ID: 922726164

View in Genome Browser
Species Human (GRCh38)
Location 1:227924002-227924024
Sequence GTGGAGTGGCCTCCTGTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922726164 Original CRISPR GTGGAGTGGCCTCCTGTAGG AGG (reversed) Intronic
900709815 1:4106707-4106729 GTGGAATGAGCTCCTATAGGTGG - Intergenic
902680173 1:18037901-18037923 GTGGAGTCACCTCCCTTAGGAGG - Intergenic
904623031 1:31786971-31786993 GTTGAGTGGCTTCCTGGAGGAGG - Intergenic
904747014 1:32717545-32717567 GTGCAGTGACCTGCTGCAGGTGG + Intergenic
907806125 1:57822064-57822086 GTGGAATGGCCAACAGTAGGTGG + Intronic
913298639 1:117346707-117346729 GTGGAGTCACTGCCTGTAGGTGG + Intergenic
914402746 1:147338655-147338677 GTGGGGTGGGCTGCTGTGGGAGG - Intergenic
919658906 1:200223972-200223994 GAGGAGTGGCCCCGCGTAGGGGG - Intergenic
920284044 1:204866921-204866943 TTGGATTGGCTTCCTGGAGGAGG + Intronic
920447949 1:206034195-206034217 GTGGGGAAGCCTCCTGGAGGAGG - Intergenic
921046517 1:211481553-211481575 GTTGAGTGGCCTCAAGTAGGTGG + Intronic
921260951 1:213384670-213384692 ATGGGGTGGCCTCCTGGGGGAGG - Intergenic
922049009 1:221972748-221972770 TTGGAGAGGCCAGCTGTAGGTGG - Intergenic
922726164 1:227924002-227924024 GTGGAGTGGCCTCCTGTAGGAGG - Intronic
923596042 1:235361454-235361476 GTGGATTGGCCTCCAGGAGAAGG - Intergenic
924820645 1:247487304-247487326 TTTGAGAGGTCTCCTGTAGGAGG + Intergenic
1065214391 10:23436703-23436725 GTGGAAAGGCTTCCTGGAGGAGG - Intergenic
1070772679 10:79091575-79091597 GGGGAGGGGCCTCCTGGAGGAGG + Intronic
1071971586 10:90913304-90913326 GTGGAATGGACTCCCGGAGGTGG + Intronic
1072611411 10:97019670-97019692 CTGGAGGGGCCTGCTGTAGCAGG - Intronic
1074407769 10:113193889-113193911 GTGGAGTGGCTTGCTTCAGGAGG + Intergenic
1074857300 10:117482830-117482852 ATGAGGTGGCCTCATGTAGGTGG + Intergenic
1075228542 10:120651207-120651229 CTGGGGTGGCCTCCTGCACGGGG - Intergenic
1076409548 10:130236096-130236118 GTGCAGTGGCCTCCTGGATTTGG + Intergenic
1077250601 11:1559043-1559065 GTGGCGAAGCCCCCTGTAGGAGG + Exonic
1077422817 11:2460931-2460953 GGGGTGTGGCCTCCTGTGGATGG + Intronic
1080635601 11:34120855-34120877 CAGGGGTGGCCTCATGTAGGAGG + Intronic
1084051910 11:66605597-66605619 GTGGTGTCGGCCCCTGTAGGAGG + Intronic
1084899011 11:72295723-72295745 CTGGGGAGGCCTCCTGAAGGAGG - Intronic
1090421839 11:126580638-126580660 GTGCACTGCCCTCCTGCAGGAGG + Intronic
1090571530 11:128052463-128052485 GTGGACTGGGCTGCTGAAGGGGG + Intergenic
1090931014 11:131298076-131298098 GTGGCTTGGCTTCCTGGAGGAGG - Intergenic
1091345799 11:134853152-134853174 GTGGAGAGGGCTGCAGTAGGGGG + Intergenic
1092141009 12:6183331-6183353 GTGGAGTGGCCTGCCTCAGGAGG + Intergenic
1093515050 12:19975733-19975755 ATGGAGTGGACTCATGGAGGTGG - Intergenic
1094731244 12:33178835-33178857 GTGCAGTAGCCTCATGAAGGTGG + Intergenic
1095964579 12:47858296-47858318 GTGGAGAGGACTCCTCTATGTGG + Intronic
1101234555 12:102775519-102775541 GTGGAGGGACCTCCTCCAGGTGG - Intergenic
