1
1: 8
2: 30
3: 66
4: 265
922710695_922710701 -5 Left 922710695 1:227828757-227828779 CCCCCCAGGGTTATGTAGGGACA 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922710701 1:227828775-227828797 GGACAGGTTTCCCACCTTGCTGG 0: 1
1: 1
2: 0
3: 18
4: 129
922710695_922710703 4 Left 922710695 1:227828757-227828779 CCCCCCAGGGTTATGTAGGGACA 0: 1
1: 0
2: 1
3: 10
4: 148
Right 922710703 1:227828784-227828806 TCCCACCTTGCTGGGAATCCTGG 0: 1
1: 6
2: 16
3: 406
4: 16901

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922710695 Original CRISPR TGTCCCTACATAACCCTGGG GGG (reversed) Intronic
900899186 1:5505296-5505318 TTTCCCTACATCAGCCTGGATGG + Intergenic
902984847 1:20149090-20149112 TGTCCCCATATTAGCCTGGGGGG - Exonic
904046932 1:27614765-27614787 TGTCCCTTCAAACGCCTGGGAGG - Intronic
904751970 1:32746524-32746546 TGTCCTTACAGCAACCTGGGAGG + Intronic
905804360 1:40864993-40865015 TCTCCCTACATCACCCGGGCTGG - Intergenic
906388756 1:45395243-45395265 TGTACTTACATAAACCTGGATGG + Intronic
907282746 1:53361809-53361831 TGTCCCTAGATGGCACTGGGAGG - Intergenic
908193264 1:61725018-61725040 AGTCACTACAGGACCCTGGGGGG - Exonic
909466907 1:75982826-75982848 TGTTCCTACTTAACCCTGGGTGG + Intergenic
912429834 1:109623288-109623310 TGTCTCTACCTACCTCTGGGAGG - Intronic
912689312 1:111792415-111792437 TGTCCTTCCCTGACCCTGGGAGG - Intronic
919824711 1:201495198-201495220 TCTCCCTATATTACCCAGGGTGG - Intronic
921118874 1:212119456-212119478 TGTCCCCACATAGCCCTGCCAGG + Intergenic
922710695 1:227828757-227828779 TGTCCCTACATAACCCTGGGGGG - Intronic
924304817 1:242676933-242676955 TGTACCTACACAAAACTGGGTGG + Intergenic
1063212837 10:3896626-3896648 TCTCCCTACATTGCCCAGGGTGG - Intergenic
1063927355 10:10993591-10993613 TGTCCCATCATAACCTTGGCAGG - Intergenic
1065124391 10:22560102-22560124 TGTCCCTAACTAACACTGGCTGG + Intronic
1067477494 10:46576532-46576554 TGTCCATGCAGTACCCTGGGAGG - Intergenic
1067617246 10:47765252-47765274 TGTCCATGCAGTACCCTGGGAGG + Intergenic
1068160925 10:53263138-53263160 ATTTCCCACATAACCCTGGGAGG - Intergenic
1069858803 10:71457490-71457512 AGACCCTACACAATCCTGGGAGG - Intronic
1071275934 10:84054976-84054998 TGTCCCTACAGAACCCTGCCAGG + Intergenic
1071721658 10:88152721-88152743 TGCCCCAACATAACCATGGTAGG - Intergenic
1072765354 10:98090416-98090438 GATCCCTACAAAACCCTGTGAGG - Intergenic
1073011524 10:100363650-100363672 TGACCCTACATAAGGCTGGATGG + Exonic
1073759442 10:106613761-106613783 TGGCCCTACATAACCTGGTGGGG + Intronic
1073824072 10:107300221-107300243 TGTCCTTCCATATCACTGGGAGG + Intergenic
1074913452 10:117933525-117933547 TGTCCTTACACAAACCTAGGTGG - Intergenic
1083089308 11:60183915-60183937 TGCCCCTTCAAAACCTTGGGTGG + Intronic
1084135469 11:67176605-67176627 TGTACTTACACAAACCTGGGTGG + Intronic
1084220431 11:67674423-67674445 TGGCCCCACATAACCCAGCGTGG + Exonic
1085565242 11:77507719-77507741 TCTCCCTACATTGCCCTGGCTGG + Intergenic
1085590369 11:77754404-77754426 TCTCCCTACATTACCCAGGCTGG - Intronic
