ID: 922724689

View in Genome Browser
Species Human (GRCh38)
Location 1:227917418-227917440
Sequence TGGCCACAGCTCCTACTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922724689_922724693 -9 Left 922724689 1:227917418-227917440 CCTCTTAGTAGGAGCTGTGGCCA 0: 1
1: 0
2: 2
3: 16
4: 137
Right 922724693 1:227917432-227917454 CTGTGGCCATGGGTCTGGAAAGG 0: 1
1: 0
2: 5
3: 29
4: 276
922724689_922724695 -1 Left 922724689 1:227917418-227917440 CCTCTTAGTAGGAGCTGTGGCCA 0: 1
1: 0
2: 2
3: 16
4: 137
Right 922724695 1:227917440-227917462 ATGGGTCTGGAAAGGAAGCCTGG 0: 1
1: 0
2: 3
3: 42
4: 391
922724689_922724696 14 Left 922724689 1:227917418-227917440 CCTCTTAGTAGGAGCTGTGGCCA 0: 1
1: 0
2: 2
3: 16
4: 137
Right 922724696 1:227917455-227917477 AAGCCTGGACTGTTCCCATCAGG 0: 1
1: 0
2: 0
3: 15
4: 141
922724689_922724697 15 Left 922724689 1:227917418-227917440 CCTCTTAGTAGGAGCTGTGGCCA 0: 1
1: 0
2: 2
3: 16
4: 137
Right 922724697 1:227917456-227917478 AGCCTGGACTGTTCCCATCAGGG 0: 1
1: 0
2: 0
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922724689 Original CRISPR TGGCCACAGCTCCTACTAAG AGG (reversed) Intergenic
900084850 1:887153-887175 GGGCCACAGCTGCTTCTAATCGG + Intergenic
902717008 1:18279911-18279933 TGTGCACAGCGCCTGCTAAGTGG + Intronic
903184881 1:21623162-21623184 TGGCCACAGCACCTAGGGAGGGG + Intronic
906103578 1:43278461-43278483 GGGCAACAGCTCCTCATAAGAGG - Intergenic
906803795 1:48760227-48760249 TAGCTACAGCTTCTACTGAGGGG + Intronic
907498627 1:54861976-54861998 TGGCTACAGTTGCTACTAATGGG - Intronic
908729380 1:67209867-67209889 TAGACAAAGCTCCGACTAAGAGG + Intronic
908985350 1:70011146-70011168 TGTCCATAGCACCTGCTAAGAGG + Intronic
909524605 1:76608546-76608568 TGACAACAGCTCCTTCTGAGAGG - Intronic
912512436 1:110198425-110198447 TGGTCACAGCTCCGACTCAGGGG - Exonic
919367647 1:196684637-196684659 TGGCCACAGTTACTTCAAAGAGG + Intronic
919750758 1:201036607-201036629 TGGACACAGCTCCTGCTTTGTGG + Intergenic
922724689 1:227917418-227917440 TGGCCACAGCTCCTACTAAGAGG - Intergenic
1062761661 10:27466-27488 AGGCCACAGCTGCTTCTAATAGG - Intergenic
1065256445 10:23874176-23874198 AGCCCACAGCTCCTACTAATCGG + Intronic
1065390732 10:25177914-25177936 TGGGCTCAGCTCTTACTAATAGG - Intronic
1068045826 10:51884881-51884903 TTGCCACTTCTCCTACGAAGAGG - Intronic
1072342834 10:94471650-94471672 TGGACAAAGATCTTACTAAGAGG - Intronic
1076918775 10:133440752-133440774 TGTCCCCTGCTCCTCCTAAGAGG - Intergenic
1078149421 11:8746102-8746124 AGGCCACAGGGCCTCCTAAGGGG + Intronic
1079538017 11:21539125-21539147 TTGTCACAAGTCCTACTAAGGGG - Intronic
1081008680 11:37780959-37780981 TGACCACAGCTACTTCTAATTGG - Intergenic
1081909634 11:46692580-46692602 TGGCCACAGCACTTTGTAAGTGG + Intronic
1082746643 11:56969485-56969507 AGACCACAGCTCCTTCTAATTGG + Intergenic
1083302317 11:61745524-61745546 TGGCCCCACCTCCTACCAACAGG - Exonic
1083665465 11:64271756-64271778 TCGCCACAGCTCCTACCCCGCGG - Exonic
1084590001 11:70085028-70085050 TAGTCGCGGCTCCTACTAAGGGG + Intronic
