ID: 922725460

View in Genome Browser
Species Human (GRCh38)
Location 1:227920958-227920980
Sequence GTACAGCTGGAGCAGGGTGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 321}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922725460_922725467 15 Left 922725460 1:227920958-227920980 CCGGCACCCTGCTCCAGCTGTAC 0: 1
1: 0
2: 1
3: 28
4: 321
Right 922725467 1:227920996-227921018 AAAAGCCTCTCAGTCCTTGCAGG 0: 1
1: 0
2: 2
3: 13
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922725460 Original CRISPR GTACAGCTGGAGCAGGGTGC CGG (reversed) Exonic
900171763 1:1272887-1272909 GTTCCCCTGGAGCAGGGCGCGGG + Intronic
901104316 1:6743510-6743532 GCCCAGGTGGAGCAGGGTCCTGG - Intergenic
901125529 1:6925910-6925932 TTACAGCTGGAGCCGGGAGGGGG - Intronic
901455799 1:9362104-9362126 GTCCAGCTGGAGTGGAGTGCAGG - Intronic
901667755 1:10836071-10836093 TTCCAGCTGGAGGAGGGGGCGGG + Intergenic
902110531 1:14074561-14074583 GGACAGCTGTGGGAGGGTGCAGG + Intergenic
902184070 1:14711988-14712010 GTACAGAAGGAGCATGGTGCAGG + Intronic
902220410 1:14960980-14961002 CCACAGCTGGAGGTGGGTGCTGG - Intronic
904046925 1:27614737-27614759 GCACAGCTGATGCAGGGGGCGGG + Intronic
905172649 1:36118332-36118354 GTAGAGCAGGAGTAGGGGGCAGG - Intronic
907474784 1:54698497-54698519 GCAGAGCTGGAGGAGGGGGCAGG - Intronic
908592927 1:65652610-65652632 GTAGAGCTTGAGCACTGTGCTGG - Intergenic
908663775 1:66466532-66466554 GTACTGCTGGAGCAGCAAGCAGG - Intergenic
909468846 1:76003596-76003618 GTACACCTATAGCAGAGTGCAGG - Intergenic
910805856 1:91189344-91189366 GCCCAGCAGGAGCAGGGGGCAGG + Intergenic
912150573 1:106853877-106853899 GCAGAGCTGGAGCACTGTGCTGG - Intergenic
912887358 1:113488952-113488974 ATGCAGCTGGAGCAGGGCGCAGG - Intronic
912894816 1:113575703-113575725 GCAGAGCTTGAGCAGTGTGCTGG + Intronic
915061311 1:153188217-153188239 GTAGAGCTTGAGCACTGTGCTGG + Intergenic
915184091 1:154089537-154089559 CTACAGCTGGACTAGGGTTCAGG + Exonic
917891302 1:179441022-179441044 GTCCACCTGGAGTAGGGTGAGGG + Intronic
920398505 1:205662966-205662988 GAAGAGCCGGCGCAGGGTGCGGG + Exonic
920574687 1:207050820-207050842 GTCCAGCCGGACCCGGGTGCGGG - Exonic
921048145 1:211491706-211491728 GTGCAGCTGTGCCAGGGTGCGGG + Intronic
921213485 1:212918882-212918904 GCCCAGCTGGTGCATGGTGCAGG + Intergenic
922209507 1:223476762-223476784 GTATAGCTGGAGAGGGGTGCAGG - Intergenic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
922725460 1:227920958-227920980 GTACAGCTGGAGCAGGGTGCCGG - Exonic
923017754 1:230140052-230140074 GTACAGCTGACGCAGGGACCCGG - Intronic
924284436 1:242471158-242471180 GTGCAGCTGGAACAGGGAGGTGG - Intronic
1064660244 10:17600625-17600647 GTACAGTAGAAGAAGGGTGCTGG - Intronic
1066357298 10:34697437-34697459 GTAGATCTGGAACAGGGTCCAGG - Intronic
1067281544 10:44877100-44877122 GTGCTGCTGGAGCAGGGTGGGGG - Intergenic
1069488011 10:68837367-68837389 GTGCAGCTGGAGTATGGAGCGGG + Intronic
1069995980 10:72342432-72342454 GTACAGTCGGAGCAGGCTGCAGG + Intronic
1072808592 10:98443000-98443022 GGGCAGCATGAGCAGGGTGCTGG - Intronic
1075265960 10:120999695-120999717 GAACAGCTGGTGAAGGCTGCAGG + Intergenic