1089283388 11:117390277-117390299 GGTCCCTTCGTAATCCTGGGAGG + Intronic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1096503119 12:52077395-52077417 TGTCTCTCCATAGCCCTGGTGGG + Exonic
1098072426 12:66690113-66690135 TGTCCCTACATTGCCCAGGCTGG + Intronic
1103603278 12:122067912-122067934 GGTTCCCACACAACCCTGGGAGG - Intergenic
1103655184 12:122465072-122465094 TCTCCCTACATTACCCAGGCTGG - Intergenic
1106487294 13:30183131-30183153 TGTCCTCACATAAACCTAGGTGG + Intergenic
1107085967 13:36428503-36428525 TGTCCCTAAATAAACTTGGCGGG + Intergenic
1109072695 13:57788750-57788772 TGTCACTACATTACCCAGGCTGG + Intergenic
1109531146 13:63649922-63649944 CATCCTTACATAACCCTGGTGGG - Intergenic
1110320939 13:74159196-74159218 TGTGCCCATATAACCCTGTGTGG + Intergenic
1110469560 13:75843542-75843564 TGTCCATACATAACCCTTTGGGG - Intronic
1112135337 13:96572179-96572201 TGTCCCAACATATCTCTGTGCGG - Intronic
1114527113 14:23373325-23373347 TGGCCCTACAGGACTCTGGGTGG - Exonic
1116359993 14:43982142-43982164 TGTCCTTTCATAACCCTAGAGGG + Intergenic
1121080702 14:91105816-91105838 TGTGCTTACACAAACCTGGGTGG + Intronic
1122058191 14:99119319-99119341 TGTCCTCACAAAACCCTAGGCGG - Intergenic
1202889719 14_KI270722v1_random:144677-144699 TGTACTTACATAACCCTAGATGG + Intergenic
1123955632 15:25331459-25331481 TGTCTTTGCATAACCCTGGCTGG - Intergenic
1126474081 15:49047517-49047539 TGTCCCTAAGTATCCCAGGGGGG - Intergenic
1127230526 15:56988257-56988279 TGTACTTACATAAACCTAGGGGG + Intronic
1127413736 15:58735414-58735436 TGTCCCTTGGTATCCCTGGGGGG + Intronic
1130712888 15:86301190-86301212 TGTCCCCACATGTCTCTGGGAGG - Intronic
1138304892 16:55965597-55965619 TGTCCCATTATAACCCTTGGAGG - Intergenic
1145185266 17:20788446-20788468 TGACCCTACATAAGGCTGGATGG + Intergenic
1147693192 17:42331078-42331100 AGTCCTTACACAAACCTGGGTGG - Intronic
1161204688 19:3034874-3034896 TGACCCTATGTGACCCTGGGAGG - Intronic
1162814280 19:13183854-13183876 GGTCACTGCATAAGCCTGGGGGG - Intergenic
1163695158 19:18760220-18760242 TGTCCCTGCCTTACCCTGGCCGG - Exonic
1163727164 19:18929324-18929346 GGTCCCAACTTAGCCCTGGGTGG - Exonic
1163873488 19:19845727-19845749 TGTTGCTACATAACCCAGGCTGG - Intergenic
1164093711 19:21985379-21985401 TTTCACTACATAACCCAGGTTGG - Intronic
1164113268 19:22191121-22191143 TCTCACTACATAACCCAGGTTGG - Intronic
1167462819 19:49635364-49635386 TGTCCCCACCTAAGCCTGGTGGG - Exonic
1168375551 19:55876264-55876286 TGTCCCTCCATATCCATAGGAGG + Intronic
1202665118 1_KI270708v1_random:111444-111466 TGTACTTACATAACCCTAGATGG + Intergenic
928540856 2:32282233-32282255 TGTCACTACGTTCCCCTGGGTGG - Intronic
930076371 2:47409005-47409027 TCTCCCTACATTCCCCAGGGTGG - Intronic
930723428 2:54659415-54659437 TATCCCTAAATAACCTTGGAGGG + Intronic
931908395 2:66868064-66868086 TGTCCTTACATACTTCTGGGAGG - Intergenic
932425854 2:71634716-71634738 TCTTCCTCCTTAACCCTGGGAGG + Intronic
934877092 2:97933103-97933125 TGTACCTACACAAACCTAGGTGG - Intronic