1084595413 11:70113867-70113889 TGGCCCCAGCTCCTCCAAAGGGG - Intronic
1084598816 11:70132898-70132920 TGGCCCCATCTCCTACAAGGTGG - Intronic
1085880674 11:80463480-80463502 TGGACAGAGCTCCCAGTAAGAGG + Intergenic
1091996898 12:5000864-5000886 CGGCCACAGCCCCTGCTGAGGGG - Intergenic
1092191005 12:6520830-6520852 TTGTTACAGCACCTACTAAGGGG - Intronic
1095501704 12:42846866-42846888 AGGCCACAGGTCCTACTAACTGG - Intergenic
1095515874 12:43004778-43004800 TAGCCAAAAATCCTACTAAGTGG - Intergenic
1095803778 12:46296300-46296322 TGGCTACAGCTCCTTCTCTGGGG + Intergenic
1097147956 12:56954582-56954604 TGGCTTCAGATCCTACCAAGAGG - Intronic
1102732569 12:115125885-115125907 TAGCCACAGCTCCTGCTGGGTGG + Intergenic
1104137599 12:125955209-125955231 TGTCCACAGCTCCTTCTGATTGG - Intergenic
1104344101 12:127980361-127980383 AGGCCACGGCTGCGACTAAGTGG + Intergenic
1107122586 13:36811816-36811838 AGGCTACAGCTCCTGCTGAGGGG - Intergenic
1108437979 13:50420218-50420240 AGGCAACAGCTTCTACTTAGAGG - Intronic
1110695889 13:78488078-78488100 TGGCCACAGCCCCTACTCAAGGG - Intergenic
1113671501 13:112178728-112178750 TGGCCACAGCCTCTCCTCAGTGG - Intergenic
1116584368 14:46683963-46683985 GGGCCACGGCTGCAACTAAGTGG + Intergenic
1119725137 14:76917817-76917839 TGGCCACAGCTCATCCCATGAGG + Intergenic
1120834043 14:89024876-89024898 TGGCCAGAGCGCCTACTTCGTGG + Intergenic
1121986507 14:98511980-98512002 TGGCCAAAGCGCATTCTAAGAGG - Intergenic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127692871 15:61414954-61414976 TGGCCACAGCTCCAACACTGTGG + Intergenic
1131108452 15:89750079-89750101 TGGCCTCAGCACCTTCGAAGTGG - Exonic
1138344587 16:56312101-56312123 TGGCCCCACCTCCTACTCACGGG + Intronic
1139701406 16:68710201-68710223 TGGCCACAGCTCCTGTCATGTGG + Intronic
1148652440 17:49259882-49259904 TGGCTGCAGCTTCTGCTAAGGGG - Intergenic
1148813955 17:50313291-50313313 CGGCCACAGCTCCTGCCCAGAGG - Intergenic
1150618586 17:66791301-66791323 TGGCCAGAGCTTTTACCAAGCGG - Intronic
1152037424 17:77881745-77881767 TGGCCGCAGCTGCTGCTGAGCGG - Intergenic
1152716303 17:81902367-81902389 GGGGCACAGCTCCTACTCGGTGG + Exonic
1152954568 18:27796-27818 AGGCCACAGCTGCTTCTAATAGG - Intergenic
1153000688 18:452831-452853 TGGCCACAGGTGCTTCCAAGTGG + Intronic
1153209875 18:2749493-2749515 TGGCCACATTTCCTAATAACTGG - Intronic
1153950476 18:10054052-10054074 TGGCCCCAGCTCCTCCTAGTAGG - Intergenic
1155274034 18:24168983-24169005 TGGCGGCAGCTCCTGCTAATAGG - Intronic
1156611012 18:38723871-38723893 CGGCCACTGCTCCTACCAGGTGG + Intergenic
1157096796 18:44692987-44693009 AGGACAAAGCTCCTACTCAGTGG - Intronic
1157870488 18:51225932-51225954 AGGCCACAGCTCCTATTAGAAGG + Intergenic
1166281579 19:41797713-41797735 TGGCTACAGCTGGTACAAAGGGG + Exonic
1166284348 19:41814586-41814608 CGGCCACAGCTCCTAACAAGTGG + Intergenic
1166406775 19:42527254-42527276 TGGCTACAGCTGGTACAAAGGGG - Exonic
1166420383 19:42631951-42631973 TGGCCACAACTGGTACAAAGGGG - Intronic
927862053 2:26566187-26566209 TGCCCACAGCTCCTGCCCAGCGG + Intronic
