ID: 922712441

View in Genome Browser
Species Human (GRCh38)
Location 1:227844327-227844349
Sequence CCTACCCCCCATGAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922712435_922712441 0 Left 922712435 1:227844304-227844326 CCTGTCTGATCAAGGCTTCCTCC 0: 1
1: 1
2: 0
3: 9
4: 143
Right 922712441 1:227844327-227844349 CCTACCCCCCATGAGTGGTGAGG 0: 1
1: 0
2: 2
3: 6
4: 108
922712434_922712441 1 Left 922712434 1:227844303-227844325 CCCTGTCTGATCAAGGCTTCCTC No data
Right 922712441 1:227844327-227844349 CCTACCCCCCATGAGTGGTGAGG 0: 1
1: 0
2: 2
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922712441 Original CRISPR CCTACCCCCCATGAGTGGTG AGG Intronic
900096843 1:943240-943262 CCTACCGCGCCTGAGTTGTGGGG - Exonic
903474764 1:23612011-23612033 CCCACCCCCTATGAGCTGTGTGG - Intronic
903743820 1:25573591-25573613 CCTGCCCCCCAACAGTGTTGGGG - Intergenic
904408674 1:30311764-30311786 CCTTCTCCCCAGCAGTGGTGGGG - Intergenic
910002670 1:82357945-82357967 CCTTGCCCCCATAACTGGTGTGG - Intergenic
910512582 1:88023278-88023300 CAGACCCCCCATGAATGGTTTGG - Intergenic
915459491 1:156061274-156061296 CTTACCCCCAATGAGAGGAGGGG + Exonic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
921391419 1:214618206-214618228 CATAATCCCCATGTGTGGTGGGG - Intronic
922712441 1:227844327-227844349 CCTACCCCCCATGAGTGGTGAGG + Intronic
1064399322 10:15008009-15008031 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1066691212 10:38030531-38030553 CCTACCCCCAATGTTTGGTTTGG + Intronic
1067720867 10:48726919-48726941 GCTACCCCACCAGAGTGGTGCGG - Intronic
1070413925 10:76171485-76171507 CCTACCTCCTGTGAGTGGTTAGG + Intronic
1070964751 10:80523087-80523109 CCTCCCCCTGATGGGTGGTGTGG + Exonic
1075239633 10:120766167-120766189 CCAATCCCCCATGAGTATTGGGG + Intergenic
1076798964 10:132811912-132811934 TGTGCCCCCCATGAGGGGTGTGG - Intronic
1077604543 11:3599790-3599812 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1081914165 11:46720157-46720179 CCCACCCCTCAAGGGTGGTGTGG - Intronic
1084260431 11:67974381-67974403 ACAACCCCCCAGGAATGGTGTGG - Intergenic
1084524404 11:69686769-69686791 CCTTCTCCCCATGAGTTGTGTGG - Intergenic
1084808198 11:71594251-71594273 ACCACCCCCCAGGAATGGTGTGG + Intronic
1084812339 11:71620864-71620886 ACCACCCCCCAGGAATGGTGTGG + Intergenic
1085780312 11:79402131-79402153 CCTAACCCCCATGGTTGGCGAGG - Intronic
1089422288 11:118340886-118340908 CCTACTCCTCATCAGTGGTCTGG - Intronic
1089564300 11:119363069-119363091 CCTACCTCACCTGTGTGGTGAGG + Intronic
1090408572 11:126492310-126492332 CCTACCCCCGATGAGGGATGAGG + Intronic
1090863726 11:130676702-130676724 CCAACCCCACATGAGGGGTCAGG - Intronic
1091323547 11:134667986-134668008 CTTTCCCCCCATGAATGCTGGGG + Intergenic
1091977482 12:4837068-4837090 CCTGCCCCCCACAAGGGGTGAGG + Intronic
1092431695 12:8414926-8414948 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1092434646 12:8437549-8437571 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1104625631 12:130351885-130351907 CCTTCCCCCCAGAAGTGATGTGG + Intronic