1102751893 12:115301922-115301944 GTGGTGTGGACTCCTTTAGCCGG - Intergenic
1107286862 13:38802824-38802846 GTCGAGGGGTCTCCTGTAGCTGG + Intronic
1107508074 13:41055446-41055468 GAGGAAAGGCCTCCTGTAGGAGG - Intronic
1112007378 13:95266028-95266050 GTGAAGTAGGCTCCTGAAGGGGG + Intronic
1121102975 14:91262924-91262946 GTGGAGGGGGCTGCTGTTGGTGG - Intergenic
1122138330 14:99647220-99647242 GTGGGCTGGCCACCTTTAGGTGG + Intronic
1122207773 14:100156733-100156755 GTGGAGGGGCTTTCTGCAGGAGG + Intronic
1122982641 14:105198555-105198577 CTGGAGTGGCAACCTGGAGGCGG + Intergenic
1125639988 15:41222467-41222489 GTGGAGTGATCTCCTAAAGGAGG - Intronic
1125796729 15:42409020-42409042 GTGGAGGGGGCTCTTGCAGGTGG + Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1127555327 15:60081995-60082017 GTGGTGGGGCTTCCTGGAGGAGG + Intergenic
1128099826 15:64989693-64989715 GAAGAGCGGCCTCCTGAAGGAGG - Exonic
1128338735 15:66805096-66805118 CTGGAGGTGACTCCTGTAGGGGG + Intergenic
1128452438 15:67813512-67813534 GTGGGCTGGGCTCCTGTGGGTGG - Intergenic
1129518421 15:76170863-76170885 GTGGGGTGGCCTTCTGGTGGGGG + Intronic
1132864099 16:2085171-2085193 GTGGGGCGGCCTCCTGTGGACGG + Intronic
1134073376 16:11274200-11274222 GTAGAGTGGCCTCTGGTTGGTGG - Intronic
1134468042 16:14496140-14496162 GTTGAGTGGCCTGCTGAAGATGG + Intronic
1136452108 16:30359349-30359371 GCTGAATGGCCTCCTGCAGGTGG + Exonic
1138086999 16:54142426-54142448 CAGGGGTGGCCTCCTGGAGGAGG + Intergenic
1138561333 16:57802431-57802453 GTGGAGCTGCCTCCTGCCGGCGG - Exonic
1140999483 16:80295134-80295156 TTAGAGTGGCCTCCTGGAGGAGG - Intergenic
1141921862 16:87140822-87140844 GAGGAGTCGCCTCCTGAAAGTGG + Intronic
1142720691 17:1773825-1773847 GTGGGGTGGCCTGGGGTAGGGGG + Intronic
1142794378 17:2296217-2296239 GTGGAGGGGGCTATTGTAGGTGG - Intronic
1142970659 17:3609454-3609476 GTGGGGTGGCTTCCAGGAGGGGG - Exonic
1144515997 17:15917844-15917866 TTGGGGTGGCCTCCTGTGGCAGG - Intergenic
1144787924 17:17842143-17842165 GGGGAGTGGGCTCCTGAAGTGGG - Intergenic
1145964966 17:28910576-28910598 GTGCAGCTGCCTCCTGTAGTTGG + Intronic
1147214363 17:38890767-38890789 GGAGAGTGGCTTCCTGGAGGAGG - Intronic
1151366071 17:73617240-73617262 GGGGAGAGGCCTCCTGCAGAGGG + Intronic
1151366087 17:73617285-73617307 GGGGAGAGGCCTCCTGCAGAGGG + Intronic
1151973968 17:77474133-77474155 CTGGGGCGGCCTCCTGGAGGTGG + Intronic
1152300957 17:79495240-79495262 TTGGAGAAGCCTCCTGAAGGGGG + Intronic
1152600357 17:81259200-81259222 GTGGAGGCCCCTCCTGGAGGCGG + Intronic
1152753938 17:82079107-82079129 GTGGAGTGACCTCCGGTGGCAGG + Exonic
1153825124 18:8868073-8868095 GTGGAGTGGCCTCCACCATGAGG + Intergenic
1156868639 18:41917418-41917440 GGGGTGTGGCCTCCTGCAGGAGG + Intergenic
1160537133 18:79600712-79600734 GTGGAGGGACCCCCTGTGGGTGG - Intergenic
1160537154 18:79600772-79600794 GTGGAGGGACCCCCTGTGGGTGG - Intergenic
1161421767 19:4179796-4179818 GTGGAAGGGCTTCCTGGAGGAGG + Intronic
1161657829 19:5526618-5526640 AAGGAGTGCCCTTCTGTAGGTGG + Intergenic