928312306 2:30221072-30221094 TGGCCACAGCTGCTACTCAGTGG + Intergenic
929238906 2:39633501-39633523 TGGCTTCAGCTCCTTCTCAGTGG - Intergenic
932972091 2:76556242-76556264 CTGGCACAGCTCCTACTAAAAGG + Intergenic
935373900 2:102376154-102376176 TGGTCACAACCCCAACTAAGTGG - Intronic
936384709 2:112018963-112018985 TGGAAACAGCTCATCCTAAGTGG + Intronic
936491185 2:112973490-112973512 AGGTCACAGCTCCTATTAGGTGG + Intronic
938512615 2:131966565-131966587 TGGCCAAAGACCCCACTAAGAGG - Intergenic
942943347 2:181645615-181645637 AGGCCACAGCTCCTGCCTAGTGG + Intronic
943012297 2:182464467-182464489 TGGCCAAAACTCCTACTGAGAGG - Intronic
944536342 2:200713931-200713953 TGTCCTCAGCTCCCACTAAGAGG + Intergenic
947610565 2:231522630-231522652 TGGGGACAGCTCCTAAGAAGTGG - Intergenic
1169049213 20:2562045-2562067 TGTCCACAGCTCCTTCTGATGGG + Intronic
1170803190 20:19607316-19607338 TGGCCACACCTCCTTCAAAAGGG + Intronic
1171774649 20:29354375-29354397 GGGCCACAGCTGCTTCTAATCGG - Intergenic
1171901687 20:30863985-30864007 AGGCCACAGCTGCTTCTAATCGG + Intergenic
1173027714 20:39325007-39325029 TGGCTATAGAGCCTACTAAGGGG - Intergenic
1173320563 20:41983608-41983630 AGGCCACAGCTCCTACCACTTGG - Intergenic
1173894687 20:46541834-46541856 CGTCCACAGCTCCTACCAATGGG - Exonic
1177051222 21:16237348-16237370 TGGCCACAGCTAACTCTAAGTGG + Intergenic
1180200199 21:46219558-46219580 TGGCCACAGCACCACCTGAGCGG + Exonic
1180335062 22:11569933-11569955 AGGCCACAGCTGCTTCTAATCGG + Intergenic
1180594113 22:16962527-16962549 TGGCAACTGCTCCTAGCAAGGGG + Exonic
1181168763 22:20996825-20996847 TGGCTGCAGCTCCCACTGAGTGG + Intronic
951429521 3:22590014-22590036 TGACCCCATCTCCTACTTAGAGG + Intergenic
951573044 3:24085365-24085387 TGGCCACACCTCCAGCTATGTGG - Intergenic
952182006 3:30926792-30926814 TGGTTACAGCTCCTACCAGGGGG + Intergenic
956897041 3:73672893-73672915 TGCCCACACCTCTTTCTAAGGGG - Intergenic
956937357 3:74118297-74118319 TGGCCAAGGCTCCTACTCAAGGG - Intergenic
958177018 3:90008822-90008844 TGGACACAGTTTCTAATAAGAGG - Intergenic
961437134 3:126927133-126927155 TGGCCACAGCTGCTGCTTAGAGG - Intronic
961613577 3:128160877-128160899 TGGCCACAGATAAAACTAAGTGG + Intronic
967932816 3:194702738-194702760 GGGCCACAGCTCCCATTATGTGG + Intergenic
968359154 3:198134343-198134365 AGGCCACAGCTGCTTCTAATAGG + Intergenic
968419689 4:473665-473687 GGACCACAGCTCCTCCTACGCGG + Intronic
969709991 4:8837250-8837272 TGGCCTCCGCTCCTGCTATGGGG + Intergenic
969986544 4:11217435-11217457 TGGCTATAGCTCCTCCCAAGAGG - Intergenic
972770014 4:42189110-42189132 TTGCCACAACTCCTAATAAAGGG + Intergenic
974354794 4:60797884-60797906 AGGCCTCAGCTCCTATAAAGAGG - Intergenic
976045336 4:80940175-80940197 TGGCCATATATCCTACTAAGTGG - Intronic
977464226 4:97363030-97363052 TGGCCATGGCTGCTACTAATTGG + Intronic
979583850 4:122391494-122391516 TGGCCACCCCTCCCACTTAGGGG + Intronic
980395983 4:132216267-132216289 TGGCTACACCTACTACTGAGTGG + Intergenic
983036298 4:162870616-162870638 TGATCACAGCACCTACTAAATGG + Intergenic
