ID: 922717576

View in Genome Browser
Species Human (GRCh38)
Location 1:227885295-227885317
Sequence GTGCAGCAGAGGGCAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922717569_922717576 -2 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data
922717563_922717576 6 Left 922717563 1:227885266-227885288 CCCTGTGCCCTGGAAGTTCAGGG No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data
922717561_922717576 12 Left 922717561 1:227885260-227885282 CCTGTTCCCTGTGCCCTGGAAGT No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data
922717559_922717576 26 Left 922717559 1:227885246-227885268 CCTGTGGGGCGCTGCCTGTTCCC No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data
922717567_922717576 -1 Left 922717567 1:227885273-227885295 CCCTGGAAGTTCAGGGGCCCAGG No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data
922717558_922717576 29 Left 922717558 1:227885243-227885265 CCTCCTGTGGGGCGCTGCCTGTT No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data
922717565_922717576 5 Left 922717565 1:227885267-227885289 CCTGTGCCCTGGAAGTTCAGGGG No data
Right 922717576 1:227885295-227885317 GTGCAGCAGAGGGCAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922717576 Original CRISPR GTGCAGCAGAGGGCAGGCGG AGG Intergenic
No off target data available for this crispr