ID: 922727480

View in Genome Browser
Species Human (GRCh38)
Location 1:227929476-227929498
Sequence AAGTGGTAGCATTAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1518
Summary {0: 1, 1: 0, 2: 26, 3: 280, 4: 1211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922727472_922727480 10 Left 922727472 1:227929443-227929465 CCCAAATTCATATGGTCAAACCT 0: 1
1: 5
2: 186
3: 854
4: 2629
Right 922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG 0: 1
1: 0
2: 26
3: 280
4: 1211
922727471_922727480 11 Left 922727471 1:227929442-227929464 CCCCAAATTCATATGGTCAAACC 0: 1
1: 6
2: 108
3: 840
4: 2564
Right 922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG 0: 1
1: 0
2: 26
3: 280
4: 1211
922727475_922727480 -10 Left 922727475 1:227929463-227929485 CCTAACACCATCAAAGTGGTAGC 0: 1
1: 0
2: 2
3: 26
4: 195
Right 922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG 0: 1
1: 0
2: 26
3: 280
4: 1211
922727473_922727480 9 Left 922727473 1:227929444-227929466 CCAAATTCATATGGTCAAACCTA 0: 1
1: 3
2: 62
3: 248
4: 714
Right 922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG 0: 1
1: 0
2: 26
3: 280
4: 1211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922727480 Original CRISPR AAGTGGTAGCATTAGGAGGT GGG Intronic
900427014 1:2585539-2585561 AAGGGGAAGCACTAGGAGGGAGG - Intergenic
900849550 1:5131321-5131343 ATGTGATCGCATTTGGAGGTGGG + Intergenic
901219063 1:7572711-7572733 AGGTGATGGTATTAGGAGGTGGG - Intronic
901442069 1:9283921-9283943 AGGTGGTGGTATTAGGAGGTAGG + Intergenic
901834508 1:11915357-11915379 ATGTGATAGGATTAGGAGGTGGG - Intergenic
902428373 1:16342741-16342763 ATGTGGTGGTGTTAGGAGGTGGG + Intronic
902611270 1:17598627-17598649 AGGTGATAGTATTAGGCGGTGGG - Intronic
902734020 1:18388148-18388170 AGGTGATGGGATTAGGAGGTGGG + Intergenic
902735354 1:18397171-18397193 ATGTGATAGAATTAGAAGGTAGG + Intergenic
902902652 1:19530253-19530275 AAGTGATGGTATTAGGAGGTGGG + Intergenic
903051479 1:20604473-20604495 AAGTGATGGTATTAGGAAGTGGG - Intronic
903388717 1:22948016-22948038 AAGTGGTTGTATTAATAGGTGGG + Intergenic
903482186 1:23661811-23661833 AGGTGATGGTATTAGGAGGTGGG - Intergenic
903528729 1:24013232-24013254 AGGTGATGGTATTAGGAGGTAGG + Intergenic
903531971 1:24037828-24037850 AGGTGATGGTATTAGGAGGTGGG - Intergenic
903985275 1:27222995-27223017 AAGTGATAGTATTAGGAGGTGGG - Intergenic
904636988 1:31889747-31889769 AGGTGATGGTATTAGGAGGTGGG - Intergenic
904862009 1:33545621-33545643 CAGTGATAGTATTAGGAAGTGGG - Intronic
904868174 1:33599059-33599081 AGGTGATGGTATTAGGAGGTGGG - Intronic
905077096 1:35282203-35282225 ATATGGCAGTATTAGGAGGTGGG + Intronic
905098734 1:35499281-35499303 AAGTGATGGTATTAGGAGGTAGG + Intronic
905534007 1:38704747-38704769 AAGTGATGGTATTAGGAGGTGGG + Intergenic
905916986 1:41691447-41691469 AGGTGATAGTATTAGGAGGTGGG + Intronic
906178717 1:43799629-43799651 ATGTGATAGTATTAAGAGGTAGG - Intronic
906256201 1:44352626-44352648 AAGTGGTAAGAGTTGGAGGTGGG - Intronic
906443997 1:45877463-45877485 ATGTGATAGTATTACGAGGTGGG - Intronic
906759023 1:48355284-48355306 AAATGGTAGCATGAGTGGGTAGG - Intronic
906823285 1:48951485-48951507 ATGTGATAGTATTAGGAAGTAGG + Intronic
907020791 1:51065243-51065265 AAGTGTTAGCATTAGAAGGCTGG - Intergenic
907052618 1:51339920-51339942 AGGTGATGGTATTAGGAGGTGGG + Intronic
907628465 1:56055526-56055548 ATGTGATAGTATTAAGAGGTGGG + Intergenic
907693384 1:56694744-56694766 AGGAGATAGTATTAGGAGGTGGG - Intronic
907715036 1:56918648-56918670 AAGTGATGGCATGAGGAGGTGGG - Intergenic
907787480 1:57626851-57626873 AGGTGATAGTATTAGGAGGCAGG - Intronic
907869447 1:58430094-58430116 AAGTGATAGTATTAGGAGATGGG - Intronic
907945387 1:59131332-59131354 AGGTGATGGCATTAAGAGGTGGG + Intergenic
908262005 1:62346333-62346355 AAGTGGTGGTATTAAGAAGTGGG + Intergenic
908345301 1:63226383-63226405 ATGTGATAGTATTAGGAAGTGGG + Intergenic
908357521 1:63337213-63337235 AAGTGATGGTATTAGGAGGTGGG + Intergenic
908392473 1:63696226-63696248 AGGTGATGGTATTAGGAGGTGGG + Intergenic
908499698 1:64730744-64730766 ATGTGGCAGTATTGGGAGGTGGG - Intergenic
908545790 1:65160923-65160945 ATGTGATAGTATTAAGAGGTGGG - Intronic
908564698 1:65342300-65342322 ATGTGGTAATATTTGGAGGTAGG + Intronic
908612708 1:65880485-65880507 AGGTGATGGTATTAGGAGGTTGG + Intronic
908710332 1:67007401-67007423 AAGTCATGGTATTAGGAGGTAGG - Intronic
908846383 1:68328771-68328793 AGGTGATAGTATTAGGAAGTGGG + Intergenic
908850550 1:68371607-68371629 ATGTGATAGCATGTGGAGGTGGG - Intergenic
908900834 1:68954641-68954663 ATGTAATGGCATTAGGAGGTGGG - Intergenic
909134590 1:71782125-71782147 AGGTGATACTATTAGGAGGTGGG + Intronic
909191333 1:72556474-72556496 ATGTGATGGCATTAGGAAGTGGG - Intergenic
909395176 1:75163788-75163810 ATGTGGTGGTATTAAGAGGTAGG + Intergenic
909454662 1:75837060-75837082 AGGTGATAGTATTAGGACGTGGG + Intronic
909759205 1:79268343-79268365 AAGGGGTAGGAGTAGGAGTTGGG + Intergenic
909870250 1:80729801-80729823 ATCTGATGGCATTAGGAGGTGGG - Intergenic
910400064 1:86829471-86829493 GTGTGGTAGTATTAAGAGGTGGG + Intergenic
910544388 1:88397737-88397759 AGGTGATGGTATTAGGAGGTGGG - Intergenic
910551469 1:88480404-88480426 AGGTGATGGCATTAGGAGGTGGG - Intergenic
910568815 1:88677458-88677480 ATGTGATAATATTAGGAGGTGGG - Intergenic
910593158 1:88949951-88949973 AGGTGATGGTATTAGGAGGTGGG + Intronic
910623277 1:89279303-89279325 AAGTGATAGTATTAAGAGGTAGG + Intergenic
910654726 1:89608354-89608376 ATGTGATGGTATTAGGAGGTGGG + Intergenic
910667781 1:89742892-89742914 AAGGTGGAGTATTAGGAGGTGGG - Intronic
910710524 1:90175124-90175146 AGGTGGCATTATTAGGAGGTGGG - Intergenic
911099871 1:94087129-94087151 AGATGATGGCATTAGGAGGTGGG - Intronic
911156070 1:94638127-94638149 AAGTGGTGGTATTAGGAGCTGGG + Intergenic
911381893 1:97125625-97125647 AAGTGATGGTAGTAGGAGGTAGG + Intronic
911445893 1:97991190-97991212 AAGTGTTGGCATTAGTAGGCTGG - Intergenic
911527188 1:99002206-99002228 AAGTGGTAGGTTTGGGAGGATGG - Intronic
912174082 1:107137097-107137119 ATGTGATGGTATTAGGAGGTAGG + Intergenic
912274308 1:108240410-108240432 ATGTGGTGGCATTTGGTGGTAGG - Intronic
912286959 1:108379452-108379474 ATGTGGTGGCATTTGGTGGTAGG + Intronic
912293911 1:108453913-108453935 ATGTGGTGGCATTTGGTGGTAGG + Intronic
912484287 1:110012550-110012572 AATAGTTAGCATTTGGAGGTTGG - Intronic
912632701 1:111260033-111260055 ATGTGATAGCATTAAGAGGTGGG - Intergenic
912977121 1:114341033-114341055 TAGTGGCAGTATTAAGAGGTGGG - Intergenic
913082295 1:115399802-115399824 AGGTGATAGTATTAGGAGGTGGG + Intergenic
913351496 1:117866142-117866164 AAGTGATGGCATTTGGAGGTGGG + Exonic
913355243 1:117913801-117913823 ATGTGATGGTATTAGGAGGTAGG + Intronic
913549534 1:119903835-119903857 ATGTGGTGGTATTAAGAGGTGGG + Intergenic
914062056 1:144216392-144216414 ATGTGGTGGTATTTGGAGGTGGG + Intergenic
914117094 1:144749962-144749984 ATGTGGTGGTATTTGGAGGTGGG - Intergenic
914376176 1:147075889-147075911 AAGTGTTAAAATTAGGAGGAGGG + Intergenic
914384257 1:147152607-147152629 ATGTGGTAGCCTTAGGAGCAAGG - Intergenic
914438923 1:147685533-147685555 ATGTGATAGTATTAAGAGGTAGG + Intergenic
914506929 1:148297375-148297397 AAGTGTTAAAATTAGGAGGAGGG - Intergenic
915939205 1:160107976-160107998 ATGTGATGGTATTAGGAGGTGGG - Intergenic
916247607 1:162704728-162704750 ATGTGATAGTATTAGGAAGTAGG - Intronic
916774244 1:167943664-167943686 GAGTGGAAGAATGAGGAGGTGGG - Intronic
916892228 1:169123035-169123057 AAGTGGTTACATAATGAGGTGGG - Intronic
917201596 1:172522681-172522703 AAGTGGTAGTATTTGGGGATGGG + Intergenic
917284254 1:173407870-173407892 GAGTGATGGTATTAGGAGGTGGG + Intergenic
917742332 1:177972780-177972802 ATGTGATGGTATTAGGAGGTAGG + Intronic
918025503 1:180740995-180741017 ATGTGATGGTATTAGGAGGTGGG - Intronic
918387184 1:184021355-184021377 ATGTGGTAACGTTGGGAGGTGGG + Intronic
918534189 1:185556206-185556228 ATGTGATAGTATTAAGAGGTAGG + Intergenic
918727437 1:187943451-187943473 AGGTGGTAGTATTAGAAAGTGGG + Intergenic
918807957 1:189074530-189074552 AAGTTGTAGCTTTAGTAGGAAGG - Intergenic
919001213 1:191833398-191833420 GAGGGATAGCATTAGGAGATAGG + Intergenic
919034138 1:192284168-192284190 ATGTGGTGGAATTGGGAGGTTGG + Intergenic
919066336 1:192696466-192696488 AGGTGATGGCATTAGGAAGTGGG + Intergenic
919365992 1:196661641-196661663 ATGTGATAGTATTAGGAGGTGGG - Intronic
919412738 1:197266434-197266456 ATGTGATAGTATTAAGAGGTGGG - Intergenic
919658297 1:200218495-200218517 AAGTGATAGTATTAGGATGTCGG - Intergenic
919773582 1:201178687-201178709 TTGTGGTGGTATTAGGAGGTGGG + Intergenic
920041456 1:203100366-203100388 AAGTAGAGGCATTGGGAGGTGGG + Intronic
920059491 1:203217696-203217718 CAGTGGTGGAATTTGGAGGTGGG - Intronic
920178732 1:204119506-204119528 ATGTGATAGACTTAGGAGGTGGG - Intronic
920243422 1:204570434-204570456 AGGTGATAGTATTAAGAGGTGGG - Intergenic
920747231 1:208640437-208640459 ATGTGATGGCGTTAGGAGGTGGG + Intergenic
921033137 1:211351404-211351426 ATGTGACAGTATTAGGAGGTGGG - Intronic
921045075 1:211470413-211470435 AAGTGGTAGAACTGGGAGGGAGG - Intergenic
921126489 1:212182539-212182561 GTGTGATAGTATTAGGAGGTGGG - Intergenic
921227538 1:213035203-213035225 ATGTGGTGGTATTAGAAGGTGGG - Intergenic
921235977 1:213130811-213130833 AATTGGTGGCATTAGGAAATGGG - Intronic
921655805 1:217735453-217735475 ATGTGATGGCATTTGGAGGTGGG - Intronic
921918520 1:220641273-220641295 AGGTGGTAGTATTAGAAGGCAGG + Intronic
921957473 1:220999356-220999378 AAGTGACTGCATTTGGAGGTAGG + Intergenic
922059792 1:222077400-222077422 ATGTGGCAGCAGCAGGAGGTTGG - Intergenic
922277607 1:224093556-224093578 ATGTGATAGTATTAAGAGGTGGG + Intergenic
922360381 1:224816138-224816160 ATGTGATAGTATTAAGAGGTGGG - Intergenic
922507289 1:226133905-226133927 AAGTGGAAGCAATAGGACTTGGG + Intergenic
922727480 1:227929476-227929498 AAGTGGTAGCATTAGGAGGTGGG + Intronic
922747383 1:228052122-228052144 AGGTGACAGCATTAAGAGGTAGG - Intronic
922823771 1:228503009-228503031 AGGTGATGGTATTAGGAGGTGGG - Intergenic
922860364 1:228811093-228811115 AGGTGATGGTATTAGGAGGTGGG - Intergenic
922972661 1:229755959-229755981 ATGTGATGGTATTAGGAGGTGGG - Intergenic
923096094 1:230776321-230776343 AAGTAGTAGTGTCAGGAGGTGGG - Intronic
923143836 1:231184333-231184355 AGGTGGTAGAATGAGGACGTCGG + Intronic
923210279 1:231797634-231797656 AGGTGATGGCATTAGGAGGTGGG - Intronic
923220241 1:231886170-231886192 ATGTGGCAGTGTTAGGAGGTGGG - Intronic
923953725 1:238991081-238991103 AAGTAATAGTCTTAGGAGGTGGG + Intergenic
924173594 1:241366600-241366622 AAGTGATGGTATTAGGAGATGGG + Intergenic
924330442 1:242935866-242935888 AAGTGATGGCACTAGGAGGTGGG + Intergenic
924562758 1:245170766-245170788 AAGTGATGGTAGTAGGAGGTGGG - Intronic
924803794 1:247347050-247347072 TTGTGATGGCATTAGGAGGTGGG - Intergenic
1063017040 10:2088676-2088698 AAGAGATAGCACTAGGAGGATGG + Intergenic
