ID: 922723722

View in Genome Browser
Species Human (GRCh38)
Location 1:227912606-227912628
Sequence GAAAGAAACAGAAATAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922723722_922723727 27 Left 922723722 1:227912606-227912628 CCTGGATTATTTCTGTTTCTTTC No data
Right 922723727 1:227912656-227912678 GAGCACTCACATTGATTCTGTGG No data
922723722_922723724 5 Left 922723722 1:227912606-227912628 CCTGGATTATTTCTGTTTCTTTC No data
Right 922723724 1:227912634-227912656 CATTTTTTGGTCTGTCTCCCTGG No data
922723722_922723723 -8 Left 922723722 1:227912606-227912628 CCTGGATTATTTCTGTTTCTTTC No data
Right 922723723 1:227912621-227912643 TTTCTTTCAGCATCATTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922723722 Original CRISPR GAAAGAAACAGAAATAATCC AGG (reversed) Intergenic