1075667289 10:124240389-124240411 GTGGAGCTGGAGCCGGATGCAGG - Intergenic
1076413674 10:130269864-130269886 GAACAGCTTGTCCAGGGTGCCGG + Intergenic
1076542042 10:131220643-131220665 CTACAGCTGAGGCAGGGTCCTGG - Intronic
1077354479 11:2108856-2108878 GAACAGCTGGTGGAGGGTGGGGG + Intergenic
1077369288 11:2174028-2174050 GCAGAGCTGGGGCGGGGTGCTGG - Intergenic
1078473295 11:11609295-11609317 GTGCGGCTAGAGCAGGGTGATGG - Intronic
1080870976 11:36236793-36236815 GGATAGCTGGAGCAGGGTAAGGG - Intergenic
1081516327 11:43833945-43833967 GTACAGCTGGAGCCAGGAGGTGG + Intronic
1083185791 11:61017224-61017246 GGACAGCTGGGGCTGGGGGCTGG + Intronic
1083406168 11:62458811-62458833 GTAAATCTGGAGCAGGGACCAGG - Intronic
1084157612 11:67322940-67322962 GTGAAGCTGGAGCAGGATGGTGG - Intronic
1088180950 11:107109627-107109649 AGAAAGCTGGAGCAGGGTGAGGG + Intergenic
1088643385 11:111895670-111895692 GTACAGTTGGGCCAGGGTGGTGG - Intergenic
1089457785 11:118635247-118635269 GTACAGCGGGAGCTGGGGGGAGG + Intronic
1089627017 11:119757746-119757768 ACACAGCTGGAGCTGGGGGCTGG - Intergenic
1090948584 11:131452749-131452771 GCACTGCAGGAGAAGGGTGCAGG - Intronic
1092084284 12:5742927-5742949 CGAGAGCTGGAGCAGGGAGCAGG - Intronic
1095990724 12:48032746-48032768 GTTGAGCAGGAGCAGGGAGCAGG + Intergenic
1096839192 12:54370354-54370376 GTGCGGCTGGAGCCGGGCGCAGG + Exonic
1097181040 12:57172026-57172048 CCACAGCTGGAGTAGAGTGCAGG - Intronic
1097695795 12:62773782-62773804 GAACATCAGGAGCAGGGTGGGGG + Intronic
1099236049 12:80083785-80083807 GCAGAGCTGGAGCACTGTGCTGG + Intergenic
1102786810 12:115611697-115611719 GCATTGCTTGAGCAGGGTGCAGG - Intergenic
1103020637 12:117531176-117531198 GCTCAGCTGGACCAGGGTTCTGG + Intronic
1103070051 12:117933862-117933884 GGAGAACTGGAGCACGGTGCTGG - Intronic
1103715798 12:122944717-122944739 CTCCAGCTGGAGCAGGCTGTGGG + Intronic
1103911430 12:124354611-124354633 GTGCTGCCGGAGCAGGGTCCCGG + Intronic
1104276631 12:127334515-127334537 CTAGAGCTGGAGCAGGGAGCTGG - Intergenic
1105210115 13:18252642-18252664 CAACACCTGGAGCAGGGTTCTGG - Intergenic
1107674033 13:42776463-42776485 GCAGAGCTGGAGCACTGTGCTGG + Intergenic
1108048756 13:46408604-46408626 GCAGAGCTCGAGCAGTGTGCTGG + Intronic
1112006606 13:95259021-95259043 GGAGAGCAGGAGCTGGGTGCAGG + Intronic
1112165906 13:96919345-96919367 GTAGAGCTTGAGCACTGTGCTGG - Intergenic
1112423075 13:99271408-99271430 GGACAGCTGGAGCAGAGTGATGG + Intronic
1113462610 13:110492476-110492498 GCACAGCAAGATCAGGGTGCAGG + Intronic
1113513643 13:110874586-110874608 GCACGGCTGGAGCTGGGGGCTGG - Intergenic
1113880774 13:113624203-113624225 GCACAGACGGAGCAGGGTGAGGG - Intronic
1113992064 14:16035588-16035610 GGCCAGCTGGAGGAGGGTGGCGG - Intergenic
1114020756 14:18476410-18476432 GTACAGTTGTAGCAGTGTTCTGG + Intergenic
1114020773 14:18476601-18476623 GTACAGTTGTAGCAGTGTTCTGG + Intergenic
1114399319 14:22394989-22395011 GTACAGCTTGAGCAATGTCCAGG + Intergenic
1114781877 14:25547277-25547299 GAGCAACTCGAGCAGGGTGCAGG - Intergenic
1115319955 14:32069189-32069211 GTACTGCTGGGGCGGGGTGAGGG + Intergenic
1115749739 14:36477390-36477412 GGACAGCTGCAGCAGAGGGCGGG + Intronic
1118336266 14:64855860-64855882 GTAGGGCTGGAGCAGGAGGCTGG + Intronic