935953948 2:108355976-108355998 TGTACTTACATAAACCTGGATGG + Intergenic
943261234 2:185666101-185666123 TGTACTTACATAAACCTAGGTGG + Intergenic
944388659 2:199193582-199193604 TGTACTTACACAACCCTAGGTGG - Intergenic
945278106 2:208008709-208008731 GGTACCCACAAAACCCTGGGAGG - Intronic
946196656 2:218036124-218036146 AATCCCCACATAACCCTGGGAGG - Intronic
946735132 2:222746505-222746527 TGTCCCTGCATAACACAGAGAGG + Intergenic
947443438 2:230143311-230143333 TGGCCTTACATAAACCTAGGAGG + Intergenic
947843637 2:233226280-233226302 TGTCACTTTATAAACCTGGGAGG - Intronic
1171200480 20:23237009-23237031 TTTCCACACATAACCCTTGGTGG - Intergenic
1172410076 20:34714500-34714522 TGTCCCTAGAAAATCCTGGGTGG + Intronic
1174170850 20:48617455-48617477 AGTCCCACGATAACCCTGGGAGG + Intergenic
1174603069 20:51740251-51740273 TCTCCCTACATAGCCCAGGTTGG + Intronic
1174796332 20:53525695-53525717 TGTCCTGACATACCGCTGGGAGG + Intergenic
1177664538 21:24137121-24137143 TGTCTCTACAGAACCTTGGTGGG + Intergenic
1181627564 22:24132030-24132052 TGTCACTCCGTAACCCAGGGTGG - Intronic
1184767480 22:46579134-46579156 TGTTTCCACATAGCCCTGGGAGG + Intronic
953963501 3:47284035-47284057 TCTCCCTACATAGCCCAGGCTGG - Intronic
954636043 3:52071384-52071406 TCTCCCTAGAGAACCCTTGGGGG - Intergenic
958622627 3:96581298-96581320 TGTCACTACAGACCGCTGGGAGG - Intergenic
962984450 3:140521908-140521930 AATCCCTACATACCCCTAGGAGG - Intronic
963047389 3:141112729-141112751 TGTCCCATCATAACCCTAGATGG + Intronic
967547208 3:190745353-190745375 TGTACTTACACAAACCTGGGTGG - Intergenic
967727878 3:192878932-192878954 TGTCCCTCCATAGCCCAGGCTGG - Intronic
968450362 4:673249-673271 TATCCCTGCACAAACCTGGGAGG + Intronic
968808462 4:2789499-2789521 TGCCCCTAGATCACCCTTGGCGG - Intergenic
971428539 4:26539850-26539872 TGTGCTTACATAAACCTGGATGG - Intergenic
971725108 4:30302106-30302128 TATCCTTACATAACCCTGTCAGG + Intergenic
973953655 4:56041564-56041586 TGCCCCAACTTTACCCTGGGAGG + Intergenic
975077658 4:70232498-70232520 TGTCCTTACACAAACCTAGGTGG - Intronic
976313485 4:83635471-83635493 TCTCCCTACATTGCCCAGGGTGG - Intergenic
977606565 4:98990429-98990451 TGTCCTTACACAAACCTAGGTGG + Intergenic
978854333 4:113376200-113376222 TGTCCTTACACAAACCTAGGTGG + Intronic
978907254 4:114021256-114021278 TGTCCTTACATAAACCTAGATGG + Intergenic
982311238 4:153987479-153987501 TGTCCATACATAACAATGAGGGG + Intergenic
982827517 4:160019439-160019461 TGCCCCTACAGAGCACTGGGTGG + Intergenic
990702844 5:58493964-58493986 TGTCCCTGCCCAACCCTGAGTGG - Intronic
991102801 5:62811881-62811903 TCTCCCTATATTACCCAGGGTGG - Intergenic
991384579 5:66071156-66071178 TCTCCCTACATTGCCCTGGCTGG - Intronic
994785006 5:104147734-104147756 TGCCCTTACATAACCCTCGGAGG + Intergenic
996928331 5:128855718-128855740 TGTCCCTCAATATCCCTGCGTGG - Intronic
999917236 5:156276047-156276069 TGTACCTACAGAACCTTGGCTGG - Intronic
1001535193 5:172493134-172493156 TGCCCCTCCACAGCCCTGGGAGG + Intergenic
