ID: 922717569

View in Genome Browser
Species Human (GRCh38)
Location 1:227885274-227885296
Sequence ACCTGGGCCCCTGAACTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922717569_922717575 -5 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717569_922717576 -2 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data
922717569_922717578 18 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717578 1:227885315-227885337 AGGGTGCAGCTGCTGTGAGCAGG No data
922717569_922717572 -8 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717572 1:227885289-227885311 GCCCAGGTGCAGCAGAGGGCAGG No data
922717569_922717580 23 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717580 1:227885320-227885342 GCAGCTGCTGTGAGCAGGGCAGG No data
922717569_922717579 19 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717579 1:227885316-227885338 GGGTGCAGCTGCTGTGAGCAGGG No data
922717569_922717577 -1 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717577 1:227885296-227885318 TGCAGCAGAGGGCAGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922717569 Original CRISPR ACCTGGGCCCCTGAACTTCC AGG (reversed) Intergenic
No off target data available for this crispr