ID: 922717752

View in Genome Browser
Species Human (GRCh38)
Location 1:227886084-227886106
Sequence CAGGAAGAGCAAAATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922717743_922717752 11 Left 922717743 1:227886050-227886072 CCCCGGGGTGTGGGCAGTCACTC No data
Right 922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG No data
922717745_922717752 9 Left 922717745 1:227886052-227886074 CCGGGGTGTGGGCAGTCACTCCT No data
Right 922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG No data
922717744_922717752 10 Left 922717744 1:227886051-227886073 CCCGGGGTGTGGGCAGTCACTCC No data
Right 922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922717752 Original CRISPR CAGGAAGAGCAAAATGGGGT GGG Intergenic
No off target data available for this crispr