1063204282 10:3815912-3815934 AGGTGATCGTATTAGGAGGTGGG + Intergenic
1063781894 10:9334438-9334460 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1063967569 10:11358898-11358920 AGATGATAGCATTAGGAGGTGGG + Intergenic
1064347871 10:14548900-14548922 AAGTGACAGTATTTGGAGGTGGG + Intronic
1064634926 10:17355626-17355648 AAGTTGGAGTATTAGGAGGGAGG - Intronic
1064850537 10:19704499-19704521 AAGCGACGGCATTAGGAGGTGGG - Intronic
1065127682 10:22589959-22589981 AAGTGATGGTATTAGGAGGTGGG + Intronic
1065171533 10:23035298-23035320 ATGTGATGGCATTTGGAGGTGGG - Intronic
1065285427 10:24182938-24182960 ATGTGGTGGCATTAGGAGATGGG + Intronic
1065663101 10:28026496-28026518 CAGTGATTGCATTAGGAAGTAGG + Intergenic
1065792278 10:29271822-29271844 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1066019489 10:31283770-31283792 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1066136282 10:32449747-32449769 ATATGGTAGAATTAGGAGGTGGG + Intronic
1066198230 10:33122512-33122534 AGGTGGTAGCAGCAGGAGGTTGG - Intergenic
1066530148 10:36328772-36328794 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1066551501 10:36563469-36563491 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1067221249 10:44345892-44345914 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1067347641 10:45448124-45448146 AGGTGATGGCATTAGGAGGAGGG - Intergenic
1067537293 10:47122749-47122771 AGGTAATAGTATTAGGAGGTTGG + Intergenic
1067803109 10:49373487-49373509 AGGTGACAGCATTGGGAGGTGGG + Intronic
1067910590 10:50342909-50342931 AAGTAGTAGTAGTAGAAGGTGGG + Intronic
1068121307 10:52784679-52784701 AGGTGATAGTATTAGGAGATGGG - Intergenic
1068181436 10:53523829-53523851 ATGTGATAGCAGTAAGAGGTGGG + Intergenic
1068299631 10:55121604-55121626 ATGTGATAGTATTAAGAGGTGGG + Intronic
1068409453 10:56636105-56636127 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1068697121 10:59979770-59979792 ATGTGGTAATATTAAGAGGTGGG + Intergenic
1068863703 10:61872270-61872292 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1069036971 10:63655922-63655944 AGGTGATGGCATTAGGAGGTGGG + Intergenic
1069069639 10:63979997-63980019 ATGTGATGGCATTAAGAGGTGGG - Intergenic
1069248639 10:66242041-66242063 ATGTGGCAGCAGTAAGAGGTGGG + Intronic
1069273499 10:66560735-66560757 ATGTGATAGTATTTGGAGGTGGG + Intronic
1069377962 10:67813066-67813088 AAATGATAGTATTAGGAGATGGG + Intronic
1070061276 10:72985418-72985440 GAGTGGCAGCAGTAGTAGGTTGG - Intergenic
1070241491 10:74686355-74686377 ATGTGATAGTATTAAGAGGTGGG + Intronic
1070596853 10:77838524-77838546 AAGAGGTAGCATGGGGAGGCCGG - Intronic
1071056736 10:81520183-81520205 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1071300337 10:84251785-84251807 ATGTGATGGCATTTGGAGGTGGG - Intronic
1071388297 10:85143950-85143972 ATGTGGTGGTATTAAGAGGTGGG + Intergenic
1071457677 10:85863373-85863395 AGGTGACAGTATTAGGAGGTGGG - Intronic
1071899165 10:90100495-90100517 ATGTGATAGTATTTGGAGGTGGG - Intergenic
1072036777 10:91570118-91570140 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1072045850 10:91654122-91654144 AAGTGTGAGGATTAAGAGGTGGG - Intergenic
1072494650 10:95944924-95944946 ATGTGATAGCATTAAGGGGTAGG + Intergenic
1072601098 10:96930697-96930719 ATGTGATAGTATTAAGAGGTGGG + Intronic
1072708684 10:97701078-97701100 AGGTGGTGGTATTAGGAGGTAGG - Intergenic
1073001486 10:100289202-100289224 ATGTGATAGTATTAGGAGGTGGG + Intronic
1073080918 10:100860211-100860233 AGGTGGTGGCACTAGGAGGTGGG - Intergenic
1073383939 10:103106800-103106822 AAATGGCAGAATTAGGAGGGGGG - Intronic
1073674802 10:105633686-105633708 ATGTGATGGCATTAAGAGGTGGG + Intergenic
1073937241 10:108648129-108648151 ATGGGATAGTATTAGGAGGTGGG + Intergenic
1074466439 10:113686337-113686359 ATGTCATAGTATTAGGAGGTGGG - Intronic
1074622814 10:115143883-115143905 ACGTGATAGTATTAGTAGGTGGG - Intronic
1075002261 10:118807590-118807612 AGGTGATAGTATTAGGAGGTGGG + Intergenic
1075053181 10:119198490-119198512 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1075180447 10:120206191-120206213 AAGTGCTCTCATTAGGAGGTTGG - Intergenic
1075580715 10:123616109-123616131 ACGTGATGGTATTAGGAGGTGGG + Intergenic
1075652934 10:124141493-124141515 AGGTGATAGGATTAGGAGGTGGG - Intergenic
1075681412 10:124335499-124335521 AAGTGATGGTGTTAGGAGGTTGG - Intergenic
1075815267 10:125260209-125260231 ATGTGGTCGTATTAAGAGGTGGG - Intergenic
1076060116 10:127407444-127407466 AGGTGATAGTATTAGAAGGTGGG - Intronic
1076350845 10:129814265-129814287 AAGTGATGGCATTAAGAGGTGGG + Intergenic
1076425842 10:130367088-130367110 ATGGGATAGTATTAGGAGGTGGG + Intergenic
1077211130 11:1371440-1371462 ATGTGGTTGCATTTGGAGGTAGG - Intergenic
1078005644 11:7530419-7530441 AAGTGATGGTATTAGGAGGTGGG + Intronic
1078056679 11:8014891-8014913 AAGCGATGGTATTAGGAGGTGGG - Intergenic
1078461281 11:11516946-11516968 AGGTGGTGGTACTAGGAGGTGGG + Intronic
1078520540 11:12059659-12059681 AAGTGATGGTATTAGGAGGTAGG + Intergenic
1078837496 11:15045106-15045128 ATGTGGTAGCATTTGAAGGTAGG - Intronic
1078863979 11:15279751-15279773 AAGTGATGGTATTAAGAGGTGGG + Intergenic
1078972538 11:16430465-16430487 AAGTGATTGTATTAGAAGGTGGG + Intronic
1079147847 11:17869674-17869696 ACGTGATAGCATTAAGAGGTGGG - Intronic
1079611368 11:22436411-22436433 ATGTGATAGTATTAGGAAGTAGG - Intergenic
1079620851 11:22552190-22552212 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1080053482 11:27881186-27881208 ATGTGATGGGATTAGGAGGTAGG + Intergenic
1080260540 11:30345042-30345064 CAGTGATGGTATTAGGAGGTGGG - Intergenic
1080282231 11:30570337-30570359 AGGTGGTGGTATTAGGAGGTGGG - Intronic
1080326011 11:31074380-31074402 ATGTGATAGTATTAAGAGGTAGG + Intronic
1080412110 11:32035423-32035445 ATGTGATGGCATTAGGAGGTGGG - Intronic
1080422667 11:32125605-32125627 AGGTGATAGCATTAGAAGGTGGG + Intergenic
1080535137 11:33214213-33214235 AAGTGACAGTGTTAGGAGGTGGG - Intergenic
1080760889 11:35247828-35247850 AGGTGATAGTATTAAGAGGTGGG + Intergenic
1080792231 11:35531714-35531736 ATGTGGTGGTATTAAGAGGTGGG + Intergenic
1080801419 11:35613732-35613754 ATATGGTGGCATTAGGAGGTAGG - Intergenic
1080975719 11:37337784-37337806 AGGTGATTGTATTAGGAGGTAGG - Intergenic
1081260809 11:40957945-40957967 AGGTGATACTATTAGGAGGTGGG + Intronic
1081362960 11:42202558-42202580 ATATGATAGTATTAGGAGGTGGG - Intergenic
1081366479 11:42241464-42241486 ATGTGCTGGTATTAGGAGGTGGG - Intergenic
1081597902 11:44471861-44471883 AAATGGTAGCAACAGGAGTTGGG + Intergenic
1081598927 11:44478649-44478671 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1081695267 11:45105246-45105268 ATGTGATGGTATTAGGAGGTGGG - Intronic
1081794961 11:45812680-45812702 AGGTGACAGTATTAGGAGGTGGG - Exonic
1082777384 11:57257438-57257460 AGATGATAGTATTAGGAGGTGGG + Intergenic
1082874762 11:57977209-57977231 AGGTGGTGGTATTAGAAGGTGGG + Intergenic
1083145181 11:60752833-60752855 TCGTGATGGCATTAGGAGGTGGG - Intergenic
1083957928 11:65996684-65996706 AAGTGGTAGCTGGAGGACGTGGG + Exonic
1084759592 11:71260963-71260985 ATTTGGTGGCATTAGGAGGTGGG + Intergenic
1085482550 11:76834803-76834825 AGGTGATAGCATTAGAAGATGGG + Intergenic
1085583567 11:77678609-77678631 AGGTGATGGTATTAGGAGGTGGG + Intronic
1085654145 11:78297004-78297026 ATGTGTTGGTATTAGGAGGTGGG - Intronic
1085664629 11:78402885-78402907 AAGTGACCGTATTAGGAGGTGGG + Intronic
1085757862 11:79216523-79216545 ATGTGGTAGTGTTGGGAGGTAGG + Intronic
1086086319 11:82958428-82958450 ATGTGATAGTATTAAGAGGTGGG + Intronic
1086129962 11:83391027-83391049 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1086313722 11:85566677-85566699 AAGTGATGGTATTAGGACGTGGG - Intronic
1086541048 11:87913597-87913619 ATGTGGTGGTATTGGGAGGTGGG + Intergenic
1086572081 11:88296731-88296753 AAGTGATGGTCTTAGGAGGTGGG + Intronic
1086970448 11:93075263-93075285 AGATGATAGTATTAGGAGGTGGG + Intergenic
1087186527 11:95204522-95204544 ATGTGATGGTATTAGGAGGTGGG + Intronic
1087529370 11:99359386-99359408 AGGTGATAGTATTAGGAGGTGGG - Intronic
1087698367 11:101407264-101407286 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1087813295 11:102631643-102631665 AGGTGATAGCACTAGTAGGTGGG + Intergenic
1087814968 11:102648380-102648402 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1087923163 11:103890169-103890191 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1088119647 11:106352824-106352846 AGGTGGTGCCATTAGGAGGGTGG + Intergenic
1088130935 11:106489918-106489940 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1088144575 11:106660498-106660520 ATGTGGTGGTATTAGAAGGTAGG + Intergenic
1088364189 11:109021533-109021555 AAGTTATAGCATTAGGAGGTGGG - Intergenic
1088365672 11:109037485-109037507 AAGTGCTAGGATTAGAAGCTTGG + Intergenic
1088713417 11:112528077-112528099 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1088978295 11:114835365-114835387 GTGTGGTAGTATTGGGAGGTGGG - Intergenic
1089009478 11:115120888-115120910 AGGTGGCAGTTTTAGGAGGTGGG + Intergenic
1089093171 11:115895620-115895642 AGGTGATAGCATTAGCAGATTGG + Intergenic
1089127603 11:116187986-116188008 AAATGGGAGCATGAGGATGTAGG - Intergenic
1089659502 11:119976878-119976900 GAGTGATGGAATTAGGAGGTGGG - Intergenic
1089731070 11:120519315-120519337 AAGTGATAGTATTAGGAGGTGGG + Intronic
1089825473 11:121271942-121271964 ACGTGATAGTATTAGGAGATAGG - Intergenic
1089917241 11:122170028-122170050 ATATGGTAGTATTAAGAGGTAGG + Intergenic
1089939913 11:122405293-122405315 ATGTAGTGGCATTGGGAGGTGGG - Intergenic
1090052055 11:123388291-123388313 ATGTGGTAGTATTAAGAGGTGGG + Intergenic
1090670164 11:128940402-128940424 ATGTGCTAGCATTAAGAGGTGGG + Intronic
1090886427 11:130880922-130880944 AGGTGATGGCAGTAGGAGGTGGG + Intronic
1091310982 11:134575019-134575041 AAGTGGTGGTCTTAGAAGGTGGG + Intergenic
1091539451 12:1446034-1446056 ACGTGATGGTATTAGGAGGTGGG - Intronic
1091756064 12:3052596-3052618 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1092053034 12:5486508-5486530 AAGTGATACCATTACAAGGTAGG - Intronic
1092660129 12:10729596-10729618 AAGCGATGGCATTAGGAGATGGG - Intergenic
1092931735 12:13321946-13321968 AAGTGGTGGTATTTGGAGGTGGG + Intergenic
1093010347 12:14100933-14100955 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1093012563 12:14124484-14124506 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1093331893 12:17853777-17853799 AGGTGATGGCATTAGGAAGTGGG + Intergenic
1093394982 12:18670054-18670076 ATGGGGTGGTATTAGGAGGTAGG - Intergenic
1093480319 12:19597802-19597824 GAGTGATGGTATTAGGAGGTGGG + Intronic
1093487443 12:19666662-19666684 ACGTGGCAGCATTGAGAGGTGGG + Intronic
1093668293 12:21840983-21841005 AAGTGCTAGAATAAGAAGGTAGG - Intronic
1094027408 12:25973642-25973664 AGGTGATGGCATTTGGAGGTGGG + Intronic