1105644432 13:22302499-22302521 GCTACCCCCCATGACACGTGGGG + Intergenic
1107546688 13:41439983-41440005 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1109839422 13:67903050-67903072 ACCACCCCCCAGGAGTGGTGTGG + Intergenic
1110256646 13:73440610-73440632 CCTAACTCCCAGGAGTGATGGGG - Intergenic
1113817722 13:113186223-113186245 CCTGCCCCACATGAGGGATGAGG + Intronic
1116962292 14:50978610-50978632 CCAAGGGCCCATGAGTGGTGTGG - Intronic
1133076737 16:3285790-3285812 CCTTCCTCCCCTGAGTGTTGGGG + Intronic
1133252814 16:4495276-4495298 CCTACACCCAAAGAGTGGTAAGG - Intronic
1133764670 16:8829611-8829633 CCTTCCCACCTTGAGTGGAGTGG - Intronic
1135284412 16:21181096-21181118 CCTAGCCACCATGATTGGTCTGG - Intergenic
1139101883 16:63777609-63777631 CCCACACCCCATGACTGGTGGGG - Intergenic
1158406965 18:57168366-57168388 GCTACCCCAGCTGAGTGGTGAGG + Intergenic
1160685751 19:435951-435973 CCTGCCCCCCAGGATTGGGGAGG - Intronic
1165275631 19:34748627-34748649 CCTGCTCCCCCTGGGTGGTGTGG + Intergenic
925257969 2:2506244-2506266 CCTGCCCTACCTGAGTGGTGTGG - Intergenic
925916656 2:8611719-8611741 CCTTCCCTCAATGAGTGGTCGGG + Intergenic
933950660 2:87326673-87326695 CCTACCCCCCATTAGTGCTGTGG + Intergenic
934590677 2:95547381-95547403 ACCACCCCCCAGGAATGGTGTGG + Intergenic
936329118 2:111531906-111531928 CCTACCCCCCATTAGTGCTGTGG - Intergenic
937314077 2:120919984-120920006 CCTTCCCTCCATCAGTGCTGGGG + Intronic
940870303 2:158854405-158854427 ACCACCCCCCAGGAATGGTGTGG + Intronic
940873010 2:158875499-158875521 ACCACCCCCCAGGAATGGTGTGG + Intergenic
1171956156 20:31465410-31465432 CCTATCCCCCACCCGTGGTGGGG + Intergenic
1172409723 20:34711986-34712008 CATACCCCCCATGAGGCCTGGGG - Exonic
1176131306 20:63497940-63497962 CCAAGCCCCCATGTTTGGTGGGG + Intronic
1176317315 21:5258427-5258449 CATATCCCTCATGACTGGTGAGG + Intergenic
1178327679 21:31659006-31659028 TCTACCCTCCTTGAGTGTTGTGG + Intergenic
1184090976 22:42292929-42292951 CCTGCCCACCAGGAGTGGCGGGG + Intronic
1184314879 22:43678513-43678535 CCTACCCCACCTGAGAGCTGGGG + Intronic
949885379 3:8688986-8689008 ACCACCCCCCAGGAATGGTGTGG + Intronic
953044605 3:39283268-39283290 CCTACCACACATGAGCTGTGTGG - Intergenic
954387177 3:50250145-50250167 CCTACCTCCCAGGATTGCTGTGG + Intronic
957075390 3:75598797-75598819 ACCACCCCCCAGGAATGGTGTGG - Intergenic
959431133 3:106256485-106256507 CCCAACCCCCAGGAGTGGAGAGG - Intergenic
961417887 3:126774617-126774639 ACTACCACCCAAGCGTGGTGAGG - Intronic
961875686 3:130021702-130021724 ACCACCCCCCAGGAATGGTGTGG - Intergenic
963517189 3:146323358-146323380 CATAATCCCCATGAGTTGTGGGG + Intergenic
968275854 3:197439786-197439808 GCTACCCCCTCTTAGTGGTGGGG - Intergenic
968613622 4:1567804-1567826 CCTTCCACCCATGTGTGGAGGGG - Intergenic
968988042 4:3889449-3889471 ACCACCCCCCAGGAATGGTGTGG - Intergenic
969019039 4:4126752-4126774 ACCACCCCCCAGGAATGGTGTGG - Intergenic
969308861 4:6340570-6340592 CCTGCCCCCCATGGCAGGTGGGG - Intronic
