ID: 922722515

View in Genome Browser
Species Human (GRCh38)
Location 1:227906082-227906104
Sequence GTTCTAGCACTGGGAGTTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922722515_922722527 25 Left 922722515 1:227906082-227906104 CCGCCAACTCCCAGTGCTAGAAC No data
Right 922722527 1:227906130-227906152 GCCAAGCCTCCCACTGCAGTGGG No data
922722515_922722526 24 Left 922722515 1:227906082-227906104 CCGCCAACTCCCAGTGCTAGAAC No data
Right 922722526 1:227906129-227906151 TGCCAAGCCTCCCACTGCAGTGG No data
922722515_922722521 -1 Left 922722515 1:227906082-227906104 CCGCCAACTCCCAGTGCTAGAAC No data
Right 922722521 1:227906104-227906126 CTCCAAGTCCTGCCTGGGCATGG No data
922722515_922722519 -7 Left 922722515 1:227906082-227906104 CCGCCAACTCCCAGTGCTAGAAC No data
Right 922722519 1:227906098-227906120 CTAGAACTCCAAGTCCTGCCTGG No data
922722515_922722520 -6 Left 922722515 1:227906082-227906104 CCGCCAACTCCCAGTGCTAGAAC No data
Right 922722520 1:227906099-227906121 TAGAACTCCAAGTCCTGCCTGGG No data
922722515_922722522 0 Left 922722515 1:227906082-227906104 CCGCCAACTCCCAGTGCTAGAAC No data
Right 922722522 1:227906105-227906127 TCCAAGTCCTGCCTGGGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922722515 Original CRISPR GTTCTAGCACTGGGAGTTGG CGG (reversed) Intergenic
No off target data available for this crispr