1094237611 12:28186656-28186678 ATGAGATAGCGTTAGGAGGTGGG + Intronic
1094478578 12:30861767-30861789 AGGTGATAGTATAAGGAGGTAGG - Intergenic
1095120344 12:38410298-38410320 AGGTGATAGTGTTAGGAGGTGGG + Intergenic
1095315613 12:40757233-40757255 ACGTGATGGCATTAGGAGGTGGG - Intronic
1095353294 12:41240849-41240871 AGATGATAGTATTAGGAGGTGGG - Intronic
1095547519 12:43388978-43389000 AGGTGATGGTATTAGGAGGTGGG - Intronic
1095547747 12:43391262-43391284 AGGTGATGGTATTAGGAGGTAGG - Intronic
1095608640 12:44101154-44101176 ATTTGGTGGTATTAGGAGGTGGG - Intronic
1095775134 12:46002277-46002299 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1095814385 12:46405774-46405796 AAGTGGTAACATTTAAAGGTAGG + Intergenic
1096498463 12:52051775-52051797 AAGTGGAAGCTGTAGGGGGTTGG + Intronic
1096587234 12:52630647-52630669 CAGTGGTAGCCTTTGGAGGGGGG - Intergenic
1096771512 12:53938768-53938790 AGGTGGAAGCACTAGGAGGAGGG + Exonic
1097240078 12:57569119-57569141 ATATGGTGGCATTAGCAGGTGGG - Intronic
1097325577 12:58272548-58272570 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1097354807 12:58589196-58589218 AGGTGATAGTATTAGAAGGTGGG + Intronic
1097623209 12:61966462-61966484 ATGTGGTAGTATTAAGAGGTGGG - Intronic
1098327046 12:69313729-69313751 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1098471206 12:70846550-70846572 AGGTGATAGTGTTAGGAGGTGGG + Intronic
1099028502 12:77495444-77495466 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1099035309 12:77579962-77579984 AACTGGTAGCTATTGGAGGTGGG + Intergenic
1099160747 12:79238693-79238715 ATGTGGTAGCATTTGGAAGTAGG - Intronic
1099230850 12:80022919-80022941 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1099390363 12:82071675-82071697 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1099507486 12:83497576-83497598 AAGTGATGGTATTATGAGGTGGG + Intergenic
1099648460 12:85392189-85392211 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1099892112 12:88602707-88602729 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1100013713 12:89983674-89983696 AAATGGTGGTATTAGAAGGTAGG + Intergenic
1100134031 12:91533049-91533071 ATGTGGTGGTATTAGAAGGTGGG + Intergenic
1100288067 12:93186708-93186730 AAGTGATGGTATTAAGAGGTGGG + Intergenic
1100379295 12:94046821-94046843 ATGTGATAACATTAAGAGGTGGG - Intergenic
1100476529 12:94940463-94940485 ATGTGATGGTATTAGGAGGTAGG + Intronic
1100712152 12:97269085-97269107 AGGTGATAGGATTAGGAGATGGG - Intergenic
1100866805 12:98866074-98866096 AAGTGATGGTATTAGGAGGTGGG - Intronic
1100901940 12:99251111-99251133 AAGTGATGGTAATAGGAGGTGGG - Intronic
1100969788 12:100056132-100056154 AAGTGATAGTACTAAGAGGTAGG + Intronic
1101022407 12:100566509-100566531 AATTGATAGTATTAGGAGGTAGG - Intergenic
1101051830 12:100871860-100871882 ATGTGATGACATTAGGAGGTAGG - Intronic
1101385034 12:104249317-104249339 AAGTGACAGCATTAGAAGGAGGG - Intronic
1101860854 12:108481359-108481381 AGGTGATGACATTAGGAGGTAGG + Intergenic
1102559526 12:113752416-113752438 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1102799448 12:115718701-115718723 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1103171632 12:118825460-118825482 ATGTGGTGGTATTAAGAGGTGGG - Intergenic
1103272231 12:119682969-119682991 ATGTGATAGTATTAAGAGGTAGG + Intergenic
1103300992 12:119926586-119926608 ATGTGATAGTATTTGGAGGTGGG + Intergenic
1103393850 12:120592958-120592980 AAGTGATGGCATTAGGAGGTGGG + Intergenic
1103441068 12:120963526-120963548 AGGTGGTGGTATTAAGAGGTGGG - Intergenic
1103449438 12:121018113-121018135 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1103679405 12:122681397-122681419 AAATGATAGGATTAGGAGGCAGG + Intergenic
1103895873 12:124272792-124272814 ATGTGATGGCATTAGGAGGTGGG + Intronic
1104002898 12:124871766-124871788 ATGTGATGGTATTAGGAGGTAGG + Intronic
1104025153 12:125020458-125020480 AAGTGATGGTCTTAGGAGGTGGG - Intronic
1104110028 12:125696139-125696161 ATGTGATGGTATTAGGAGGTTGG - Intergenic
1104407039 12:128526477-128526499 AGGTGTTGGCTTTAGGAGGTGGG - Intronic
1104670347 12:130675908-130675930 AGGTGGTGGCATCAGCAGGTGGG + Intronic
1104695711 12:130862218-130862240 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1104703251 12:130923395-130923417 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1104796536 12:131523922-131523944 AAGTGGTGTCATTAGGAGGTGGG + Intergenic
1104805220 12:131585723-131585745 AGGTGATAGTTTTAGGAGGTGGG + Intergenic
1105370882 13:19800993-19801015 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1105430688 13:20334550-20334572 CAGTGGTGGCAGTGGGAGGTGGG - Intergenic
1105641252 13:22267470-22267492 ATGTGACAGCATTAGGAGGTGGG - Intergenic
1105716855 13:23075002-23075024 AGGTGATGGCATTAGGAGGTAGG - Intergenic
1106051968 13:26199863-26199885 ATGTGATAGTATTAGGAAGTGGG + Intronic
1106173039 13:27305412-27305434 AAGGTTTAGCTTTAGGAGGTTGG + Intergenic
1106305865 13:28508738-28508760 ATGTGACAGTATTAGGAGGTGGG - Intergenic
1106346420 13:28883664-28883686 AAGGGGTAGCAGGAGGAGGCAGG + Intronic
1106697420 13:32191835-32191857 AGGTGGTGGTATTTGGAGGTGGG - Intronic
1106894843 13:34288903-34288925 AAGTGATGGTATTTGGAGGTGGG - Intergenic
1107474326 13:40720739-40720761 ATGTGGCAGCATTGAGAGGTGGG - Intergenic
1107572002 13:41671588-41671610 ATATGATAGTATTAGGAGGTGGG + Intronic
1107677118 13:42808962-42808984 AAGCGATGGTATTAGGAGGTGGG + Intergenic
1107948791 13:45443695-45443717 ATGTAATAGTATTAGGAGGTGGG + Intergenic
1108134940 13:47346011-47346033 AAATGTTGGTATTAGGAGGTTGG + Intergenic
1108152557 13:47551302-47551324 ATGTGGTGGTATTAGGAGGTGGG - Intergenic
1108259625 13:48643904-48643926 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1108710029 13:53024256-53024278 AAGTGATGGAATCAGGAGGTAGG - Intergenic
1109085493 13:57966222-57966244 AAGTGATGGTATTAAGAGGTAGG + Intergenic
1109179748 13:59199632-59199654 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1109517291 13:63460289-63460311 ATGAGATGGCATTAGGAGGTGGG - Intergenic
1109627084 13:64988827-64988849 ATGTAGTGGTATTAGGAGGTGGG - Intergenic
1109796976 13:67328160-67328182 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1109958197 13:69596751-69596773 CAGTGGTAGCCTTTGGTGGTGGG - Intergenic
1110027536 13:70560228-70560250 ATGTGGTAGTGTTGGGAGGTAGG + Intergenic
1110145132 13:72181214-72181236 ATGTAATAGCATTGGGAGGTGGG + Intergenic
1110262516 13:73501353-73501375 ATGTGATGGCATTAGGAGGTGGG + Intergenic
1110351602 13:74515139-74515161 AAGTGATGGTATTAGGGGGTGGG + Intergenic
1110381890 13:74861909-74861931 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1110455593 13:75687004-75687026 ATGTGACAGTATTAGGAGGTAGG - Intronic
1110539263 13:76689443-76689465 GTGTGATAGCATTAGGAGTTGGG - Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1110744721 13:79039049-79039071 AAGTGATGGTATTAGGAGGTAGG - Intergenic
1110817259 13:79875891-79875913 ATGTGATAGTATTAGGAGGTAGG - Intergenic
1110844247 13:80175741-80175763 ATGTGACAGAATTAGGAGGTGGG - Intergenic
1110900111 13:80811595-80811617 AAGTGATGGTAATAGGAGGTGGG + Intergenic
1110931377 13:81222857-81222879 AGGTGGTGGCATTAGGAAGTAGG + Intergenic
1111889133 13:94059844-94059866 AAGTGATGGTATTAGGAGGTGGG - Intronic
1111910185 13:94302423-94302445 ATGTGATGGAATTAGGAGGTAGG - Intronic
1112187220 13:97138801-97138823 AAGTTTGAGCATTAAGAGGTAGG + Intergenic
1112423238 13:99272763-99272785 ATGTGGTGGTATTTGGAGGTAGG - Intronic
1112608023 13:100927189-100927211 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1112719750 13:102230037-102230059 AGGTGATGGTATTAGGAGGTGGG + Intronic
1112996165 13:105577482-105577504 AAGTGATAGTATTAAGTGGTGGG - Intergenic
1113191925 13:107758912-107758934 AAGTCTTATCATTTGGAGGTAGG - Intronic
1113233082 13:108237298-108237320 AAGCAGTGGTATTAGGAGGTGGG + Intergenic
1113284471 13:108831141-108831163 AAGTGATAGCATTAAGAAGTAGG - Intronic
1113298933 13:108995348-108995370 AAGTGATGGGATTAGAAGGTGGG - Intronic
1113374421 13:109750926-109750948 AAGTGCTGGTATTAGGAGGTGGG + Intergenic
1113389071 13:109878402-109878424 AGGTGATGGAATTAGGAGGTAGG + Intergenic
1113525447 13:110971352-110971374 TAGTGATAACATTAAGAGGTGGG - Intergenic
1113526191 13:110979549-110979571 ATCTGGTAGTATTAAGAGGTGGG + Intergenic
1113548271 13:111171791-111171813 AGGTGACAGTATTAGGAGGTGGG + Intronic
1114259879 14:21028879-21028901 AAGTGGTGGCATTATTAGATGGG + Intronic
1114808938 14:25872957-25872979 ATGTGGTAGTATTAAGAAGTGGG - Intergenic
1114836575 14:26210234-26210256 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1115300035 14:31875046-31875068 AGGTGATAGTATCAGGAGGTGGG + Intergenic
1115355367 14:32440910-32440932 ATGTGATAGTATTAAGAGGTGGG + Intronic
1115570411 14:34661241-34661263 AAGTGATAGTATTAGGAGATGGG + Intergenic
1115658532 14:35467189-35467211 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1115712448 14:36065940-36065962 AGGTGATAATATTAGGAGGTGGG + Intergenic
1115720012 14:36150219-36150241 AGATGATAGTATTAGGAGGTGGG + Intergenic
1115946619 14:38668545-38668567 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1115965653 14:38884669-38884691 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1115977051 14:39008249-39008271 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1116258568 14:42589830-42589852 AAGTGATAGAATTAGGAGTAGGG - Intergenic
1116303088 14:43211486-43211508 AGATGATAGTATTAGGAGGTGGG + Intergenic
1116425480 14:44784998-44785020 AAGTGATGGTTTTAGGAGGTGGG + Intergenic
1116433933 14:44876151-44876173 AAGTGATGATATTAGGAGGTGGG - Intergenic
1116438034 14:44915833-44915855 AAATGATGGCATTAGGAGGTGGG + Intergenic
1116582245 14:46656884-46656906 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1117144908 14:52827633-52827655 AGGTGATGGCATTAGGAGGTGGG + Intergenic
1117303653 14:54452163-54452185 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1117435159 14:55708829-55708851 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1117816704 14:59606383-59606405 ATGTGATAGTGTTAGGAGGTGGG + Intronic
1117998290 14:61498786-61498808 ATGTGATAGCATTTGGAGGTAGG - Intronic
1118024964 14:61759775-61759797 ATGTGATAGCATTAAGAGGTAGG + Intergenic
1118050904 14:62026562-62026584 AAGTGGTAGTATTAAGAGGTGGG - Intronic
1119035435 14:71226550-71226572 ATGTGATAGTATTGGGAGGTAGG - Intergenic
1119177817 14:72582179-72582201 ATATGGTGGCATTGGGAGGTAGG - Intergenic
1119537214 14:75412307-75412329 AAGTGATGGTATTAGGAAGTAGG + Intergenic
1119680111 14:76585720-76585742 AAGTGATGACATTAGGAGGCGGG - Intergenic
1119840719 14:77790852-77790874 CAGTGGTAGCATGAGCAGATGGG - Intergenic
1119867373 14:77985167-77985189 AGGTGGCATCATTAGGATGTTGG + Intergenic
1120498931 14:85269801-85269823 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1121151028 14:91635198-91635220 AGGTGGTAGTATTAGGAGGTGGG - Intronic