1001614060 5:173027961-173027983 TGACACTAAATAACACTGGGTGG + Intronic
1003569769 6:7248143-7248165 TGTCCATACAGATCCCTGAGAGG + Intronic
1003728997 6:8799364-8799386 TCTCCCTTAATAACCCAGGGAGG - Intergenic
1006960264 6:37922605-37922627 TGTCCTTACACAAACCTAGGTGG + Intronic
1008067670 6:47067208-47067230 TGTACCTACACAAACCTAGGTGG - Intergenic
1009632883 6:66221848-66221870 TCTCCCCACATAACCCTGGAGGG - Intergenic
1012802023 6:103842728-103842750 TTTCCCTACATCACCCTGACAGG + Intergenic
1013178154 6:107694740-107694762 TGGCCCAAGATGACCCTGGGTGG + Intergenic
1017140762 6:151187942-151187964 TGTACTTACATAAACCTGGTTGG + Intergenic
1019052336 6:169192697-169192719 TGGCTCCACCTAACCCTGGGAGG + Intergenic
1019798751 7:3072273-3072295 TCTCACTACATTACCCTGGCTGG + Intergenic
1020175042 7:5875501-5875523 TGTCACTACATCACCCTGGCTGG + Intergenic
1023015039 7:35958842-35958864 TGTACCTACATAAACCTAGATGG + Intergenic
1024065905 7:45735858-45735880 TGTACCTACATAAACCTAGATGG - Intergenic
1029083728 7:97995116-97995138 TCTCACTACATCACCCTGGCTGG - Intergenic
1031892014 7:127305531-127305553 TGTACCTACACAAACCTAGGTGG - Intergenic
1031930995 7:127685851-127685873 AGTCCCTACACACCCCTGGGAGG - Intronic
1032565607 7:132939543-132939565 TGTACTTACACAACCCTAGGTGG - Intronic
1032867760 7:135944932-135944954 TGTCCTTACATAAACCTAGATGG + Intronic
1033157716 7:138971105-138971127 TGTCCCTCCAGCAGCCTGGGTGG - Intronic
1033647331 7:143315606-143315628 TGGCCAGACAGAACCCTGGGTGG + Intergenic
1037687032 8:21149446-21149468 TGTCCACACATACCACTGGGGGG + Intergenic
1037870606 8:22492064-22492086 TGTACTTACATAAACCTAGGTGG + Intronic
1040457996 8:47619532-47619554 TGACCCTACATGACCCTGAGAGG - Intronic
1042841876 8:73132182-73132204 AGTCCTTACACAACCCTAGGTGG + Intergenic
1043996043 8:86817746-86817768 TGTCCCTACAAATGCCTGAGGGG + Intergenic
1046950133 8:120012301-120012323 TGTACTTACACAAACCTGGGTGG + Intronic
1048562968 8:135562423-135562445 TGTACTTACATAAACCTAGGTGG - Intronic
1050025973 9:1334952-1334974 ATTCCCTACATCACACTGGGGGG + Intergenic
1051127895 9:13824767-13824789 TGTCCCTCCTTCACCCTGGCAGG + Intergenic
1056103386 9:83322452-83322474 TGCTCCTACATACCCCTAGGAGG - Intronic
1056452437 9:86729234-86729256 CCTCCCCACAGAACCCTGGGAGG + Intergenic
1059106398 9:111515455-111515477 TCTCCCTACATTACCCAGGCTGG - Intergenic
1059509957 9:114836027-114836049 TGTGTCTGCATAACCCTGGCTGG + Intergenic
1060630565 9:125154256-125154278 TGTCCTTACATAAACCTAGATGG + Intronic
1186460069 X:9741126-9741148 TCTCCCTACATTGCCCAGGGTGG + Intronic
1186701510 X:12095179-12095201 TCTCACTACATTACCCAGGGTGG - Intergenic
1188595261 X:31892583-31892605 TGTACCTACACAAACCTAGGTGG + Intronic
1188832559 X:34917861-34917883 TAACCCTACACAACCCTGAGAGG - Intergenic
1190035145 X:47015968-47015990 TGTCCCTAAATAACTGTGTGGGG - Intronic
1195979546 X:110562475-110562497 TGTACTTACACAACCCTGGATGG - Intergenic
1197632958 X:128883271-128883293 TGTCCTTACATAAACCTGGATGG - Intergenic