ID: 922719901

View in Genome Browser
Species Human (GRCh38)
Location 1:227895014-227895036
Sequence CTGGTGACTCAGGGTTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922719893_922719901 1 Left 922719893 1:227894990-227895012 CCGTGCCCCTAGACGCTGGGTAG No data
Right 922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG No data
922719890_922719901 17 Left 922719890 1:227894974-227894996 CCAGGCTGCTGCAGGACCGTGCC No data
Right 922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG No data
922719897_922719901 -5 Left 922719897 1:227894996-227895018 CCCTAGACGCTGGGTAGGCTGGT No data
Right 922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG No data
922719898_922719901 -6 Left 922719898 1:227894997-227895019 CCTAGACGCTGGGTAGGCTGGTG No data
Right 922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG No data
922719895_922719901 -4 Left 922719895 1:227894995-227895017 CCCCTAGACGCTGGGTAGGCTGG No data
Right 922719901 1:227895014-227895036 CTGGTGACTCAGGGTTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922719901 Original CRISPR CTGGTGACTCAGGGTTAGCA TGG Intergenic
No off target data available for this crispr