1121164392 14:91777891-91777913 AGATGATAGTATTAGGAGGTGGG - Intronic
1121187725 14:91991092-91991114 ATGTGGCAGTATTGGGAGGTAGG + Intronic
1121300191 14:92863974-92863996 AAGTAATGGCATTTGGAGGTGGG - Intergenic
1121393593 14:93597820-93597842 ATATGATAGTATTAGGAGGTGGG - Intronic
1121549761 14:94789982-94790004 ATGCAGTAGCATTAAGAGGTGGG + Intergenic
1121625284 14:95380941-95380963 AACTGATGGTATTAGGAGGTGGG + Intergenic
1121788394 14:96680216-96680238 AGGAGATAGTATTAGGAGGTGGG + Intergenic
1121875753 14:97450023-97450045 AAGTGATGGTATTAGGAAGTTGG - Intergenic
1121881182 14:97501582-97501604 AGGTGATAGTTTTAGGAGGTGGG + Intergenic
1122285166 14:100646975-100646997 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1122376348 14:101262121-101262143 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1122438443 14:101714016-101714038 ATGTGGCAGTATTGGGAGGTGGG + Intergenic
1122494860 14:102145902-102145924 AAGTGGTAACTACAGGAGGTAGG + Intronic
1122730128 14:103790402-103790424 ATGTGGTAATATTAGGAGGTGGG + Intronic
1122911283 14:104829062-104829084 AAGTGATGGTATTAAGAGGTAGG + Intergenic
1123015490 14:105372015-105372037 AGGTGCTAGAATTAGGAAGTGGG - Intronic
1123416161 15:20097091-20097113 ATGTGGTAGTATTAAGAGGTGGG + Intergenic
1123525501 15:21104196-21104218 ATGTGGTAGTATTAAGAGGTGGG + Intergenic
1123662415 15:22575897-22575919 ATGTGGCAGTATTAGGAGATGGG - Intergenic
1123710978 15:22987513-22987535 AGATGATGGCATTAGGAGGTGGG + Intronic
1123963739 15:25435478-25435500 AGGTGATAGTATTAAGAGGTGGG + Intronic
1123993603 15:25702966-25702988 GTGTGGTAGTATTAGGATGTGGG + Intronic
1124047404 15:26162929-26162951 AGGAGGTAGTATTGGGAGGTGGG - Intergenic
1124193118 15:27597709-27597731 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1124261874 15:28200003-28200025 ATGTGGCAGTATTAGGAGATGGG + Intronic
1124316215 15:28670181-28670203 ATGTGGCAGTATTAGGAGATGGG - Intergenic
1124362150 15:29045462-29045484 GTGTGATGGCATTAGGAGGTGGG - Intronic
1124465900 15:29939676-29939698 AAGTGATGGTATTAGGAGGTGGG + Intronic
1124572569 15:30878559-30878581 ATGTGATGGCATTGGGAGGTGGG + Intergenic
1124857756 15:33407209-33407231 CAGTGGTGGTATTAAGAGGTGGG - Intronic
1125136164 15:36345756-36345778 ATGTGGTAGTATTAAGAGATGGG + Intergenic
1125153783 15:36563322-36563344 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1125307275 15:38333042-38333064 ATATGATAGTATTAGGAGGTGGG - Intronic
1125395504 15:39243275-39243297 AGGTGATGGCATCAGGAGGTAGG - Intergenic
1125441819 15:39711390-39711412 AGGTGATGGGATTAGGAGGTGGG - Intronic
1126764761 15:52001043-52001065 ATGTGATAGCATTAAGAGGTGGG + Intronic
1127492247 15:59476178-59476200 ATGTGATGGTATTAGGAGGTGGG - Intronic
1127503439 15:59575928-59575950 AGGTGATAGTATTAGGAGGTTGG - Intergenic
1127733207 15:61818960-61818982 ATGTGGTGGTATTTGGAGGTGGG + Intergenic
1127985010 15:64062441-64062463 AAGTGATGGTATTCGGAGGTGGG - Intronic
1128393731 15:67201900-67201922 AAGTGGGAGCACTAAGGGGTGGG - Exonic
1128728203 15:70003253-70003275 AAGTAACAGCATTGGGAGGTGGG + Intergenic
1129063232 15:72878327-72878349 AAATGGTAGCATTAAGAGGTGGG - Intergenic
1129580487 15:76803772-76803794 ATGTGATAGTATTAAGAGGTGGG - Intronic
1129637281 15:77333841-77333863 AAGGAGTAGCATTATGAAGTTGG - Intronic
1129921930 15:79326710-79326732 AGGTGATGGTATTAGGAGGTGGG + Intronic
1130121222 15:81049230-81049252 AGATGATAGTATTAGGAGGTGGG + Intronic
1130177747 15:81592769-81592791 ATGTGATCGTATTAGGAGGTGGG + Intergenic
1130331687 15:82927057-82927079 ATGTGATGGTATTAGGAGGTGGG - Intronic
1130706897 15:86241716-86241738 ATGTGATAGTATTAAGAGGTGGG - Intronic
1130845716 15:87743252-87743274 ATGGGATAGTATTAGGAGGTGGG + Intergenic
1131037439 15:89232542-89232564 AAGAGATAGTATTAGGAGGCAGG + Intergenic
1131132190 15:89907419-89907441 ATGTGATAGTATTAAGAGGTGGG + Intronic
1131345188 15:91640266-91640288 AGGTGATGGTATTAGGAGGTAGG - Intergenic
1131365143 15:91832757-91832779 ATATGATAGTATTAGGAGGTGGG + Intergenic
1131475553 15:92735637-92735659 AAGTGATAGTATCAAGAGGTGGG - Intronic
1131960410 15:97784583-97784605 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1132016813 15:98325012-98325034 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1132034368 15:98469035-98469057 AAGTGATAGTATTAAGAGATAGG + Intronic
1132347601 15:101117906-101117928 GTGTGGTAGTATTAAGAGGTGGG + Intergenic
1132347692 15:101118432-101118454 ATGTGGTAGTATTAAGAGGTGGG - Intergenic
1133191710 16:4138670-4138692 AGGTGATAGTGTTAGGAGGTGGG + Intergenic
1133537600 16:6716902-6716924 ATGTGATGGTATTAGGAGGTGGG + Intronic
1133707639 16:8370304-8370326 ATATGATAGCATTTGGAGGTCGG - Intergenic
1133924902 16:10184079-10184101 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1134638543 16:15811030-15811052 AAGTGATGATATTAGGAGGTGGG + Intronic
1134902756 16:17953455-17953477 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1135060080 16:19263957-19263979 AAGTGATGGCATTAGGAGGCGGG + Intronic
1135355770 16:21767837-21767859 AAGTGGGAGCATTGAGAGGTGGG - Intergenic
1135454260 16:22583983-22584005 AAGTGGGAGCATTGAGAGGTGGG - Intergenic
1135578587 16:23605783-23605805 ATGTGATGGTATTAGGAGGTGGG + Intronic
1135819864 16:25674384-25674406 ACGTGGTGGTATTGGGAGGTGGG + Intergenic
1135981457 16:27150715-27150737 AAGTGATGGGATTAGGAGGTGGG - Intergenic
1136283450 16:29228009-29228031 AAGTGATGGGATTAGGAGGTGGG - Intergenic
1137600221 16:49751451-49751473 AAGTGCTAGGATTACAAGGTGGG - Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1137781479 16:51101232-51101254 AAGTGATGGTCTTAGGAGGTGGG + Intergenic
1138646466 16:58429048-58429070 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1138647380 16:58435022-58435044 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1138709601 16:58955201-58955223 AAGTGATAGTGTTAAGAGGTGGG - Intergenic
1139054547 16:63166656-63166678 AGGTGATAGCATTAGGAGATGGG + Intergenic
1139093452 16:63676734-63676756 ATGTGATGGTATTAGGAGGTCGG + Intergenic
1139320047 16:66107022-66107044 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1139434624 16:66928879-66928901 GAGTGGGAGCAATAGGAGTTGGG + Intergenic
1139674762 16:68515851-68515873 ATGTGATTGTATTAGGAGGTGGG - Intergenic
1140067057 16:71620549-71620571 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1140645962 16:77030030-77030052 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1140716735 16:77733469-77733491 AGGTGATGGTATTAGGAGGTGGG - Intronic
1141439716 16:84022063-84022085 ATGTGGTAGCATTGAGACGTGGG - Intronic
1141457632 16:84154416-84154438 ATGTGATGGTATTAGGAGGTGGG - Intronic
1142087876 16:88193959-88193981 AAGTGATGGGATTAGGAAGTGGG - Intergenic
1143880695 17:10027468-10027490 ACATGGTAGGATTAAGAGGTGGG + Intronic
1144385004 17:14741243-14741265 AGGTGATGGCATTAGGAGGTGGG - Intergenic
1145102525 17:20088804-20088826 ATGTGATAGGATTAAGAGGTGGG + Intronic
1146383345 17:32347784-32347806 ATGTGATAGCATTAAGAGTTGGG - Intronic
1147412798 17:40265667-40265689 GAGTGGTAGGACTTGGAGGTTGG + Intronic
1148801278 17:50227954-50227976 AAGTGATAGTATTAGGAGGTGGG + Intergenic
1148957039 17:51362519-51362541 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1149561535 17:57611212-57611234 AAGGGGAAGTCTTAGGAGGTGGG + Intronic
1149628765 17:58101927-58101949 ATGTGATAAGATTAGGAGGTGGG - Intergenic
1150032358 17:61752972-61752994 ATGTGGCAGCATTGAGAGGTGGG + Intronic
1150189424 17:63222233-63222255 AGGTGATGGTATTAGGAGGTAGG - Intronic
1150811596 17:68361196-68361218 ATGGGGTGGTATTAGGAGGTGGG + Intronic
1151112776 17:71698732-71698754 ACATGGTAGTATCAGGAGGTAGG + Intergenic
1151265199 17:72949679-72949701 CAGTGATTGTATTAGGAGGTGGG - Intronic
1151617938 17:75226567-75226589 ATGTGATAGTATTAAGAGGTAGG - Intronic
1151788807 17:76290721-76290743 GAGCAGTAGCATTGGGAGGTGGG - Intronic
1152428937 17:80236740-80236762 ATGTGGCAGCATAAGCAGGTGGG - Intronic
1153073781 18:1138053-1138075 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1153418056 18:4872231-4872253 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1153720094 18:7892936-7892958 AAATGGTGGTATTAGGAGGTGGG - Intronic
1153923505 18:9812175-9812197 ACGTGGCGGTATTAGGAGGTGGG - Intronic
1154495949 18:14961271-14961293 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1154498587 18:14980900-14980922 GTGTGGCAGCATTGGGAGGTGGG + Intergenic
1155343933 18:24839992-24840014 AGGTGGTAGTATTAGGAGGTGGG + Intergenic
1155579968 18:27293036-27293058 ATGTGCTAGTATTAAGAGGTGGG + Intergenic
1155587823 18:27388192-27388214 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1155728053 18:29114615-29114637 ATGTGATAGTATTAGAAGGTGGG + Intergenic
1155829860 18:30500551-30500573 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1155899244 18:31367625-31367647 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1156612987 18:38749678-38749700 AAGTGATGGTATTAAGAGGTGGG - Intergenic
1156640974 18:39098282-39098304 TTGTGGTGGCATTAGGAGGTGGG - Intergenic
1156729576 18:40175276-40175298 AAGTGATGGTATTAGGAGGCAGG - Intergenic
1157042537 18:44057828-44057850 ATGTGATGGCATTAGGAGGTTGG - Intergenic
1157437354 18:47682135-47682157 AAGGGATAGTGTTAGGAGGTGGG - Intergenic
1157532999 18:48438217-48438239 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1157641936 18:49224509-49224531 AGGTGATGGTATTAGGAGGTGGG + Intronic
1157771887 18:50356209-50356231 ATGTGGTAGTGTTGGGAGGTGGG + Intergenic
1158121239 18:54050338-54050360 ATGTGATAGGATTAAGAGGTGGG - Intergenic
1158259643 18:55592527-55592549 ATGTGCTAGTATTAGGAGGTGGG - Intronic
1158420801 18:57291885-57291907 ATGTGATAGTATTAAGAGGTAGG + Intergenic
1158429436 18:57371926-57371948 AATTGGAAGCATTATTAGGTTGG - Intergenic
1158429820 18:57375335-57375357 AGGTGATAGTATTAGGAGATGGG + Intergenic
1158494977 18:57946840-57946862 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1158789223 18:60755848-60755870 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1158980439 18:62755457-62755479 AGGTGATAGTTTTAGGAGGTGGG + Intronic
1159248358 18:65839470-65839492 AGGTGATGCCATTAGGAGGTGGG - Intronic
1159807992 18:72978705-72978727 ATGTGATAGCATTTGAAGGTAGG - Intergenic
1160609933 18:80077010-80077032 ATGTGATAGTATTAAGAGGTGGG - Intronic
1160963788 19:1736689-1736711 AGGTGGTGGCAGTTGGAGGTGGG + Intergenic
1161748251 19:6074935-6074957 AGGCAGTAGCTTTAGGAGGTGGG + Intronic
1161914858 19:7220863-7220885 ATGTGGCAGCATTGAGAGGTGGG + Intronic
1162165035 19:8746751-8746773 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162166101 19:8754202-8754224 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162167167 19:8761658-8761680 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162169176 19:8775414-8775436 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162169856 19:8780725-8780747 AAGCGGAGGTATTAGGAGGTGGG + Intergenic