1163146279 19:15380730-15380752 GTGGAGTGGCCCTCCGTTGGTGG - Intronic
1164399026 19:27890231-27890253 GTGGGGAGGCCTCTTGGAGGAGG - Intergenic
1164596927 19:29536291-29536313 CAGGAGAGGCTTCCTGTAGGTGG + Intronic
1166098269 19:40555039-40555061 GTGATGTTGCCTCGTGTAGGCGG + Intronic
1166222546 19:41375082-41375104 GAGGAGTGGGGTCCAGTAGGGGG - Intronic
925613439 2:5722566-5722588 GTGGCTTGGTCTCCTGGAGGTGG + Intergenic
928124826 2:28608031-28608053 GTGGAGCAGCCTCCTTTTGGGGG - Intronic
930689870 2:54350463-54350485 GTGGAGTGACCACCTGGAGAAGG - Intronic
937287046 2:120760303-120760325 GTGGAGTGGTCTTATGTGGGGGG + Intronic
937335558 2:121060113-121060135 GTGCAGTGGCCTTGTGGAGGTGG + Intergenic
938092367 2:128441931-128441953 CTGGAGGGGCCTTCTGTAGCTGG + Intergenic
938457574 2:131476465-131476487 GTGGCGTCGCCTCCTGAAGACGG + Intronic
945190027 2:207178356-207178378 ATGGAATGGCCTCCTTCAGGTGG - Intergenic
945570677 2:211463710-211463732 CTGGAAAGGCCTGCTGTAGGAGG - Intronic
947603672 2:231469763-231469785 GAGGAGTGGCCCCAAGTAGGTGG - Intronic
947766398 2:232640698-232640720 CTGGAGTGTCCTCCTGTATGTGG - Intronic
948716086 2:239864704-239864726 ATGGGGTGGCCTCCGGGAGGTGG + Intergenic
1169342977 20:4810285-4810307 TTGGAGAGGCCTCCTGTGGGAGG - Intronic
1174796277 20:53525150-53525172 CTGGAGAGGCCACGTGTAGGAGG + Intergenic
1177014029 21:15761669-15761691 GTGGACAGCCATCCTGTAGGAGG + Intronic
1177507893 21:22041145-22041167 GTTGAGGGGCCTCCTGCAGCTGG + Intergenic
1178589170 21:33894880-33894902 GTGGAGGGTCTCCCTGTAGGAGG + Exonic
1183322978 22:37176387-37176409 GTGGAGTTGCAGCCTGGAGGTGG - Intergenic
1184276133 22:43410866-43410888 CTGGTGTGGCTTCCTGGAGGTGG - Intergenic
1184846470 22:47090789-47090811 GGGGAGTGGCCTCGCGGAGGGGG + Intronic
1184846538 22:47091114-47091136 GGGGAGTGGCCTCGGGGAGGGGG + Intronic
1184846551 22:47091175-47091197 GGGGAGTGGCCTCGCGGAGGGGG + Intronic
1184846589 22:47091411-47091433 GGGGAGTGGCCTCGCGGAGGGGG + Intronic
1184846601 22:47091478-47091500 GGGGAGTGGCCTCGTGGAGGGGG + Intronic
950702492 3:14759935-14759957 GGGGAGGGTCCTCCTGCAGGGGG - Exonic
951825461 3:26863560-26863582 GTGGGCTTGCCTCATGTAGGGGG + Intergenic
953385178 3:42502249-42502271 GCGGGGAGGCCTCCTGGAGGAGG + Intronic
954972733 3:54664713-54664735 GTGGTGAGACCTCCTGTAGATGG + Intronic
956964854 3:74447247-74447269 GAGCTGTGGCCTCCAGTAGGAGG + Intronic
959906934 3:111720846-111720868 GAGCTGTGTCCTCCTGTAGGAGG - Intronic
960610945 3:119554354-119554376 GGGGAAAGGCCTCCTGTAGGAGG - Intronic
961490809 3:127255748-127255770 GTGGAGGGGGCCCCAGTAGGTGG - Intergenic
965259518 3:166463258-166463280 CTGGACTGGCCTCCTGAAAGTGG - Intergenic
968231454 3:197007128-197007150 GTGGGGTGGCTCCCTGAAGGTGG + Intronic
968473687 4:793155-793177 GAGGCCTGGCCTCCTGGAGGTGG + Intronic
971047400 4:22820206-22820228 GTGGAGTTGCCTTATGCAGGAGG + Intergenic
973247212 4:48022222-48022244 GTGGAGTGGCCTACGGGAGAAGG - Intronic
975148145 4:70992964-70992986 CTGGAAAGGCCTCCTGTGGGTGG + Intronic
