ID: 922722259

View in Genome Browser
Species Human (GRCh38)
Location 1:227905045-227905067
Sequence CCTTCTGTCCAGGGGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922722259_922722268 9 Left 922722259 1:227905045-227905067 CCCAGCAGCCCCTGGACAGAAGG No data
Right 922722268 1:227905077-227905099 ACTGTCTTCTTTCGTTCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922722259 Original CRISPR CCTTCTGTCCAGGGGCTGCT GGG (reversed) Intergenic
No off target data available for this crispr