ID: 922717578

View in Genome Browser
Species Human (GRCh38)
Location 1:227885315-227885337
Sequence AGGGTGCAGCTGCTGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922717574_922717578 1 Left 922717574 1:227885291-227885313 CCAGGTGCAGCAGAGGGCAGGCG No data
Right 922717578 1:227885315-227885337 AGGGTGCAGCTGCTGTGAGCAGG No data
922717573_922717578 2 Left 922717573 1:227885290-227885312 CCCAGGTGCAGCAGAGGGCAGGC No data
Right 922717578 1:227885315-227885337 AGGGTGCAGCTGCTGTGAGCAGG No data
922717565_922717578 25 Left 922717565 1:227885267-227885289 CCTGTGCCCTGGAAGTTCAGGGG No data
Right 922717578 1:227885315-227885337 AGGGTGCAGCTGCTGTGAGCAGG No data
922717563_922717578 26 Left 922717563 1:227885266-227885288 CCCTGTGCCCTGGAAGTTCAGGG No data
Right 922717578 1:227885315-227885337 AGGGTGCAGCTGCTGTGAGCAGG No data
922717567_922717578 19 Left 922717567 1:227885273-227885295 CCCTGGAAGTTCAGGGGCCCAGG No data
Right 922717578 1:227885315-227885337 AGGGTGCAGCTGCTGTGAGCAGG No data
922717569_922717578 18 Left 922717569 1:227885274-227885296 CCTGGAAGTTCAGGGGCCCAGGT No data
Right 922717578 1:227885315-227885337 AGGGTGCAGCTGCTGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922717578 Original CRISPR AGGGTGCAGCTGCTGTGAGC AGG Intergenic
No off target data available for this crispr