1162170918 19:8788184-8788206 ATGTGGCGGTATTAGGAGGTGGG + Intergenic
1162287841 19:9753156-9753178 AAGTGATTGTATTAGGAGCTGGG - Intronic
1162513225 19:11132337-11132359 AAGTGGAAGCACTAGGTGGGCGG - Intronic
1163336520 19:16675903-16675925 TTGTGATAGCATTAGGAGGTCGG - Intronic
1164529414 19:29036806-29036828 CAGTGGCAGCATTAGGTGGTTGG - Intergenic
1164954843 19:32373296-32373318 AAGGGATAGTATTAAGAGGTGGG - Intronic
1164962239 19:32443402-32443424 AGGTGATTGTATTAGGAGGTAGG + Intronic
1164972281 19:32542836-32542858 AAGTGATGGTATGAGGAGGTGGG + Intergenic
1165127528 19:33610800-33610822 ATGTGGTGGCATTGGGAGGTGGG - Intergenic
1165620048 19:37238163-37238185 ATGTGATAGTATTAAGAGGTGGG - Intronic
1165882824 19:39055668-39055690 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1167735095 19:51289520-51289542 AAGTGATCGTATTTGGAGGTGGG - Intergenic
1168519117 19:57034566-57034588 AGGTGGAGGTATTAGGAGGTGGG + Intergenic
925038463 2:710577-710599 AAGTGATGGTATTAGGAGGTGGG + Intergenic
925320188 2:2960145-2960167 AGGTAATGGCATTAGGAGGTGGG - Intergenic
925642481 2:5999278-5999300 ATGTGATGGTATTAGGAGGTGGG - Intergenic
925799385 2:7583109-7583131 AACTGATGGTATTAGGAGGTGGG - Intergenic
925833815 2:7923223-7923245 AAGTGGTGGTATTAGGAGGTGGG - Intergenic
925880660 2:8349734-8349756 ATGTGATGGTATTAGGAGGTGGG - Intergenic
926097201 2:10089345-10089367 GTGTGTTGGCATTAGGAGGTGGG + Intergenic
926344552 2:11933351-11933373 AGGGGATAGTATTAGGAGGTGGG - Intergenic
926442323 2:12902805-12902827 ATGTGGCAGTATTAAGAGGTGGG - Intergenic
926573325 2:14553706-14553728 ATGTGATGGTATTAGGAGGTGGG + Intergenic
926589632 2:14726602-14726624 ATGTGGCAGTATTGGGAGGTAGG - Intergenic
926834782 2:17006373-17006395 ATGTGATAGTATTAGGAAGTTGG - Intergenic
927119017 2:19936597-19936619 TTGTGGTAGTATTAAGAGGTGGG + Intronic
928054105 2:28033613-28033635 ATGTGGCAGTATTAAGAGGTGGG - Intronic
928168073 2:28985079-28985101 ATGTGTTGGTATTAGGAGGTGGG + Intronic
928439997 2:31284431-31284453 ATGTGATGGTATTAGGAGGTGGG + Intergenic
928441352 2:31294898-31294920 ATATGGTAGTATTTGGAGGTAGG + Intergenic
928611790 2:32998633-32998655 ATGTGATGGTATTAGGAGGTGGG + Intronic
928653095 2:33422471-33422493 AAGTGATGGGATTAGAAGGTGGG + Intergenic
928767620 2:34666455-34666477 AGGTGATAGTATTAGGAAGTGGG + Intergenic
929448160 2:42016411-42016433 AGGTGATGGTATTAGGAGGTGGG - Intergenic
929850259 2:45581243-45581265 ATGTGAGAGCATAAGGAGGTAGG - Intronic
930100428 2:47598998-47599020 AGTTGATAGTATTAGGAGGTGGG + Intergenic
930194855 2:48499075-48499097 AGGTGATGGTATTAGGAGGTAGG - Intronic
930426749 2:51222542-51222564 ATGTGATAGTATTTGGAGGTGGG - Intergenic
930605932 2:53493066-53493088 AAGTGATTGTATTTGGAGGTGGG + Intergenic
930878463 2:56245711-56245733 ATGTGATGGTATTAGGAGGTGGG + Intronic
930985135 2:57576461-57576483 AGATGATAGTATTAGGAGGTGGG - Intergenic
931269614 2:60689842-60689864 AATTGATAGTATTAAGAGGTGGG + Intergenic
932012056 2:67988489-67988511 AGGTGATGGTATTAGGAGGTTGG - Intergenic
932299146 2:70653100-70653122 ATGTGATTGTATTAGGAGGTGGG + Intronic
932362270 2:71118726-71118748 AAGTGATGGTGTTAGGAGGTGGG - Intronic
932472469 2:71969681-71969703 ACGTGGTAGTATCAAGAGGTAGG + Intergenic
932588704 2:73049628-73049650 ATGTGATAGTATTAAGAGGTGGG - Intronic
932589015 2:73051940-73051962 ATGTGATAGTATTAAGAGGTGGG - Intronic
932711834 2:74071246-74071268 ATGGGATAGCATTTGGAGGTAGG - Intronic
932784761 2:74590386-74590408 AATAGATAGTATTAGGAGGTGGG - Intronic
932967236 2:76491069-76491091 AAGTGGCAAAATTAGTAGGTAGG + Intergenic
933057418 2:77689544-77689566 GGGTGATAGTATTAGGAGGTGGG + Intergenic
933180648 2:79222768-79222790 ATGTGATGGCATTAGGAGGTGGG + Intronic
933290880 2:80436958-80436980 GAGTGATAGTATTAAGAGGTGGG + Intronic
933421767 2:82056443-82056465 AAGTGGTAGCATCAGGTATTTGG - Intergenic
933505686 2:83174593-83174615 AGGTGATATTATTAGGAGGTTGG - Intergenic
933927556 2:87110734-87110756 GGGTGATAGTATTAGGAGGTGGG + Intergenic
933993774 2:87652573-87652595 CAGTGAGGGCATTAGGAGGTGGG - Intergenic
934014254 2:87862254-87862276 ATGTGATGGTATTAGGAGGTAGG + Intergenic
934087261 2:88520275-88520297 ATGTGGCAGCATTGAGAGGTGGG - Intergenic
934172381 2:89551717-89551739 ATGTGGTGGTATTTGGAGGTGGG + Intergenic
934282694 2:91626069-91626091 ATGTGGTGGTATTTGGAGGTGGG + Intergenic
934546721 2:95223903-95223925 AGGTGATGGCATTAGGAGATGGG + Intronic
934797023 2:97110179-97110201 ATGTGATAGTATTAAGAGGTGGG - Intergenic
934836389 2:97593247-97593269 ATGTGATAGTATTAAGAGGTGGG + Intergenic
935063656 2:99629899-99629921 ATGTGATAGTATTAGGAGGTGGG - Intronic
935448443 2:103181488-103181510 ATGTGATGGTATTAGGAGGTGGG - Intergenic
935495658 2:103777600-103777622 AAGTGGTGGTATTGGGAGGTGGG + Intergenic
935608434 2:104994925-104994947 ATGTGATAGTATTAGAAGGTAGG - Intergenic
935643196 2:105309817-105309839 GAGTGGTAGTGTTGGGAGGTGGG + Intronic
935685291 2:105677660-105677682 ATGTGATAGTATTAGGAGGTGGG + Intergenic
935740668 2:106144838-106144860 CAGTGATGGTATTAGGAGGTGGG - Intronic
935745249 2:106184710-106184732 AAGTGATGGCATTAAGAGGTGGG - Intronic
935758113 2:106293392-106293414 ATGTGATGGTATTAGGAGGTGGG + Intergenic
936087277 2:109477833-109477855 GTGTGATAGCCTTAGGAGGTGGG - Intronic
936300089 2:111298310-111298332 CAGTGAGGGCATTAGGAGGTGGG + Intergenic
936396704 2:112137251-112137273 AGATGATGGCATTAGGAGGTGGG + Intergenic
937253116 2:120536516-120536538 AGGTGATGGTATTAGGAGGTGGG + Intergenic
937420262 2:121748266-121748288 AAGTGATGTTATTAGGAGGTAGG + Intronic
937473767 2:122195977-122195999 ATGTGGTAGTATTTGGAGGTAGG + Intergenic
937506261 2:122540801-122540823 AAGTTGTGGTATTAGGAGCTGGG + Intergenic
937615788 2:123920840-123920862 ACATGGTAGTTTTAGGAGGTGGG - Intergenic
937653197 2:124344103-124344125 ATGTGTTTGCATTGGGAGGTGGG - Intronic
938928661 2:136066912-136066934 AAGTGATGGTATTAGGAGGTGGG + Intergenic
938989751 2:136615752-136615774 ATGTGATAGTATTAAGAGGTGGG + Intergenic
939489984 2:142865743-142865765 AGGAGGTGGTATTAGGAGGTGGG - Intergenic
939566926 2:143796181-143796203 ATGTGATAGCATTAAGAGGTGGG + Intergenic
939795041 2:146632744-146632766 AGGTGATAGTGTTAGGAGGTGGG - Intergenic
940191366 2:151043594-151043616 ATGTAGCAGCATTGGGAGGTAGG + Intronic
940307228 2:152239571-152239593 AAGTGATCGTATTAGGAGGTAGG + Intergenic
940371431 2:152905340-152905362 ATGTGATAGTATTAAGAGGTAGG - Intergenic
940411420 2:153368200-153368222 AAGTGGTGGTATTAGGAGGTGGG + Intergenic
940718579 2:157257114-157257136 ATGTGATAGTATTAGGAGGTAGG - Intergenic
941349873 2:164418881-164418903 AGGTGATGGCATTAGGACGTGGG - Intergenic
941364180 2:164590052-164590074 ATGTGATGGCATTAGGATGTGGG - Intronic
941709454 2:168696776-168696798 AAGTGATAGTATTAGGACATGGG - Intronic
941807189 2:169721584-169721606 ATGTGATAGCATTAAGAGGGAGG + Intronic
941966220 2:171303578-171303600 AAGTGATGGTATTAGAAGGTGGG + Intergenic
942151980 2:173085404-173085426 AAGTGGAAACATAAGAAGGTAGG - Intronic
942225082 2:173807922-173807944 AGGTGATAGTATTAGGAGGTGGG - Intergenic
942287349 2:174433574-174433596 ATGTGTTAGTATTAGGAGGTAGG + Exonic
942513064 2:176723169-176723191 AAGTAATAGTATTAAGAGGTGGG + Intergenic
942650218 2:178158524-178158546 AAGTGATAGTATTTGGAGGTGGG - Intergenic
942796293 2:179824094-179824116 AACTTGTACCCTTAGGAGGTAGG - Intronic
942812714 2:180017520-180017542 AGGTGATGGTATTAGGAGGTGGG + Intergenic
942888386 2:180956782-180956804 ATGTGATAGTATTTGGAGGTTGG + Intergenic
942906280 2:181184554-181184576 ATGAGGTAGTATTAAGAGGTGGG + Intergenic
943044638 2:182845404-182845426 AACTTGTGCCATTAGGAGGTTGG - Intronic
943212571 2:184987209-184987231 AAGTGGTGGCATTGAGAGGTGGG + Intergenic
943389330 2:187244157-187244179 ATGTGATGGTATTAGGAGGTGGG - Intergenic
943517226 2:188904304-188904326 AGGTAATGGCATTAGGAGGTGGG + Intergenic
943623518 2:190175851-190175873 ATGTGATAGGATTAAGAGGTAGG + Intronic
943624239 2:190180854-190180876 AAGTGGCAGCATGTGGAGGACGG - Exonic
943660107 2:190550417-190550439 AGGTGATAGTATTAGGAGGTAGG - Intergenic
943734786 2:191342344-191342366 AAAAGCTAGTATTAGGAGGTGGG - Intronic
943831496 2:192469064-192469086 AAGTGGTAGCATTGGAAATTAGG - Intergenic
943944074 2:194036144-194036166 AAGTGATGGTGTTAGGAGGTGGG + Intergenic
943990258 2:194680600-194680622 AGGTGATGGTATTAGGAGGTAGG - Intergenic
944154636 2:196596449-196596471 ATGTGATGGTATTAGGAGGTGGG + Intergenic
944840719 2:203621287-203621309 AAGTAATAGTATTAAGAGGTAGG + Intergenic
944965467 2:204927241-204927263 AGGTGTTAGTATTAAGAGGTAGG + Intronic
945007799 2:205428019-205428041 GCGTGATAGTATTAGGAGGTGGG + Intronic
945158071 2:206860080-206860102 ATGTGGTAGTATTGAGAGGTGGG + Intergenic
945568525 2:211434308-211434330 AAGTGATGGTGTTAGGAGGTGGG + Intronic
945762169 2:213927215-213927237 ATGTGGCAGTATTCGGAGGTAGG - Intronic
945930741 2:215852656-215852678 AGGTGGTGGTATTAGGAGGTGGG - Intergenic
945935202 2:215896873-215896895 CAGTGATGGTATTAGGAGGTGGG - Intergenic
946045883 2:216820623-216820645 AAGTGATGGTATTAGAAGGTGGG + Intergenic
946120501 2:217508889-217508911 AGGTGGTGGCATTAGGAGGTGGG + Intronic
946128131 2:217582277-217582299 AGGTGATTGTATTAGGAGGTGGG + Intronic
946452652 2:219794288-219794310 ATGTGATAGAATTAAGAGGTGGG + Intergenic
946658959 2:221978954-221978976 ATGTGATAGTATTAAGAGGTGGG + Intergenic
946909792 2:224448305-224448327 ATGTGATGGTATTAGGAGGTAGG + Intergenic
946977749 2:225172590-225172612 ATGTGATAGTACTAGGAGGTTGG + Intergenic
947041229 2:225922967-225922989 AGGTGATAGTATTAAGAGGTAGG + Intergenic
947099114 2:226600370-226600392 AAGTGGTCACATTAGGACTTTGG - Intergenic
947127962 2:226891623-226891645 GATTGCTAGCATTAGGATGTAGG - Intronic
947181731 2:227417276-227417298 AGGTGATGGTATTAGGAGGTGGG + Intergenic
947258552 2:228193493-228193515 AGGTGATAGTATTAAGAGGTGGG + Intergenic
947358898 2:229326302-229326324 AAGTGATGATATTAGGAGGTAGG + Intergenic
947647563 2:231754966-231754988 ATGTGATGGTATTAGGAGGTGGG + Intronic
948017235 2:234700701-234700723 AGGTGATGGTATTAGGAGGTGGG - Intergenic
948225311 2:236305227-236305249 AGGTGATAGTATTAAGAGGTGGG - Intergenic
948238045 2:236405048-236405070 ATGTGGTGGTGTTAGGAGGTGGG - Intronic
948439346 2:237976715-237976737 CTGTGGTAGTATTAAGAGGTGGG - Intronic
1168884171 20:1233756-1233778 ATGTGATGGTATTAGGAGGTGGG - Intronic
1169048989 20:2560414-2560436 AAATGGTAGTATTAGGGTGTGGG - Intronic
1169315831 20:4590427-4590449 AGGTGATAGTATTAGGAGATGGG + Intergenic
1169408532 20:5347181-5347203 ATGTGGTGGTATTAGGAGGTGGG - Intergenic
1169603862 20:7293279-7293301 ATGTGATATTATTAGGAGGTGGG + Intergenic
1169752327 20:9007008-9007030 AGGAGGTAGTATTAGGAGGTGGG + Intergenic
