ID: 922717575

View in Genome Browser
Species Human (GRCh38)
Location 1:227885292-227885314
Sequence CAGGTGCAGCAGAGGGCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922717567_922717575 -4 Left 922717567 1:227885273-227885295 CCCTGGAAGTTCAGGGGCCCAGG No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717559_922717575 23 Left 922717559 1:227885246-227885268 CCTGTGGGGCGCTGCCTGTTCCC No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717569_922717575 -5 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717565_922717575 2 Left 922717565 1:227885267-227885289 CCTGTGCCCTGGAAGTTCAGGGG No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717563_922717575 3 Left 922717563 1:227885266-227885288 CCCTGTGCCCTGGAAGTTCAGGG No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717557_922717575 30 Left 922717557 1:227885239-227885261 CCAGCCTCCTGTGGGGCGCTGCC No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717561_922717575 9 Left 922717561 1:227885260-227885282 CCTGTTCCCTGTGCCCTGGAAGT No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data
922717558_922717575 26 Left 922717558 1:227885243-227885265 CCTCCTGTGGGGCGCTGCCTGTT No data
Right 922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922717575 Original CRISPR CAGGTGCAGCAGAGGGCAGG CGG Intergenic
No off target data available for this crispr