1118458323 14:65965069-65965091 GTACAGATGGGGCAGGTTGGTGG + Intronic
1119472268 14:74907474-74907496 GGGCAGCTGGAGCTGGGTGTGGG + Exonic
1120812275 14:88816261-88816283 GTACAGTTGGTTGAGGGTGCAGG + Intergenic
1121006966 14:90496587-90496609 GCGCAGCAGGAGCAGGGTGGGGG - Intergenic
1122357918 14:101135111-101135133 ACAGGGCTGGAGCAGGGTGCAGG - Intergenic
1122417573 14:101557764-101557786 GCACACCTGGAGGAGAGTGCTGG - Intergenic
1122825676 14:104369333-104369355 GTGGAGGTGGGGCAGGGTGCAGG + Intergenic
1123091792 14:105745254-105745276 GTGCAGGAGGAGCAGGGGGCAGG - Intergenic
1124474611 15:30022382-30022404 GTAGAGCTTGAGCACTGTGCTGG + Intergenic
1125485701 15:40109282-40109304 GTCCAGTGGGTGCAGGGTGCAGG + Intergenic
1126675526 15:51156780-51156802 ATACACCTGGAGGAGGGGGCAGG + Intergenic
1127927539 15:63561493-63561515 GCACTGCTGGAGATGGGTGCTGG + Intronic
1128602912 15:69012801-69012823 GCAGAACTGGAGCAGGGAGCAGG - Intronic
1128693411 15:69742658-69742680 ACACAGCTGGAGCAGGAGGCTGG + Intergenic
1129299643 15:74618233-74618255 GTATGGGTGGAGCAGGTTGCTGG + Intronic
1129694098 15:77730856-77730878 TGACAGCTGGGGCAGGGTCCTGG + Intronic
1130178917 15:81605787-81605809 GTACTGCAGGAGCAAGATGCAGG + Intergenic
1130728613 15:86466984-86467006 GCAGAGCTGGAGCACTGTGCTGG + Intronic
1131160097 15:90100086-90100108 GTACATCTGGTGCAGGCTGCTGG - Intronic
1133055173 16:3142186-3142208 GTGCCGATGGAGCAGGGTGCCGG - Exonic
1133697252 16:8276495-8276517 GGACACCTGGAGCAGCATGCTGG + Intergenic
1134247686 16:12552225-12552247 GCAAAGCTGGGGCATGGTGCTGG - Intronic
1134273900 16:12758767-12758789 GTACTTCTGGAGCAGTGTTCAGG + Intronic
1134673493 16:16073175-16073197 GTACCCCTGGAGGAGGGTGATGG + Intronic
1138580946 16:57940097-57940119 GGACAGAGGGAGCAGGGTGGCGG - Intronic
1138706405 16:58920182-58920204 GTAGAGCTTGAGCACTGTGCTGG + Intergenic
1139378798 16:66517304-66517326 GCACAGCTCGAGCAGGAAGCAGG + Intronic
1139507649 16:67407212-67407234 GGACAGCTGGCCCAGGGTCCAGG + Intronic
1140200449 16:72890524-72890546 GAACTGCTAGAGAAGGGTGCTGG - Intronic
1141615536 16:85207533-85207555 CTGCCGCTGGGGCAGGGTGCAGG - Intergenic
1142123668 16:88399721-88399743 GCACAGCTGGTTCAGGCTGCAGG - Intergenic
1142231626 16:88902824-88902846 TGTCAGCAGGAGCAGGGTGCGGG - Intronic
1142231637 16:88902871-88902893 TGTCAGCAGGAGCAGGGTGCGGG - Intronic
1142504387 17:353569-353591 GTACAGGCGAAGCAGGGGGCTGG + Intronic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1143805807 17:9425465-9425487 GTACACCTGAAGCAAGGTGGGGG + Intronic
1144636137 17:16910463-16910485 AAGCAGCTGGAGCAGGGTGATGG - Intergenic
1144645933 17:16973364-16973386 AAGCAGCTGGAGCAGGGTGATGG + Intergenic
1145203573 17:20968558-20968580 AAGCAGCTGGAGCAGGGTGATGG - Intergenic
1145994826 17:29099250-29099272 GCACAGCTAGGCCAGGGTGCTGG - Intronic
1148131767 17:45266576-45266598 CTCCAGCTGGAACATGGTGCTGG - Exonic
1148479905 17:47953261-47953283 TTTCTGCTGGAGCAGGGTGGGGG + Exonic
1148872016 17:50663858-50663880 GGTCAGCTGGAGCAGGGCCCAGG + Exonic
1149529436 17:57383023-57383045 GAACAGCAGGAACAGGGTGGAGG + Intronic
1151538249 17:74750513-74750535 GTCCAGCCAGAGCTGGGTGCTGG + Intronic
