ID: 922716223

View in Genome Browser
Species Human (GRCh38)
Location 1:227874131-227874153
Sequence CCTCTTCAGAAGCTCTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922716223_922716225 -8 Left 922716223 1:227874131-227874153 CCTTGCAAGAGCTTCTGAAGAGG No data
Right 922716225 1:227874146-227874168 TGAAGAGGCACAAATATGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922716223 Original CRISPR CCTCTTCAGAAGCTCTTGCA AGG (reversed) Intergenic
No off target data available for this crispr