1169939105 20:10917907-10917929 ATGTGATAGTATTTGGAGGTGGG + Intergenic
1170147986 20:13198471-13198493 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1170148717 20:13205689-13205711 ATGTGATGGCATTCGGAGGTGGG - Intergenic
1170273133 20:14550406-14550428 ATGTGATTGTATTAGGAGGTGGG + Intronic
1170663062 20:18361401-18361423 ATGTGGTGGTATTAAGAGGTGGG + Intergenic
1170728389 20:18949664-18949686 ATGTGATTGTATTAGGAGGTCGG - Intergenic
1170946800 20:20898673-20898695 ATGTGATTGTATTAGGAGGTGGG + Intergenic
1171084419 20:22224260-22224282 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1171394820 20:24825221-24825243 AAGTGAGAGTATTAAGAGGTGGG - Intergenic
1171510000 20:25674491-25674513 CAGTGTAAGTATTAGGAGGTGGG - Exonic
1171539267 20:25933022-25933044 AAGTGATAGGATTATGGGGTGGG + Intergenic
1172210237 20:33192608-33192630 AAGTAGTGGTATTAAGAGGTGGG - Intergenic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1172784441 20:37457731-37457753 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1172968513 20:38856469-38856491 AGGTTGTAGCAGTAGCAGGTAGG + Intronic
1173134504 20:40427493-40427515 AAGTCCTAGGATTAGGATGTGGG + Intergenic
1173180596 20:40803741-40803763 AGGTGATGGCATTGGGAGGTGGG - Intergenic
1173334839 20:42104086-42104108 ATGTGATGGTATTAGGAGGTTGG + Intronic
1173542005 20:43860749-43860771 AAGTGATGGTATTAAGAGGTTGG - Intergenic
1173655284 20:44696200-44696222 CAGTGATAGCCTTAAGAGGTGGG - Intergenic
1173778551 20:45733715-45733737 AGGTGATAGTATTAGGAGATGGG - Intergenic
1173956560 20:47037624-47037646 TAGTGGCAGCCTTGGGAGGTTGG - Intronic
1174033575 20:47651173-47651195 AAGCAGTCACATTAGGAGGTGGG - Exonic
1174189314 20:48728985-48729007 ACGTGCTGCCATTAGGAGGTTGG - Intronic
1174645939 20:52085383-52085405 AAGTGTTGTCATTAGGAGGTTGG - Intronic
1174851927 20:54004108-54004130 ATGTGATGGTATTAGGAGGTGGG + Intronic
1175030242 20:55946226-55946248 AAGTGGAAGCATTGTGAGGGAGG - Intergenic
1175465396 20:59187258-59187280 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1176369306 21:6052843-6052865 AAGCAGTGGCATTAGGAGGTGGG + Intergenic
1176702550 21:10073198-10073220 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1176937291 21:14882093-14882115 AGGTGATGGTATTAGGAGGTAGG - Intergenic
1177007433 21:15690799-15690821 AACTGGAAGCCTTAGGAGGTTGG + Intergenic
1177069942 21:16492209-16492231 ATGTGATAGCATTTGGAGGTGGG + Intergenic
1177183382 21:17767322-17767344 ATATGGTTGTATTAGGAGGTAGG - Intergenic
1177349789 21:19922452-19922474 AGATGATAGTATTAGGAGGTGGG - Intergenic
1177430694 21:20988836-20988858 AAGTGATAATATTCGGAGGTGGG + Intergenic
1177748682 21:25253224-25253246 ATATGGTGGTATTAGGAGGTAGG + Intergenic
1177934536 21:27327542-27327564 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1178066792 21:28913362-28913384 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1178198707 21:30378533-30378555 AACTGGTAACAGGAGGAGGTTGG + Intronic
1178222863 21:30680887-30680909 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1178237521 21:30859603-30859625 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1178348522 21:31852549-31852571 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1178711943 21:34925000-34925022 ATGTGATGGTATTAGGAGGTGGG - Intronic
1178750439 21:35297406-35297428 ATGTGACAGTATTAGGAGGTGGG + Intronic
1178773435 21:35527118-35527140 AGGTAATAGTATTAGGAGGTGGG + Intronic
1178775089 21:35542368-35542390 ATGTGATTGTATTAGGAGGTTGG - Intronic
1179013013 21:37570927-37570949 ATGTGGTGGCATTTGGAGGCGGG + Intergenic
1179080474 21:38166154-38166176 TAGTGGTACCATTAAGAGGGTGG + Intronic
1179240704 21:39588670-39588692 AGGTGATGGTATTAGGAGGTGGG - Intronic
1179370555 21:40802548-40802570 ATGTGGCAGTATTAAGAGGTGGG + Intronic
1179754213 21:43485698-43485720 AAGCAGTGGCATTAGGAGGTGGG - Intergenic
1179829605 21:43988332-43988354 AAGGGGCAGCGTTAGGAAGTGGG + Intergenic
1180010397 21:45046191-45046213 AGGTGGTAGTATTAGGAGGTGGG - Intergenic
1180249521 21:46572465-46572487 ATGTGGCAGTATTAAGAGGTGGG + Intergenic
1181385552 22:22542879-22542901 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1181643279 22:24216023-24216045 ATGTGATAGCGTTAGCAGGTGGG + Intergenic
1181719484 22:24762909-24762931 ATGTGGCAGCATTGGGAAGTGGG - Intronic
1182347680 22:29678060-29678082 TCGTGGTGGCATTGGGAGGTGGG + Intronic
1182543525 22:31058916-31058938 ATGTGGTAGTATTAAGAGGTGGG - Intergenic
1182835898 22:33341097-33341119 AGGTGATGACATTAGGAGGTGGG + Intronic
1182898361 22:33877000-33877022 CAGTGGTACCATTAGATGGTGGG - Intronic
1183022289 22:35037060-35037082 AGGTGATAGGATTAAGAGGTGGG - Intergenic
1183039165 22:35163416-35163438 AGGTGGTGGTATTAGGAGGTGGG - Intergenic
1183144264 22:35974800-35974822 AAGTGGTAGCAGTAAGATGAGGG - Intronic
1183242558 22:36668757-36668779 AAGTGCTGGGATTACGAGGTGGG + Intronic
1183752721 22:39731177-39731199 ATGTGATGACATTAGGAGGTGGG + Intergenic
1183761367 22:39821938-39821960 AAGTGATGGTATTAGGAGGCGGG - Intronic
1184290233 22:43495014-43495036 AGGTGCTAGTACTAGGAGGTGGG - Intronic
1184358861 22:44001603-44001625 AAGTGGGACCATTAGAAGTTAGG + Intronic
1184722897 22:46325724-46325746 AGGTGATGGCATTAGAAGGTGGG - Intronic
1184821793 22:46915057-46915079 AAGTAGTGGCATTGGGAGGAAGG + Intronic
1184854478 22:47138927-47138949 AGGTGGTAGTATTAGGAAGCGGG - Intronic
1184874005 22:47261175-47261197 AGGTGGTGGTATTAGCAGGTGGG + Intergenic
1184904455 22:47471330-47471352 ATGTAATAGTATTAGGAGGTGGG - Intronic
1185076593 22:48686500-48686522 AAGTGATGGTATTAGGAAGTGGG - Intronic
1185131683 22:49043073-49043095 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1185152784 22:49175526-49175548 AGGTGGTGGTATTAGGAGGTGGG + Intergenic
1185201783 22:49511383-49511405 AGGCGGTAGTGTTAGGAGGTGGG + Intronic
1185389745 22:50552755-50552777 ACGTGATGGTATTAGGAGGTCGG + Intronic
949172179 3:1014051-1014073 ATGTGGTAATATTAAGAGGTGGG + Intergenic
949196363 3:1313977-1313999 AGGTGATAGTATTAGGAGGTGGG - Intronic
949255820 3:2044615-2044637 ATGTGGCAGTATTTGGAGGTGGG + Intergenic
949406076 3:3716253-3716275 ATGTGGTGCTATTAGGAGGTGGG - Intronic
949589889 3:5483096-5483118 AGGTGATGGTATTAGGAGGTGGG - Intergenic
949738325 3:7200238-7200260 ATGTGGCAGTGTTAGGAGGTAGG - Intronic
949830822 3:8212374-8212396 AAGTGATGGTATTAGGATGTGGG - Intergenic
949873583 3:8609260-8609282 AGGTGATGGCATTAGGACGTGGG - Intergenic
949980045 3:9496758-9496780 TGGTGGTAGCATTAGGGGGCTGG - Intergenic
950567358 3:13778186-13778208 AGGTGATGGCATTAGGAGGTGGG + Intergenic
950626798 3:14253252-14253274 AACTGGAGGCATTAGAAGGTGGG + Intergenic
950798864 3:15533215-15533237 AAGTGATGGTATTAGGAGATAGG - Intergenic
950918184 3:16666475-16666497 ATGTGATAGTATTTGGAGGTGGG + Intronic
950999826 3:17544795-17544817 TAGTGGTAGAAATAGGAGATAGG - Intronic
951024441 3:17814916-17814938 ATGTGATAGCATTAAGAGGTGGG - Intronic
951116764 3:18872357-18872379 ATGTGATAGCATTTGGAGTTGGG - Intergenic
951247849 3:20361742-20361764 AGGTGATGGTATTAGGAGGTGGG - Intergenic
951425469 3:22539647-22539669 AAGTGATAGTATTAGGAGGTTGG - Intergenic
951480245 3:23153229-23153251 ATGTGATAGTGTTAGGAGGTGGG - Intergenic
951520335 3:23605334-23605356 ATGTGATAGTATTAAGAGGTGGG + Intergenic
951710531 3:25581652-25581674 ATGTGATGGTATTAGGAGGTGGG + Intronic
951794750 3:26525846-26525868 ATGTGGTGGTATTAAGAGGTGGG - Intergenic
951836604 3:26990268-26990290 AAATGATAGTATTAGAAGGTAGG - Intergenic
951857168 3:27210438-27210460 ATGTGGCAGTATTAGGAGATGGG - Intronic
951934638 3:28008421-28008443 AGGTGATGGTATTAGGAGGTGGG + Intergenic
951978716 3:28542741-28542763 ATGTGATAGTATTAAGAGGTGGG - Intergenic
952274642 3:31865554-31865576 AGTTGATAGCATTAGGAGGTGGG + Intronic
952380225 3:32798704-32798726 AGGTGATGGTATTAGGAGGTAGG - Intergenic
952413033 3:33066227-33066249 ATGTGGTAGTATTGAGAGGTGGG + Intronic
952775139 3:37038513-37038535 AGGTGATACTATTAGGAGGTGGG - Intronic
952851695 3:37734847-37734869 AAGTGGTAGCATTACCAGCTGGG - Intronic
953152754 3:40340186-40340208 ATTTGATAGTATTAGGAGGTGGG + Intergenic
953271341 3:41448212-41448234 AAGTGTTAGGACTAGGAGGCTGG + Intronic
953358072 3:42271205-42271227 ATGTGATGGTATTAGGAGGTGGG - Intergenic
953408580 3:42673627-42673649 GTGTGATAGTATTAGGAGGTAGG - Intergenic
953438031 3:42895454-42895476 GAGTGATAGCATTAGGCAGTTGG + Intronic
953467586 3:43137086-43137108 AAGTGATGGTGTTAGGAGGTAGG - Intergenic
953475003 3:43197951-43197973 CAGTGGTTGCCTTGGGAGGTGGG + Intergenic
953950466 3:47185499-47185521 AAGTGATAGTATTAGGAAGTAGG - Intergenic
954643370 3:52115575-52115597 AAGTAATAGTATTAGGAGGTGGG + Intronic
954895223 3:53969524-53969546 AGGTGATAGTATTAGGAGGTGGG - Intergenic
954990111 3:54833375-54833397 AAGGGGTAGGAGCAGGAGGTGGG - Intronic
955024566 3:55155125-55155147 AAGTGGTGGCATGAGGAAGATGG + Intergenic
955113861 3:55976888-55976910 AAGTGATCGTATGAGGAGGTGGG + Intronic
955149717 3:56355030-56355052 GAGTGGTTGCATTAGGAAATAGG - Intronic
955309110 3:57866356-57866378 AACTGGTAGAGTTAGGAGGTGGG + Intronic
955517541 3:59742627-59742649 ATGTGATGGTATTAGGAGGTAGG - Intergenic
955952663 3:64257831-64257853 AAGTGATAGTATTAGAAGATGGG + Intronic
956230956 3:67016155-67016177 ATGTGATGGTATTAGGAGGTAGG - Intergenic
956366911 3:68514146-68514168 AAGTGATAGTGTTAGGAGGAGGG - Intronic
956393435 3:68799432-68799454 AGGTGGTGGTATTAAGAGGTGGG - Intronic
956571880 3:70705679-70705701 AAGTGATGGTATTAAGAGGTGGG - Intergenic
956582129 3:70825853-70825875 AAGTGATAGTATTAGGAGGTGGG + Intergenic
956891138 3:73615486-73615508 AAGTGATGGTATTAGCAGGTGGG + Intronic
956914665 3:73858677-73858699 ATGTGATGGTATTAGGAGGTGGG - Intergenic
957219713 3:77366306-77366328 ATTTGATAGTATTAGGAGGTGGG + Intronic
957260138 3:77890218-77890240 AAGTGATGATATTAGGAGGTGGG - Intergenic
957300168 3:78381566-78381588 ATGTGATAGCATTAAGATGTAGG + Intergenic
957311141 3:78520375-78520397 AAGTGATAACATTAAGAGGTGGG + Intergenic
957561842 3:81832394-81832416 AAATGATGACATTAGGAGGTGGG + Intergenic
958891321 3:99786300-99786322 AAGTGATGGTATTAGGAGGTGGG + Intronic
959123760 3:102265336-102265358 ATGTGATAGTATTAGGAGGTGGG + Intronic
959141685 3:102493618-102493640 AAGTGATAGTATTAAGAGGTAGG + Intergenic
959164595 3:102760176-102760198 ATGTGATAGTATTAAGAGGTGGG + Intergenic
959193262 3:103142668-103142690 ATGTGATAGTATTAAGAGGTGGG + Intergenic
959422247 3:106143316-106143338 GAGTGGTGGTATTGGGAGGTGGG + Intergenic
959524338 3:107359941-107359963 AAGTGATGGTATTAGGAGGTAGG + Intergenic
959638172 3:108599670-108599692 ATGTGATAGTATTAGGAGGTTGG + Intronic
959663038 3:108890660-108890682 ATGTGATAGTATTAAGAGGTTGG - Intergenic
959770176 3:110085584-110085606 AGGTGATGGCATTAGGAGGTGGG + Intergenic
959995854 3:112679480-112679502 AGGTGATGGCATTAGGAGGTGGG - Intergenic