1151564502 17:74890282-74890304 GCACTGCTGGAGGAGGGTGCTGG - Intronic
1151574293 17:74943933-74943955 GGACACCTGGAGTTGGGTGCAGG - Intronic
1152209427 17:78995247-78995269 GTGCGGCGGGAGCTGGGTGCGGG - Intronic
1152218751 17:79049396-79049418 GACCAGCTGGAGCAGGGTTGCGG + Exonic
1152477146 17:80525893-80525915 GTACAAGTGGGGCAGGGTGGGGG - Intergenic
1155320510 18:24614190-24614212 GGCCAGCTGTAGGAGGGTGCTGG + Intergenic
1155418704 18:25629771-25629793 GTCTAGCTGGAGCAGTCTGCTGG - Intergenic
1156030501 18:32707280-32707302 ATACAGCTAGAGGAGGGTGTGGG - Intronic
1156350614 18:36298212-36298234 GAACAGCTAGAGCCGGGGGCGGG + Intronic
1156463294 18:37333647-37333669 GCAGAGCTGGGGCAGGGTGGAGG - Intronic
1156812887 18:41273977-41273999 GGACAGGTGGAGCAGGCAGCGGG + Intergenic
1157067239 18:44366459-44366481 GCAGAGCTTGAGCATGGTGCGGG + Intergenic
1157842069 18:50968050-50968072 GGACAGCTGGGCCAGGGTGCGGG + Exonic
1160208655 18:76858668-76858690 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208682 18:76858756-76858778 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208709 18:76858844-76858866 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208723 18:76858888-76858910 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208779 18:76859064-76859086 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208793 18:76859108-76859130 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1161915604 19:7225755-7225777 GGACCCCTGGACCAGGGTGCTGG - Intronic
1162211190 19:9093528-9093550 GTACATCTGGATCAGGCAGCAGG - Exonic
1162273906 19:9638115-9638137 GTACAGTTGGAGGAGTGTGGGGG + Intronic
1163530094 19:17843785-17843807 GTACAGCAGGACTTGGGTGCTGG + Exonic
1163641450 19:18464718-18464740 TTACGGCAGGAGTAGGGTGCCGG - Intronic
1163702837 19:18795006-18795028 GTAGCGCTGGAGCTGGGCGCTGG - Intergenic
1164262670 19:23581767-23581789 GTAGGGCTGGGGCAGGGAGCTGG - Intronic
1164456786 19:28414496-28414518 GGACAGGTGGGGCAGGGGGCAGG - Intergenic
1165321513 19:35088336-35088358 GTAGAGGTGGGGCAGGGTGAGGG - Intergenic
1165429795 19:35766138-35766160 GTGGGGCTGGAGCAGGGTGAGGG + Intronic
1165461119 19:35944955-35944977 GTCCAGCTGGACCACGGTGTGGG - Exonic
1166107606 19:40605144-40605166 GTACAGCCGGGGCCGGGGGCCGG - Exonic
1166144829 19:40826575-40826597 GTCCAGCAGGGGCAGGGTGTGGG - Intronic
1166182913 19:41121632-41121654 GTCCAGCAGGGGCAGGGTGTGGG + Intronic
1166322719 19:42028590-42028612 TTACAGCTGGTGCTGGGTTCTGG - Intronic
1166369625 19:42293678-42293700 CTACAGCTGGAGCTGGGGCCGGG - Exonic
1166766537 19:45254540-45254562 GGGCAGATGGAGCAGAGTGCTGG - Intronic
1166827911 19:45620989-45621011 GCACAGTTGGAGCAGGGGCCTGG + Intronic
926187717 2:10704411-10704433 GTACAGCTGGCCCAGTGTGGTGG + Intergenic
926953644 2:18271433-18271455 GCTCAGCGGGAGCAGGGTGGAGG - Intronic
927452146 2:23217894-23217916 GTACAGCTGAAGCTGTGTGAAGG + Intergenic
929588992 2:43133166-43133188 GCTCAGCAGGTGCAGGGTGCGGG + Intergenic
931212040 2:60206843-60206865 GTATAGCTTGAGCACTGTGCTGG + Intergenic
931665371 2:64606590-64606612 GGACAGCTGGCCCAGGGAGCAGG - Intergenic
932534774 2:72581678-72581700 GGCCAGCAGGGGCAGGGTGCGGG - Intronic