969413835 4:7046159-7046181 CCCACCCCCCCGGAGTGGTGAGG + Intronic
969499066 4:7542140-7542162 CCCTCCGCCCATGAGGGGTGAGG - Intronic
969786307 4:9460076-9460098 ACCACCCCCCAGGAATGGTGTGG + Intergenic
969794223 4:9513725-9513747 ACCACCCCCCAGGAATGGTGTGG + Intergenic
970148781 4:13067380-13067402 CCTACCCCCGATTGATGGTGAGG - Intergenic
970422083 4:15914829-15914851 CTTGCCCACCCTGAGTGGTGTGG - Intergenic
979870353 4:125812096-125812118 CCTAAAGCCCATGATTGGTGAGG + Intergenic
982399808 4:154954132-154954154 CCCAACCCCCAAGAGTGATGAGG + Intergenic
985886590 5:2684830-2684852 CCCCACCCCCATGAGTGTTGGGG - Intergenic
986504073 5:8430543-8430565 CCGGCCACCCATGAGTGCTGGGG - Intergenic
999853980 5:155573311-155573333 TCTAGCCACCATGATTGGTGTGG - Intergenic
1006380734 6:33695644-33695666 CCTTCCCTCCATGGGTGCTGTGG - Intronic
1007530213 6:42535495-42535517 CCTACCTCACAGGATTGGTGTGG - Intergenic
1016458479 6:144257178-144257200 CCTACCCAGCCTGAGAGGTGTGG - Intergenic
1018731678 6:166656441-166656463 CCTGCCCTGCCTGAGTGGTGTGG + Intronic
1019410444 7:904448-904470 CCTCCCTCCCAGGAGTGATGGGG + Intronic
1020310781 7:6866801-6866823 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1025790187 7:64681296-64681318 CCTAGCCTCCATGACTGTTGTGG + Intronic
1028994539 7:97085752-97085774 CCTAGCCCCACTGAGTGGTATGG - Intergenic
1033935338 7:146576901-146576923 CCTAACTCCTAAGAGTGGTGAGG + Intronic
1035058152 7:156050610-156050632 CCTCTCCCCCATGGATGGTGGGG + Intergenic
1035422569 7:158741723-158741745 ACTGCCCCCAATGACTGGTGTGG + Exonic
1036261751 8:7246764-7246786 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1036304842 8:7592788-7592810 ACCACCCCCCAGGAATGGTGTGG + Intergenic
1036313791 8:7705309-7705331 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1036355693 8:8040780-8040802 ACCACCCCCCAGGAATGGTGTGG + Intergenic
1036819482 8:11928714-11928736 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1036832652 8:12033763-12033785 ACCACCCCCCAGGAGTGGTGTGG - Intergenic
1036902819 8:12684286-12684308 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1046360407 8:113146270-113146292 CCTACCCCCCATGAAGCATGTGG - Intronic
1056916520 9:90751370-90751392 ACCACCCCCCAGGAATGGTGTGG - Intergenic
1057821519 9:98334920-98334942 CCGAGCCACCATGAGTGCTGAGG + Intronic
1058979910 9:110159732-110159754 CCGAGCCCCCATCAGGGGTGTGG + Intronic
1060413197 9:123413495-123413517 CCTGCCCTCCAGGAGTAGTGGGG - Intronic
1061240530 9:129368607-129368629 CCTAACCCCCATGGGAAGTGTGG - Intergenic
1203415579 Un_KI270582v1:3475-3497 CATATCCCTCATGACTGGTGAGG + Intergenic
1188182765 X:27075726-27075748 GCTCCCTCCCATGAGGGGTGGGG + Intergenic
1190431276 X:50379854-50379876 CCTTCCTCCCATGAGCTGTGAGG + Intronic
1191056065 X:56242493-56242515 CCTAACAGCCATGAGTGGGGAGG + Intronic
1192808552 X:74530576-74530598 CCTTCCCCCAATGGGTAGTGTGG - Intronic
1197296576 X:124726457-124726479 CCTACACCACATGATGGGTGTGG - Intronic
1198939237 X:141934814-141934836 CCTGACCCCCAGGAGTGATGTGG - Intergenic