960066849 3:113383458-113383480 ATGTGATAGTATTTGGAGGTGGG - Intronic
960653160 3:119974354-119974376 ATGTGATGGTATTAGGAGGTAGG + Intronic
960694835 3:120386032-120386054 AAGTTATAGTATTAGGAGGTGGG + Intergenic
960960934 3:123069727-123069749 AAGTGGTGGTGTTAGGAGGTGGG - Intronic
960977897 3:123194175-123194197 ATGTAATAGCATTAAGAGGTGGG - Intronic
961147962 3:124611098-124611120 GAGTGGCAGCATGTGGAGGTGGG + Intronic
961251780 3:125513106-125513128 AGGTGATGGTATTAGGAGGTGGG + Intronic
961371755 3:126435726-126435748 GAGTGGTAGCATCAGGGGCTTGG - Intronic
961746199 3:129064915-129064937 GTGTGCTTGCATTAGGAGGTGGG - Intergenic
962016669 3:131448047-131448069 AAGTGATAATATTAAGAGGTGGG - Intergenic
962088233 3:132214289-132214311 GAGTGGTGGTATTAAGAGGTAGG + Intronic
962107568 3:132407965-132407987 AGGTGATAGTATTAGGAGGTTGG + Intergenic
962150898 3:132892366-132892388 ATGTGGTAGTATTAAGAGGTGGG - Intergenic
962288985 3:134114581-134114603 ATGTGGCAGCATTGGGAAGTTGG - Intronic
962294196 3:134166145-134166167 AAGTGATGGTATTAGGAGTTGGG + Intronic
962445814 3:135463662-135463684 ATGTGATAGTATTAAGAGGTGGG + Intergenic
962446712 3:135472428-135472450 CAGAGGTAGCATCAGGAGTTTGG - Intergenic
962557245 3:136566174-136566196 AAGTGATGGTATTAGAAGGTGGG + Intronic
962916880 3:139912411-139912433 AAGTGGCAGAACTAGGAGGTGGG - Intergenic
962948032 3:140190139-140190161 AGGTGATAGTATTAGGAGGTGGG - Intronic
963250407 3:143097387-143097409 ATGTGGTAGTATTTGGAGATAGG + Intergenic
963262348 3:143205732-143205754 ATGTGATAGTATTAGGAGATGGG - Intergenic
963334353 3:143955863-143955885 AAGTGATAGTATTAGGTGGTGGG - Intergenic
963348710 3:144126877-144126899 AGGTGATGGTATTAGGAGGTGGG - Intergenic
963712987 3:148768720-148768742 AGGTGATGGAATTAGGAGGTGGG + Intergenic
963731538 3:148978790-148978812 AAGTGATTGTATTAGGAGATGGG + Intergenic
963842538 3:150122356-150122378 AGGTGATGGTATTAGGAGGTAGG + Intergenic
963907233 3:150782696-150782718 ATGTGATAGTATTTGGAGGTGGG + Intergenic
964058540 3:152491634-152491656 ACGTGGTGGTATTAGAAGGTGGG + Intergenic
964340850 3:155706985-155707007 ATGTGATAGTATTAGGAGGTGGG + Intronic
964659766 3:159107188-159107210 AGGCTGTAGTATTAGGAGGTAGG + Intronic
964865499 3:161255228-161255250 ATGTGATGGCATTAGGAGGTGGG - Intergenic
966059832 3:175741390-175741412 AAGTGATGGTATTAGGAGGTAGG - Intronic
966252782 3:177885455-177885477 CAGTGGATACATTAGGAGGTAGG - Intergenic
966462881 3:180197212-180197234 CAGTGGCAGCATCAAGAGGTGGG + Intergenic
966547399 3:181165891-181165913 ATGTGATAGTATTAGGAGTTGGG - Intergenic
966690573 3:182737543-182737565 AAGTAATAGAATTAGGAGGCTGG + Intergenic
966750984 3:183322088-183322110 ATGTGATAGCATTAAGAGGAGGG - Intronic
967013130 3:185457591-185457613 AAGGGACAGTATTAGGAGGTGGG - Intronic
967719590 3:192801494-192801516 ATGTGATAGTATTAGGAGCTGGG + Intronic
967863597 3:194172310-194172332 ATATGATGGCATTAGGAGGTGGG - Intergenic
967939769 3:194756841-194756863 AAGTGGCAGCATCCTGAGGTTGG + Intergenic
968170674 3:196507275-196507297 CAGTGATAGCAATAGGAGGCAGG - Exonic
968799965 4:2736254-2736276 AGGTGATAGTATTAAGAGGTGGG - Intergenic
969027362 4:4184139-4184161 ATGTGGTGGTATTTGGAGGTGGG - Intergenic
969630310 4:8332143-8332165 ATGGGATTGCATTAGGAGGTGGG + Intergenic
969965139 4:10986361-10986383 ATGTGGTAGTATTAGGAAGTTGG + Intergenic
970113016 4:12659882-12659904 AGGTGATAGTATTAGGAGGTAGG - Intergenic
970127994 4:12835913-12835935 AGGTGATAGTATTAAGAGGTGGG - Intergenic
970155883 4:13141414-13141436 GTGTGATAGGATTAGGAGGTGGG + Intergenic
970158298 4:13163693-13163715 AGGTGATGGTATTAGGAGGTGGG + Intergenic
970237720 4:13975497-13975519 ATGTGATAGTATTTGGAGGTGGG - Intergenic
970343041 4:15126848-15126870 ATGTGATGGTATTAGGAGGTGGG + Intergenic
970376447 4:15462516-15462538 ATGTGATGGCATTTGGAGGTGGG + Intergenic
970730980 4:19103258-19103280 AGGTGATAGTATTAGGAGGTGGG + Intergenic
970866262 4:20762305-20762327 ATGTGATAGTATTAGGAGGTGGG - Intronic
970879705 4:20914306-20914328 AGGTGATGGTATTAGGAGGTAGG + Intronic
971366137 4:25978538-25978560 AAGTGGAAAGATGAGGAGGTAGG - Intergenic
971376511 4:26059945-26059967 ATGTGATTGAATTAGGAGGTGGG + Intergenic
971485793 4:27158888-27158910 ACGTGAAAGTATTAGGAGGTGGG + Intergenic
971490106 4:27203207-27203229 ATGTGATGGCATTAGGAGGTGGG + Intergenic
971646591 4:29214155-29214177 ATGTGATGGTATTAGGAGGTGGG + Intergenic
971707238 4:30060974-30060996 AAGTGATGGTATTAAGAGGTGGG + Intergenic
971907458 4:32745641-32745663 GTGTGATAGTATTAGGAGGTGGG - Intergenic
972110749 4:35555941-35555963 AATAGGTAGTATTAGGAGATTGG + Intergenic
972166010 4:36284941-36284963 AGGTGATGGTATTAGGAGGTGGG - Intronic
972302953 4:37802980-37803002 AAGTTATAGCATTAGTAGTTTGG - Intergenic
972377595 4:38487290-38487312 ATGTGATGGTATTAGGAGGTGGG - Intergenic
972450010 4:39187583-39187605 AAATGATAGCATTAGGTGGGTGG - Intronic
972490984 4:39587044-39587066 ATGTGCTAGCATTTGGAGGTGGG - Intronic
972624003 4:40778421-40778443 AAGTGATGGTATCAGGAGGTGGG + Intronic
972768668 4:42175150-42175172 AGGTGATGGCATTAGGAGGTGGG - Intergenic
973075440 4:45919053-45919075 ATATGGTGGTATTAGGAGGTAGG - Intergenic
973163931 4:47053517-47053539 ATGTGATGGCATTAGAAGGTGGG - Intronic
973215648 4:47666577-47666599 ATGTGATAGTATTTGGAGGTGGG + Intronic
973582070 4:52353927-52353949 ATGTGATAGCATTTGGAGGTGGG - Intergenic
973659560 4:53088896-53088918 ATGTGCTGGCATTAGGAAGTGGG + Intronic
973911612 4:55587339-55587361 ATGTGATAGTATTAGGAGGTGGG - Intronic
974008662 4:56586480-56586502 CAGTGATTGAATTAGGAGGTGGG - Intronic
974015768 4:56647549-56647571 AGGTGGTGATATTAGGAGGTGGG - Intergenic
974081573 4:57219267-57219289 ATGTGGTGGTATTTGGAGGTAGG + Intergenic
974750536 4:66134766-66134788 ATGTGGTAGTATTAAGAGGTAGG - Intergenic
974843992 4:67329386-67329408 AAGTGATGATATTAGGAGGTCGG + Intergenic
974847393 4:67367347-67367369 AAGTGATGGCATTAGGAATTGGG + Intergenic
974849601 4:67388582-67388604 ATGTGATGGCATTAGGAGATGGG - Intergenic
975499494 4:75069207-75069229 AGGTGGTACTATTAGGAGGTGGG + Intergenic
975531846 4:75407572-75407594 AAGTGATAGTATTAGGAGGTAGG - Intergenic
975611275 4:76206016-76206038 AGGTGGTGAGATTAGGAGGTGGG + Intronic
976095519 4:81504708-81504730 ATGTGATAGTATTAGAAGGTGGG - Intronic
976108834 4:81648591-81648613 GAGTTGTATCATTTGGAGGTTGG + Intronic
976224828 4:82787640-82787662 AGGTGTTGGTATTAGGAGGTGGG + Intronic
976305174 4:83552802-83552824 AAGTGATGGTATTAGGAGGTGGG + Intronic
976318523 4:83685405-83685427 AAGGGATGGCATTATGAGGTGGG - Intergenic
976635243 4:87280899-87280921 AGGTGGTGGTATTAGGGGGTGGG + Intergenic
977038781 4:91987284-91987306 AAGTAGTAGTATTAGTAGGTGGG - Intergenic
977075819 4:92447852-92447874 AGGTGATGGTATTAGGAGGTGGG - Intronic
977201293 4:94119878-94119900 ATGTGATGGAATTAGGAGGTGGG - Intergenic
977306038 4:95324643-95324665 AGGTGATGGTATTAGGAGGTGGG + Intronic
977349754 4:95867518-95867540 AAGAGGCAGCACTAGGAGGATGG - Intergenic
977371052 4:96136652-96136674 AGGTGATAGTATTAGCAGGTGGG + Intergenic
977406704 4:96608684-96608706 AAGTGATGGTATTTGGAGGTGGG - Intergenic
977709807 4:100112179-100112201 AGGTAATAGTATTAGGAGGTAGG + Intergenic
977710121 4:100115071-100115093 AAGAGGAAGCATTAGGAGTAAGG - Intergenic
978084303 4:104631703-104631725 ATGTGGTAGTATTAAGAGATGGG - Intergenic
978109602 4:104946966-104946988 AGGTGATGACATTAGGAGGTGGG + Intergenic
978161795 4:105557515-105557537 ATGTGACAGTATTAGGAGGTGGG + Intronic
978268736 4:106861563-106861585 AAGAGGAAGAATTAGGATGTTGG - Intergenic
978595431 4:110372722-110372744 ATGTAATGGCATTAGGAGGTGGG - Intronic
978631894 4:110757217-110757239 AGGTGATAGTATTAGGAGGTGGG + Intergenic
978869254 4:113555818-113555840 AAGTGCTGATATTAGGAGGTGGG + Intronic
978964432 4:114724479-114724501 ATGTGATAGTATTAAGAGGTGGG + Intergenic
979348021 4:119612131-119612153 AGGTGATAGTATTAGGAGGTGGG + Intronic
979955422 4:126948293-126948315 AAGTGATGGTGTTAGGAGGTAGG + Intergenic
980206700 4:129729018-129729040 ATGTGCTAGTATTAGGAGGTAGG + Intergenic
980374723 4:131929652-131929674 ACGTGTTAGCATTTGGAGGTGGG + Intergenic
980524380 4:133970691-133970713 AGGTGGTAGTATTAGGAGGTAGG + Intergenic
980603915 4:135064392-135064414 AGGTGATGGTATTAGGAGGTGGG + Intergenic
980706519 4:136503438-136503460 AGGTGATAGTATTAGGAGGTGGG + Intergenic
980731973 4:136835486-136835508 AAGTGATGGTAGTAGGAGGTGGG + Intergenic
980852263 4:138396949-138396971 ATGTGATGGTATTAGGAGGTAGG + Intergenic
981038752 4:140200026-140200048 ACATGATAGTATTAGGAGGTGGG - Intergenic
981047477 4:140278651-140278673 CAGTGATAGTATTAGAAGGTAGG - Intronic
981264267 4:142762822-142762844 ATGTGATAGCATTAAGAAGTAGG + Intronic
981338936 4:143598097-143598119 AGGTGATAGCATTAGGAGGTGGG - Intronic
981445501 4:144832755-144832777 ATGTGATGGTATTAGGAGGTGGG + Intergenic
981665114 4:147215444-147215466 AAGTGATGGTATTAGGAGGTGGG + Intergenic
981917565 4:150051570-150051592 AGGTGATGGTATTAGGAGGTGGG + Intergenic
982203733 4:152981685-152981707 AGGAGGTAGGATTAGGAGGTGGG + Intergenic
982231943 4:153216889-153216911 ATGTGATAGTATTAAGAGGTTGG - Intronic
982304448 4:153915663-153915685 ATGTGGTGGTATTAGGAGGTGGG + Intergenic
982431524 4:155327238-155327260 ATGTGATGGGATTAGGAGGTGGG - Intergenic
982536570 4:156614284-156614306 AAGTGATGGTCTTAGGAGGTGGG + Intergenic
982605116 4:157505982-157506004 TCGTGGTGGTATTAGGAGGTAGG - Intergenic
982962468 4:161858042-161858064 AGGTGATAGTATTAGGAGGTGGG + Intronic
982980494 4:162128352-162128374 AGGTGATAATATTAGGAGGTGGG + Intronic
983000214 4:162405162-162405184 ATGTGACAGTATTAGGAGGTAGG - Intergenic
983125005 4:163939964-163939986 ATGTGATGGTATTAGGAGGTGGG + Intronic
983317563 4:166151534-166151556 ATGTGGTAGCATTGAGAGGTGGG - Intergenic
983427602 4:167606920-167606942 ATGTGATGGCATTAGGAGGTGGG - Intergenic
983672308 4:170252411-170252433 ATGTGATGGTATTAGGAGGTGGG + Intergenic
983852643 4:172601332-172601354 ATGTGGTAGTGTTGGGAGGTAGG + Intronic
983993935 4:174158597-174158619 ATGTGCTGGTATTAGGAGGTGGG - Intergenic
984215326 4:176905702-176905724 AGGTGATAGCACTAAGAGGTGGG + Intergenic
984281130 4:177672089-177672111 AAGTGATAGTATTAGGAAGTGGG - Intergenic
984488967 4:180408366-180408388 AGGTGATAGCATTAGGATGCAGG + Intergenic
984810146 4:183788785-183788807 ATGTGGTGGTATTGGGAGGTGGG - Intergenic
985150530 4:186942779-186942801 AGGTGATGGTATTAGGAGGTGGG + Intergenic
985289750 4:188375673-188375695 AGGTGATGGCATTAGGAGGCGGG + Intergenic
985835644 5:2270083-2270105 AGGTGGTAGCATCAAGAGGTGGG - Intergenic
985934692 5:3088008-3088030 GTGTGATGGCATTAGGAGGTGGG - Intergenic
986104091 5:4643401-4643423 TAGTGGTGGTATTTGGAGGTGGG - Intergenic
986174284 5:5338786-5338808 ATGTGATAGAATTAGGAGGTGGG + Intergenic
986256373 5:6104218-6104240 ATGTGATGGTATTAGGAGGTGGG - Intergenic
986673926 5:10167495-10167517 AAGTGATGGTATCAGGAGGTAGG - Intergenic