934654680 2:96111012-96111034 GTGCAGCTGGAGCTGGGCCCAGG - Intergenic
934745823 2:96759099-96759121 GTAGGGGTGGAGCAGGGCGCTGG + Intergenic
934927902 2:98394543-98394565 TAACAGCTGGAGCTGGGTGAGGG - Intronic
935406884 2:102718741-102718763 GTAGAGCAGCAGCAGTGTGCAGG + Exonic
936236105 2:110744017-110744039 GGACATCTGCTGCAGGGTGCAGG - Intronic
936592426 2:113816815-113816837 GTACAGCTGGGACAAGGTCCTGG + Intergenic
937078655 2:119125140-119125162 GTTCAGCTGGGGCTGGGGGCAGG - Intergenic
937447914 2:121974475-121974497 GTACAGGTGGGGCAGGTAGCAGG + Intergenic
938394132 2:130929748-130929770 GTACAACTGGAGTAGAGTGTTGG + Intronic
938644561 2:133317638-133317660 CTACAGCTGGCGAAGGATGCAGG - Intronic
940752285 2:157639470-157639492 GGACAGCTGCAGCAGGGTGATGG - Intergenic
941172980 2:162162491-162162513 CTACAGATGGGGCAGGGTGGTGG - Intergenic
941688956 2:168478415-168478437 GTTCAGCTGGAACAGGATACTGG - Intronic
942919599 2:181355752-181355774 TTACCTATGGAGCAGGGTGCTGG + Intergenic
942930464 2:181486438-181486460 GCAGAGCTGGAGCAGGGTTCTGG + Intronic
944245671 2:197528567-197528589 GAACATCAGGAGCAGGGAGCAGG - Intronic
947187345 2:227467141-227467163 GTAGGGCTGGAGCAGAGTGGTGG + Intergenic
947698872 2:232216058-232216080 CTAGAGCTGGAGCAGAGTACAGG - Intronic
948940208 2:241191522-241191544 GAACAGCTGGAGGATGGTGGAGG - Intronic
1170463350 20:16599748-16599770 GTGCACCTGGAGGGGGGTGCAGG + Intergenic
1170882375 20:20308424-20308446 GTACAGATGGGGAAGGGGGCTGG + Intronic
1171298713 20:24040907-24040929 GTAGAGGTGGAGGAGGGTACAGG - Intergenic
1172958765 20:38782185-38782207 GTAAAGATGGTGCAGGGTCCTGG + Intergenic
1172979182 20:38928021-38928043 ATAAAGCTGCAGCAGGGTGCTGG + Intronic
1173888384 20:46481631-46481653 GGAGAGCTGGAGCAGGGCACAGG + Intergenic
1174112227 20:48204785-48204807 GTGGAGCTGGACCAGGGTGGAGG + Intergenic
1174446097 20:50592419-50592441 GTCCAGCTGGAGCAGCGCCCAGG + Exonic
1175251213 20:57611129-57611151 GGCCAACTGGAGCAGGGTGATGG - Intronic
1175457499 20:59126590-59126612 GGACAGCTGGAGACGGGAGCAGG - Intergenic
1175785740 20:61710662-61710684 GCCCATGTGGAGCAGGGTGCAGG + Intronic
1176192385 20:63818170-63818192 GTAGAGCTGGACAAGGGCGCTGG + Intronic
1178347183 21:31840251-31840273 GTGCAGCTGGAGCAGTGCTCAGG - Intergenic
1179078993 21:38152588-38152610 GTGCAGCTGGAACAGGGTAATGG + Intronic
1179383134 21:40918192-40918214 GTACATCTGGAGCAGAGAGTTGG - Intergenic
1179412732 21:41174684-41174706 GTACAGCAGGAACGGGGTGGTGG + Intronic
1180315207 22:11271939-11271961 GGCCAGCTGGAGGAGGGTGGCGG + Intergenic
1180445259 22:15407187-15407209 GTACAGTTGTAGCAGTGTTCTGG + Intergenic
1180766142 22:18346762-18346784 CAACACCTGGAGCAGGGTTCTGG + Intergenic
1180780171 22:18515616-18515638 CAACACCTGGAGCAGGGTTCTGG - Intergenic
1180812887 22:18772937-18772959 CAACACCTGGAGCAGGGTTCTGG - Intergenic
1181173994 22:21025843-21025865 ATAGAGCTTGAGCAGGGTGCGGG - Exonic
1181199045 22:21207185-21207207 CAACACCTGGAGCAGGGTTCTGG - Intergenic
1181199065 22:21207253-21207275 CAACACCTGGAGCAGGGTTCTGG - Intergenic
1181392419 22:22593438-22593460 GAACAGATGGAGCAGGGTGCAGG + Intergenic
