ID: 922723727

View in Genome Browser
Species Human (GRCh38)
Location 1:227912656-227912678
Sequence GAGCACTCACATTGATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922723722_922723727 27 Left 922723722 1:227912606-227912628 CCTGGATTATTTCTGTTTCTTTC No data
Right 922723727 1:227912656-227912678 GAGCACTCACATTGATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922723727 Original CRISPR GAGCACTCACATTGATTCTG TGG Intergenic