ID: 922726164

View in Genome Browser
Species Human (GRCh38)
Location 1:227924002-227924024
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922726164 Original CRISPR GTGGAGTGGCCTCCTGTAGG AGG (reversed) Intronic