1181404388 22:22672431-22672453 GAGGAGATGGAGCAGGGTGCAGG + Intergenic
1181411042 22:22719957-22719979 GAGGAGATGGAGCAGGGTGCAGG + Intergenic
1181751699 22:24993371-24993393 GCACAGCTGGAGTAGAGTGAAGG - Intronic
1183205624 22:36417012-36417034 GTCCAGGTGGAGCTGGGTGCAGG - Intergenic
1183630976 22:39032380-39032402 GCACAGCTGGTGCAGGATGGAGG - Exonic
1183982659 22:41551121-41551143 GAACAGCTGAAGCGGGGTGAGGG + Intergenic
1184033538 22:41908280-41908302 GCAGAGCTGGAGGAGGGTGGGGG - Intergenic
1184105528 22:42365544-42365566 TCACAGATGGAGCAGGGTCCTGG + Intergenic
1184255047 22:43281738-43281760 GTACAGGTGAAGCAGGGAGTGGG - Intronic
1184558725 22:45248687-45248709 TGACAGATGGAGCAGGGCGCTGG - Intergenic
1184664909 22:45983181-45983203 GTCCACATGGAGCAGGGTGAAGG - Intergenic
1203227760 22_KI270731v1_random:87653-87675 CAACACCTGGAGCAGGGTTCTGG + Intergenic
950085783 3:10256741-10256763 CTACAGCGGGAGCAGAGGGCAGG + Intronic
950143003 3:10628094-10628116 GTGTGGCTGGAGCAGGGGGCGGG + Intronic
950535615 3:13576523-13576545 GTAGAGCTGGAGCTGGGGGAGGG + Intronic
954808309 3:53232789-53232811 CTTCAGCTGGAGCAGGTGGCCGG + Intronic
954930090 3:54273636-54273658 GGACAGCAGGAGCAGGCTGGTGG + Intronic
956279418 3:67540675-67540697 GCACAGCTCCAGCAGTGTGCTGG - Intronic
956603500 3:71048812-71048834 GTACAGCTGGAGGTGGGGGAGGG + Intronic
960300081 3:115992187-115992209 GTAAAGTTGGAGCTGGGGGCTGG - Intronic
962919228 3:139935801-139935823 GGACGGCTAGAGCAGGGCGCTGG + Intronic
965058562 3:163753539-163753561 CTAAAGCTGGACCAGGGTACTGG - Intergenic
966282843 3:178254820-178254842 ATACTGCAGGAGCTGGGTGCTGG - Intergenic
969031400 4:4217898-4217920 GGAAAGCTGGAGGAGGGTGGAGG + Intronic
969426534 4:7127752-7127774 GTGCTGCTGGGGGAGGGTGCCGG + Intergenic
970099107 4:12500590-12500612 GTAGAGCAAGAGCAGAGTGCAGG + Intergenic
970748471 4:19329186-19329208 GTACAGCTGCTGGAGTGTGCAGG - Intergenic
973199580 4:47485169-47485191 AAACAGCTGGAGCTGGGAGCCGG + Intergenic
974671170 4:65032214-65032236 GTACAGCAGGAGATGAGTGCTGG - Intergenic
975245919 4:72120383-72120405 GCAGAGCTGGAGCACTGTGCTGG - Intronic
975417254 4:74119158-74119180 GTACAGCTGCATCTGGTTGCTGG + Intronic
979212304 4:118119856-118119878 GGACAGCTGGAGATCGGTGCTGG - Intronic
981807485 4:148733509-148733531 AAACAGCTGGAGAAGGCTGCGGG - Intergenic
985528196 5:418466-418488 GCACATGTGGAGGAGGGTGCAGG - Intronic
986981988 5:13458431-13458453 GTACAGCAGGACAAGGGTGATGG - Intergenic
987181791 5:15375365-15375387 ACACAGCTGGAGCAGGGTTCTGG - Intergenic
987262883 5:16221421-16221443 CTCCAGCTGGAGCAGGGACCTGG - Intergenic
987294726 5:16539578-16539600 GGACAGCTTGTGCAGGGAGCTGG - Intronic
987362540 5:17120223-17120245 GTGTAGCTGGACCAGGATGCAGG + Intronic
988306261 5:29498482-29498504 CTACAGCTGCAGCAAGGTGTTGG + Intergenic
988977546 5:36529883-36529905 GTCCAGCTGGGGGAGGCTGCAGG - Intergenic
992187412 5:74257527-74257549 GTAAACCTGGAGCTGGGGGCTGG + Intergenic
992281994 5:75188075-75188097 GTACAGCAGGAGCAGTGGCCAGG - Intronic
992769607 5:80035223-80035245 GGGCAGCTGGAGCAGCGAGCCGG - Intronic
998766505 5:145493600-145493622 ACACAGCTGGAGCAGAGTGATGG - Intronic
999734021 5:154499158-154499180 TCACAGCTGGGGCAGGGTGCTGG - Intergenic