975944985 4:79695613-79695635 GTTGATTGGCCTCCAGCAGGAGG + Intergenic
980331262 4:131414600-131414622 GTGGAGTGGGTTCATGTCGGCGG - Intergenic
982099865 4:151957440-151957462 GTGGGGTGGCCTCCTGCTGGTGG + Intergenic
987251535 5:16106101-16106123 TTAGAATGGCTTCCTGTAGGAGG + Intronic
988577754 5:32444009-32444031 GGGGAGCGGCCCCCAGTAGGGGG - Intronic
996448605 5:123589501-123589523 GTGCAGTGACCTTCTTTAGGTGG - Intronic
996458811 5:123717251-123717273 TTGGAGTAGCCTCCTGTACTAGG + Intergenic
998286066 5:140862276-140862298 GTGGAGCGTCCTCCTGTACAGGG - Intronic
999133677 5:149302946-149302968 GTAGAATGACCTCCTATAGGTGG + Intronic
1000231223 5:159316971-159316993 GTGGAGTGTCTGCCAGTAGGTGG - Intronic
1008877622 6:56346969-56346991 GTGCAGGGGCCTCCTGCAAGAGG - Intronic
1009848577 6:69165581-69165603 TTGGAGAGGCTTCCTGGAGGAGG - Intronic
1010374090 6:75146166-75146188 GTGCAGTGGCAGCCTGTGGGAGG - Exonic
1011735071 6:90302388-90302410 GTGGGATGGCTTCCTGGAGGAGG + Intergenic
1014515094 6:122368338-122368360 GGGGAGTGGCCTCATGAAGAGGG + Intergenic
1018300706 6:162399467-162399489 GTGGAGGGGTGTCCTGTATGTGG - Intronic
1019511076 7:1417598-1417620 GTCGCGTGGGCTCCTGGAGGTGG + Intergenic
1019795001 7:3042976-3042998 CTGGAGGGGCCTCCTGGGGGAGG + Intronic
1020628145 7:10608254-10608276 GTGGAGAGGCCTACTGTTGGAGG - Intergenic
1024350303 7:48356513-48356535 GTGGAGAGACCTACTATAGGTGG + Intronic
1027336376 7:77154931-77154953 GAGGAGTGGCCTCCAGTGTGAGG + Intronic
1029779415 7:102716170-102716192 GAGGAGTGGCCTCCAGTGTGAGG - Intergenic
1030267143 7:107632137-107632159 GCGGGGTAGCCTCCTGTAGCGGG - Intergenic
1037594390 8:20342813-20342835 GTGGTGAGTCCTCCTGCAGGTGG + Intergenic
1038284022 8:26190793-26190815 GTGGAGCGCCCTCCTGGAGTGGG - Intergenic
1039553731 8:38461715-38461737 GTGATGTGGCTTCCTCTAGGTGG - Intronic
1039854985 8:41404216-41404238 GCGGAGTGGCCTCCTGGAAACGG - Intergenic
1044323448 8:90832279-90832301 GTGGAGTGGCCTGATTTAGAAGG - Intronic
1052736172 9:32344796-32344818 GTGGAGAGGCAGCCTGTGGGAGG - Intergenic
1053169520 9:35868829-35868851 GTGGGGTGGCTTCCTGGTGGAGG + Intergenic
1053303841 9:36970205-36970227 GGGGAGTGGCCTCCTGTGGGAGG + Intronic
1056791101 9:89625838-89625860 GTAGAGTGGCCTGCTGCAGACGG - Intergenic
1058371793 9:104277364-104277386 GTGGATTTGCCTCCTGCAGGAGG - Intergenic
1061843656 9:133375411-133375433 GTGCTGTGGCTTCCTGTAGCTGG + Intronic
1062211482 9:135366642-135366664 GTGGACTGGCCTTCAGCAGGGGG - Intergenic
1062211900 9:135369440-135369462 GTGGACTGGCCTTCAGCAGGAGG - Intergenic
1062662486 9:137645584-137645606 GAAGAGGGGCCTCCTGTAGGTGG + Intronic
1185855626 X:3532215-3532237 GTAGAGTGGCATCCAGTTGGTGG - Intergenic
1187684985 X:21807179-21807201 GAGGAATGGCCTCCTGTGAGAGG + Intergenic
1188113037 X:26214310-26214332 GTGGAGTTGTCTCCTTTAGCTGG - Intergenic
1198602589 X:138300476-138300498 GTGATGTTGCCTCCTGTAAGTGG - Intergenic
1200116708 X:153772725-153772747 GTGCAGTGGCCTCGGGAAGGAGG + Intronic