984618914 4:181929656-181929678 TGAACTCAGCTCCTACCAAGTGG + Intergenic
985074515 4:186200257-186200279 TGACCAAACCTGCTACTAAGTGG - Intronic
989469660 5:41800543-41800565 AGGCCACAGTTCCTACTAAGTGG + Intronic
990507416 5:56458324-56458346 TTGGCAGAGCTCCTACTAACAGG + Intronic
990544663 5:56810877-56810899 TGGCCAAAGCTGCTATAAAGAGG - Intergenic
992172199 5:74114462-74114484 TTGCCACAGCCCCTCCTCAGTGG + Intergenic
997230296 5:132237729-132237751 TGGCCATAGCCTCTAGTAAGAGG + Intronic
1002079577 5:176729299-176729321 TTTCCAGAGCTCCTACTTAGGGG - Intergenic
1003145135 6:3504156-3504178 TGCCCACCGCTGCTACCAAGGGG - Intergenic
1005620313 6:27614111-27614133 TGGGCACAGCTCCTAGTGGGTGG + Intergenic
1007522293 6:42460238-42460260 AGGCCACAGCTCCTTTTAGGTGG - Intergenic
1019471968 7:1225778-1225800 TAGCCACAGATCCTACAAACAGG + Intergenic
1020688073 7:11320135-11320157 AGGCCACAGCTCCTGCTAGGAGG + Intergenic
1021313418 7:19118050-19118072 TGGCAACAGCTTCTACACAGTGG + Intergenic
1021456242 7:20832176-20832198 AGGCCACAGCTCCTGCTGTGAGG + Intergenic
1021657966 7:22890543-22890565 GGGCCACAGTTGCCACTAAGTGG - Intergenic
1031077951 7:117230964-117230986 TGGCCACATCTCCTTCTCAGGGG + Intergenic
1031953395 7:127915687-127915709 TGGCCACAGCTTATTCTAAGTGG + Intronic
1032438474 7:131921843-131921865 TGGCCATAGCTACTTCAAAGAGG + Intergenic
1033979194 7:147142647-147142669 TGGCACCAGCTCCTCCTAATGGG + Intronic
1034742503 7:153490665-153490687 TGTCCGCATCTCCTAGTAAGGGG - Intergenic
1037903041 8:22699053-22699075 TGGCCATTGCACCTACTGAGAGG - Intergenic
1039626830 8:39062706-39062728 TGGCCATAGCTCCTACTATAAGG + Intronic
1043264908 8:78253685-78253707 TGGCAACAGCTAGTGCTAAGAGG + Intergenic
1045250978 8:100483323-100483345 TGGCCACAGCCCCTAGAGAGGGG + Intergenic
1046097849 8:109581281-109581303 TTGCCTAAGTTCCTACTAAGTGG - Intronic
1046625935 8:116577089-116577111 TGGGCACAGCCCCTACACAGTGG - Intergenic
1048018349 8:130517257-130517279 TGGCAACAGCACCTATTGAGAGG + Intergenic
1048504367 8:135007321-135007343 TGGCCTCACCTCCCACAAAGAGG + Intergenic
1048586134 8:135775926-135775948 AGGCCACATCTTCCACTAAGAGG - Intergenic
1049626049 8:143621963-143621985 TGGCCTCACCTCCTGCTATGTGG + Intergenic
1049882547 8:145076087-145076109 AGGCCACAGCTGCTTCTAATAGG + Intergenic
1050429668 9:5549835-5549857 TGGCTACAGCTCCTGGGAAGTGG - Intronic
1057218367 9:93242168-93242190 TGGCTACAGCTCCCACTGTGGGG + Intronic
1061045282 9:128161607-128161629 TGGCCACAGCAAGTACTTAGTGG - Intronic
1185699303 X:2218396-2218418 AGGCCACGGCTGCTACTAAGTGG + Intergenic
1189544568 X:42028252-42028274 TGCCCACTGCTCCCACCAAGTGG + Intergenic
1189679974 X:43505750-43505772 TGGCCACTGCTACTAGTAACTGG + Intergenic
1189952714 X:46248818-46248840 TGTCTACAACTCCTGCTAAGGGG + Intergenic
1195148708 X:102043911-102043933 TGGACACAGCTCCCACTGGGAGG + Intergenic
1195606301 X:106809408-106809430 TGTCCACAGCTCATCCTAAGAGG - Intronic
1197182455 X:123550937-123550959 AGTCCACAGCTCCTATCAAGAGG + Intergenic
1202068615 Y:20967455-20967477 ATGCCACAGCTGCAACTAAGTGG + Intergenic