999835014 5:155360317-155360339 GTGCTGATGGATCAGGGTGCTGG + Intergenic
999938676 5:156516407-156516429 GTACAGCTGCTGCAGTTTGCTGG - Intronic
1000406537 5:160893672-160893694 GCAGAGCTGGAGCACTGTGCTGG - Intergenic
1000816331 5:165927137-165927159 CTGGAGCTGGAGCAGGGTGAGGG - Intergenic
1001722261 5:173866597-173866619 GTACAGCTGGGCCTGGCTGCGGG - Intergenic
1001821333 5:174712812-174712834 GGACAGGTGGAGCGGGGAGCCGG - Intergenic
1002775899 6:327319-327341 TTACAGCTGGAGGAGAGTGAAGG + Intronic
1002942659 6:1731920-1731942 GCACAGCTGGAGCAGAGTATGGG + Intronic
1004259581 6:14096375-14096397 GCACTGCTGGAGGAGGATGCTGG + Intergenic
1005893400 6:30158364-30158386 GCACAGGTGGGGCAGGGTTCCGG + Intronic
1006066024 6:31463223-31463245 GAACAGCAGGAGGAGGGTTCGGG - Intergenic
1006304114 6:33208629-33208651 GAACGGCTGGAGCTGGGTGAGGG + Exonic
1006670601 6:35727830-35727852 GCACAGCTGGGGGAGGGAGCAGG - Intronic
1006772029 6:36561661-36561683 GTACAGCTGGAGCAAGTTGTGGG - Intergenic
1006804555 6:36779689-36779711 GGTCAGCTGGGGCAGGGAGCAGG - Intronic
1007111178 6:39314240-39314262 GAGCAGCAGGAGCACGGTGCTGG + Exonic
1007380823 6:41488960-41488982 GTCCAGCAGGAGCAGGGACCAGG + Intergenic
1009945305 6:70336138-70336160 GTAGAGCTTGAGCACTGTGCTGG + Intergenic
1010101418 6:72112467-72112489 GTACAGATGATGCAGGGTGTTGG - Intronic
1010244857 6:73653689-73653711 GTCCCGCCGGCGCAGGGTGCGGG + Intronic
1011632478 6:89340469-89340491 GTAGAGTTGGAGCAGGGTCCTGG - Intronic
1012207406 6:96478416-96478438 GCAGAGCTGGAGCACTGTGCTGG + Intergenic
1017320333 6:153084568-153084590 GAACAGCTGGAAAAGGCTGCAGG + Intronic
1019923939 7:4180170-4180192 ATAGAGCTGGAGCTGGGCGCTGG - Intronic
1019923945 7:4180195-4180217 ATAGAGCTGGAGCCGGGCGCTGG - Intronic
1019923950 7:4180220-4180242 ATAGAGCTGGAGCTGGGCGCTGG - Intronic
1019923978 7:4180345-4180367 ATAGAGCTGGAGCCGGGTGCTGG - Intronic
1019923993 7:4180420-4180442 ATAGAGCTGGAGCTGGGCGCTGG - Intronic
1019923999 7:4180445-4180467 ATAGAGCTGGAGCCGGGTGCTGG - Intronic
1019924014 7:4180520-4180542 ATAGAGCTGGAGCCGGGTGCTGG - Intronic
1020213668 7:6172735-6172757 GTACATCCAGAGAAGGGTGCAGG - Intronic
1023527107 7:41116336-41116358 GTAGAGCTGGAGCAGGGAGAAGG + Intergenic
1023632646 7:42179344-42179366 ATACAGCTGGAGCAGAGGGAAGG + Intronic
1023810407 7:43906749-43906771 GGACAGCTGGGGCGGGGTGGGGG + Exonic
1023996457 7:45161815-45161837 GTCCAGGTGGACCAGGCTGCAGG + Intronic
1024446008 7:49479638-49479660 TGTCAGCTGTAGCAGGGTGCTGG + Intergenic
1026913439 7:74106099-74106121 GGTCAGCTGGAGCAGGCGGCTGG - Exonic
1027701317 7:81473173-81473195 TTACTGCTGGTGCAGGGTCCAGG - Intergenic
1028282530 7:88948593-88948615 GGACAGCAGGAGCAGGCTGGTGG - Intronic
1028639911 7:93030163-93030185 TATCAGCTGCAGCAGGGTGCTGG - Intergenic
1028657002 7:93220055-93220077 GTACAGATGGAGCACAGTGGAGG + Intronic
1029973833 7:104814747-104814769 GGGCAGATGCAGCAGGGTGCTGG + Intronic
1031711058 7:125046930-125046952 GCAGAGCTGGAGCACTGTGCTGG - Intergenic
1034138726 7:148796815-148796837 CTGCATCTAGAGCAGGGTGCGGG - Intronic
1034778817 7:153858331-153858353 GTTCTGCTGGGGCAGGGTGAAGG + Intergenic
1034985929 7:155515414-155515436 GGAGAGCTGCTGCAGGGTGCTGG + Intronic
1036642167 8:10591481-10591503 GTACAGCCGCTGCAGGGTGTAGG + Intergenic
1037056269 8:14445537-14445559 GGGCAGCTGGAGAAGGGGGCAGG - Intronic
1037285411 8:17293964-17293986 GCAGAGCTAGAGCATGGTGCTGG + Intronic
1037690373 8:21176830-21176852 GCACAGCAGGAGGTGGGTGCAGG - Intergenic
1037701024 8:21273905-21273927 TTTCAGCTGGAGGAGGGTTCAGG + Intergenic
1038426999 8:27470112-27470134 GCACAGCATGAGCAGGCTGCGGG + Intronic
1038485850 8:27934730-27934752 GAACCCCTGGAGCAGGGGGCAGG + Intronic
1039474152 8:37830581-37830603 TCCCAGCTGGAGCAGGCTGCAGG + Intronic
1047151491 8:122268592-122268614 GAACTGATGGAGCAGAGTGCAGG + Intergenic
1049425242 8:142535260-142535282 GGCCAGCTGGAGCAGAGGGCTGG + Intronic
1049586584 8:143435265-143435287 GGGCAGCAGGAGCAGGGTGGGGG - Intergenic
1052261628 9:26523094-26523116 GAATACCTGGAGCAGGGTGCGGG + Intergenic
1055571836 9:77624398-77624420 GCAGAGCTGGAGCATTGTGCTGG - Intronic
1055697533 9:78902952-78902974 GTGCAGCTGGAGCAGAGAGGAGG + Intergenic
1058718466 9:107742518-107742540 GTGCAGCAGGAAGAGGGTGCTGG - Intergenic
1058892186 9:109370743-109370765 TTCCAGCTGGAGCAGGTTTCAGG + Intergenic
1059167866 9:112096265-112096287 GTATGGCTGGAGCAGAGAGCTGG - Intronic
1060230607 9:121822624-121822646 GCACAGCTGGTGCGGGGTGGGGG + Exonic
1060877895 9:127096284-127096306 CAACAGCTGGAGCAGAGCGCCGG + Intronic
1061867245 9:133499195-133499217 GTCCAGCAGGGGCAGGGTGCTGG - Intergenic
1061898340 9:133660136-133660158 GTACTGCTGGAGCGGGGTAGGGG - Intergenic
1061916253 9:133755980-133756002 GAACAGCTGGAACAGCCTGCTGG - Intergenic
1062039721 9:134398685-134398707 TTACATCTGGAGCAGGGGGTGGG + Intronic
1062554411 9:137107470-137107492 GTCCATCAGGAGGAGGGTGCTGG + Intronic
1186617577 X:11205351-11205373 TTACAACTGGAGAAGGGGGCAGG - Intronic
1186626034 X:11295042-11295064 GTACAGCTGGGGCGGGGCCCAGG + Intronic
1187474962 X:19602402-19602424 GTACAGCTGGAGAAGGGAGAGGG + Intronic
1189098818 X:38168065-38168087 GTTCAGCTTCAGCTGGGTGCTGG - Intronic
1189155540 X:38752728-38752750 GCACAGCTGGCTCAGGGTACAGG + Intergenic
1189189683 X:39089434-39089456 GCAGAGCTCGAGCAGTGTGCTGG - Intergenic
1190119213 X:47646854-47646876 GTGTGGCTGGAGCAGAGTGCGGG - Intronic
1190330113 X:49230577-49230599 GTTCTGCTGGAGCAGGGCCCCGG - Exonic
1191893447 X:65968380-65968402 AATCAGCTGGAGCTGGGTGCAGG - Intergenic
1192030763 X:67509832-67509854 GCAGAGCTGGAGCACTGTGCTGG - Intergenic
1194261280 X:91699272-91699294 CAACAGTTGGGGCAGGGTGCTGG + Intergenic
1195738578 X:108038739-108038761 GTATGGCTAGAGCAGAGTGCAGG + Intergenic
1197406961 X:126065307-126065329 GTCCAGATGTGGCAGGGTGCTGG - Intergenic
1199745624 X:150770498-150770520 GTTCAGGTGGCTCAGGGTGCAGG - Intronic
1199819018 X:151426296-151426318 GGTTAGCAGGAGCAGGGTGCAGG - Intergenic
1200169343 X:154060988-154061010 GGACACCTGGACCAGGGTGGGGG + Intronic
1200250102 X:154548214-154548236 CTATAGCTGGAGCAGAGTGAGGG + Intronic
1200579929 Y:4938073-4938095 CAACAGTTGGGGCAGGGTGCTGG + Intergenic
1201920562 Y:19229296-19229318 GGAAAGCTGAAGCAGGGTGATGG + Intergenic
1202096242 Y:21250795-21250817 GCAGAGCTGGAGCACTGTGCTGG + Intergenic