986915649 5:12616402-12616424 AAGTGATAGTGTTAGGAGGTGGG + Intergenic
987096535 5:14555663-14555685 AACTGGAATCATTTGGAGGTTGG - Intergenic
987175367 5:15302551-15302573 ATGTGATGGCATTTGGAGGTGGG + Intergenic
987194003 5:15506807-15506829 ACGTGATAGCATTTGGAGGTGGG - Intronic
987225671 5:15838452-15838474 ATGTTATGGCATTAGGAGGTGGG - Intronic
987627306 5:20418826-20418848 ATGTGATAGTGTTAGGAGGTGGG + Intronic
987650976 5:20739694-20739716 AAATGATGGTATTAGGAGGTGGG - Intergenic
987795032 5:22616781-22616803 ATGTGATGGTATTAGGAGGTAGG + Intronic
987803230 5:22725671-22725693 GTGTGGCAGTATTAGGAGGTAGG - Intronic
988005020 5:25399248-25399270 ATGTGGTGGAATTAAGAGGTAGG - Intergenic
988088460 5:26503264-26503286 AAGTGGTAGCTCTAGGAGTCAGG - Intergenic
988123240 5:26994386-26994408 GACTGATAGTATTAGGAGGTGGG + Intronic
988172398 5:27675710-27675732 AAGTGATGGTATTAGGAGGTGGG + Intergenic
988273207 5:29044846-29044868 ATGTGGTAGTATTAAGGGGTGGG + Intergenic
988443951 5:31263712-31263734 ATGTGGCAGTATTAAGAGGTGGG - Intronic
988485220 5:31662935-31662957 TAGTGATAGCATTAGAAGGTGGG - Intronic
988566158 5:32321212-32321234 ATATGATAGCATTAAGAGGTGGG + Intergenic
988915554 5:35890718-35890740 AGGTGATAGTATTAAGAGGTGGG - Intergenic
989070724 5:37508183-37508205 ATGTTATAGTATTAGGAGGTGGG + Intronic
989182614 5:38593679-38593701 ATGTGATGGCATTAGCAGGTGGG + Intronic
989381348 5:40812465-40812487 ATGTGATAGTATTAGGAGGTGGG - Intergenic
989734823 5:44690915-44690937 AGGTGATAGTATTAAGAGGTGGG - Intergenic
990055586 5:51572780-51572802 AAGTGATGACATTAGGAGGTAGG - Intergenic
990377233 5:55183669-55183691 AGGTGATAGTATTAGGAGGTGGG - Intergenic
990455806 5:55986471-55986493 AAGTGGCATCTTTAGGGGGTAGG + Intronic
990500896 5:56396364-56396386 ATGTGATAGTATTAAGAGGTGGG - Intergenic
990685867 5:58300421-58300443 ATGTGGTGGTATTTGGAGGTGGG + Intergenic
990687896 5:58328290-58328312 AAGTGATGGTATTAAGAGGTGGG + Intergenic
990755677 5:59066720-59066742 ATGTGATGGTATTAGGAGGTGGG + Intronic
990971479 5:61511498-61511520 AGGTGATGGCATTAGGAGTTGGG + Intronic
991038871 5:62155685-62155707 AAGTGGAAGGATTAGGTGCTGGG - Intergenic
991214032 5:64141070-64141092 ATGTGATAGTATTAAGAGGTGGG - Intergenic
991292960 5:65050553-65050575 ATGTGATGGTATTAGGAGGTGGG - Intergenic
991559441 5:67933968-67933990 AGGTGATGGTATTAGGAGGTGGG + Intergenic
991633205 5:68677708-68677730 ATGTGGTAGTATTTGGAAGTAGG + Intergenic
991953729 5:71971832-71971854 AGGTGATGGTATTAGGAGGTGGG - Intergenic
992107703 5:73463701-73463723 ATGTGATGGTATTAGGAGGTGGG + Intergenic
992157948 5:73973181-73973203 AGGTGATGGTATTAGGAGGTGGG - Intergenic
992276790 5:75129091-75129113 AAGAGGTAGCACTAGGGGGATGG - Intronic
992519830 5:77539170-77539192 GTGTGATAGCATTTGGAGGTGGG - Intronic
992578103 5:78140631-78140653 ATGTGATGGTATTAGGAGGTAGG - Intronic
992590154 5:78286320-78286342 ATATGATAGCATTAAGAGGTGGG + Intronic
992646950 5:78819955-78819977 AGGTGATGGCATTAAGAGGTGGG + Intronic
992778540 5:80108252-80108274 AAGTGATGGCATAAGGAGGTGGG + Intergenic
993164596 5:84336054-84336076 ATGTGATAGTATTAAGAGGTGGG - Intronic
993488492 5:88516199-88516221 AAGTGATAGTATTAAGAGGTCGG - Intergenic
993497562 5:88624720-88624742 AATTGGTAGTGTTATGAGGTGGG - Intergenic
993571012 5:89538857-89538879 AGGTGATAGCATTAACAGGTGGG + Intergenic
993747983 5:91625582-91625604 AGGTGACAGTATTAGGAGGTGGG + Intergenic
993769216 5:91904069-91904091 ATGTGATGGCATTAGAAGGTGGG + Intergenic
993954260 5:94213421-94213443 AAGAGGTAGTATTAGGTGGGTGG - Intronic
993978338 5:94510989-94511011 AGGTGGTGGCATTTGGAGGTAGG + Intronic
994369108 5:98948707-98948729 AGGTGATAGTATTAGGAGGTGGG - Intergenic
995065002 5:107851582-107851604 AAGTGATGGTATTAGGAGGTGGG + Intergenic
995406990 5:111809415-111809437 ATGTGGCAGCATTGGAAGGTAGG + Intronic
995490470 5:112685589-112685611 ATGTTGTAACATAAGGAGGTGGG + Intergenic
995755501 5:115499302-115499324 ATGTGGTGGTATTTGGAGGTGGG - Intergenic
995773497 5:115699222-115699244 ATGTGATGGTATTAGGAGGTGGG + Intergenic
995974910 5:118022572-118022594 ATGTGATGGCATTAGGAGGTGGG + Intergenic
996191967 5:120555646-120555668 AAGTGATAGCATTTGGAAGTGGG - Intronic
996424866 5:123303791-123303813 ATGTGATGGCAGTAGGAGGTGGG - Intergenic
996764312 5:127020482-127020504 ATGTGATAGTATTAGAAGGTGGG + Intronic
997119188 5:131156745-131156767 ATGTGATGGTATTAGGAGGTGGG - Intergenic
998195470 5:140065968-140065990 AGGTGATGGTATTAGGAGGTGGG + Intergenic
998669771 5:144340586-144340608 ATATGATAGTATTAGGAGGTAGG + Intronic
999364674 5:151014442-151014464 AAGTGATGCTATTAGGAGGTGGG + Intergenic
999480638 5:151944972-151944994 ATGTGGTAGGATTAGTTGGTTGG - Intergenic
999675578 5:153998387-153998409 ACATGGCAGTATTAGGAGGTGGG + Intronic
999950294 5:156642214-156642236 ATGTGATGGTATTAGGAGGTGGG - Intronic
999969513 5:156845157-156845179 AAGTGTTAGTATTTGGAGATGGG + Intergenic
1000025598 5:157356354-157356376 ATATGATAGTATTAGGAGGTGGG - Intronic
1000050368 5:157557837-157557859 AGGTGATGGTATTAGGAGGTGGG - Intronic
1000166467 5:158653872-158653894 ACGTGATGGCATTTGGAGGTGGG - Intergenic
1000259056 5:159568488-159568510 AGGTGATAGTATTAGAAGGTGGG - Intergenic
1000701452 5:164456505-164456527 ATGTGGCAGTATTAAGAGGTAGG + Intergenic
1000738897 5:164939678-164939700 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1000966100 5:167658551-167658573 CTGTGATAGCATTAAGAGGTGGG - Intronic
1001195136 5:169666284-169666306 ATGTGATGGCATTAGGAGGTGGG - Intronic
1001251696 5:170151879-170151901 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1001453166 5:171841665-171841687 AAGTGATGGTATTTGGAGGTGGG - Intergenic
1001494259 5:172176810-172176832 AGGTGATAGCATTAGAAGGAGGG + Intronic
1001677242 5:173528764-173528786 AGGTGACAGTATTAGGAGGTGGG + Intergenic
1001738065 5:174023247-174023269 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1001867986 5:175122244-175122266 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1001900275 5:175421227-175421249 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1002884263 6:1280159-1280181 ATGTGGTGGTATTAGGAGGTGGG + Intergenic
1002915423 6:1524606-1524628 AAGTGATAGTCTTAGGAGGTGGG - Intergenic
1003104691 6:3206352-3206374 AAGTGATAGTCTTAGGAGATAGG + Intergenic
1003191321 6:3877842-3877864 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1003311006 6:4969973-4969995 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1003435450 6:6083923-6083945 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1003613006 6:7630226-7630248 AGGTGATGGCATGAGGAGGTGGG + Intergenic
1003636031 6:7832293-7832315 AGGTGATGGTATTAGGAGGTGGG + Intronic
1003674335 6:8189143-8189165 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1003709703 6:8575724-8575746 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1003946196 6:11078170-11078192 ATGTGATGGCATTAGGAAGTGGG + Intergenic
1004038481 6:11949691-11949713 AGGTGATAGCATTAAGAGGTGGG + Intergenic
1004241976 6:13931839-13931861 AGGTGATGGTATTAGGAGGTAGG + Intronic
1004605685 6:17193077-17193099 AAATGATGGTATTAGGAGGTAGG - Intergenic
1004618700 6:17314482-17314504 ATGTGATGGAATTAGGAGGTGGG + Intergenic
1004759805 6:18654228-18654250 ATGTGTTGGTATTAGGAGGTGGG + Intergenic
1005074303 6:21891397-21891419 AGGTGGTAGCATAAGAAGGCAGG - Intergenic
1005121657 6:22396736-22396758 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1005129726 6:22492271-22492293 GTGTGATAGTATTAGGAGGTAGG + Intergenic
1005212021 6:23477136-23477158 ATGTGATAGTATTAGGAAGTGGG + Intergenic
1005314280 6:24589145-24589167 ATGTGATAGTATTTGGAGGTAGG + Intronic
1005660240 6:27990863-27990885 AAGTGTTGGTATTAGGAGATGGG - Intergenic
1006248396 6:32760127-32760149 AATTGACAGCATTAGGATGTGGG + Intronic
1006433230 6:34011170-34011192 AAGTGGTGGTATTAGGAGGTGGG - Intergenic
1007345585 6:41227445-41227467 ATGTGATAGCGTTAAGAGGTGGG - Intergenic
1007364340 6:41380575-41380597 AGGTGATGGCATTAGGAGGTGGG - Intergenic
1007928371 6:45668419-45668441 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1008026040 6:46636971-46636993 AGGTGATGTCATTAGGAGGTGGG + Intronic
1008142066 6:47843507-47843529 AGGTGGTAGAATTAAGAGGTGGG - Intergenic
1008189015 6:48431612-48431634 AACTGGTGGTATTAGGAAGTGGG + Intergenic
1008252577 6:49258481-49258503 AGGTGATAGTATTAGGAGGTAGG - Intergenic
1008689210 6:53958773-53958795 ACGTGATGGTATTAGGAGGTAGG - Intronic
1008774353 6:55018257-55018279 ATGTGATAGTATTAGGAGGTGGG + Intergenic
1009040602 6:58171716-58171738 AGGTGGTAGTATTAAGAGATTGG + Intergenic
1009041783 6:58188989-58189011 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1009216457 6:60926248-60926270 AGGTGGTAGTATTAAGAGATTGG + Intergenic
1009217632 6:60943252-60943274 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1009744568 6:67796646-67796668 ATGTGATGGCATTTGGAGGTGGG + Intergenic
1009878721 6:69538699-69538721 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1009896860 6:69762656-69762678 ATGTGATAGTATTTGGAGGTGGG + Intronic
1009987249 6:70795601-70795623 ATGTGATATTATTAGGAGGTGGG - Intronic
1010185728 6:73141288-73141310 AAGTGATAGTATTAAGAGGTGGG - Intronic
1010891626 6:81319770-81319792 AAGTGATAACATTAAGAGTTGGG + Intergenic
1010924651 6:81729508-81729530 AGGTGATGGCATTAGGAGGTAGG + Intronic
1011156868 6:84342960-84342982 AGGTGGTGGTATTAGGAGGTGGG - Intergenic
1011221314 6:85057211-85057233 AGGAGGTGGTATTAGGAGGTAGG - Intergenic
1011250857 6:85370709-85370731 AAGTGTTAGCATTTGGGGTTGGG - Intergenic
1011574901 6:88786834-88786856 ATGTGATGGTATTAGGAGGTGGG + Intronic
1011747474 6:90420061-90420083 AAGTGTGAGAATTAGGGGGTGGG - Intergenic
1011758386 6:90529494-90529516 AAGTAGTAGCAGTAAGAAGTTGG + Intronic
1012152698 6:95774839-95774861 ATGTGATGGCATTAGAAGGTGGG + Intergenic
1012365157 6:98429832-98429854 AAGCGATGGTATTAGGAGGTGGG + Intergenic
1012785280 6:103617300-103617322 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1012926644 6:105274385-105274407 AAGTGATGGAATTAGGAGGCAGG - Intergenic
1013224340 6:108109284-108109306 ATGTGATGGCATTAAGAGGTGGG - Intronic
1013326657 6:109051951-109051973 ATGTGATAGTATTAAGAGGTGGG - Intronic
1013440663 6:110163534-110163556 ATGTGATAGTATTAGGAGATAGG - Intronic
1013626750 6:111945531-111945553 ATGTGATGGCATCAGGAGGTGGG - Intergenic
1013693308 6:112670428-112670450 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1013787646 6:113799617-113799639 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1014008115 6:116444601-116444623 ATGTGATAGTATTAGGATGTGGG + Intergenic
1014053877 6:116990165-116990187 ATGAGATAGCATTAGGAGGTAGG + Intergenic
1014167516 6:118242492-118242514 AGGTGGTAGCATTATCATGTTGG + Intronic
1014302644 6:119701721-119701743 AAGTGATAGAAGTAGGTGGTGGG + Intergenic
1014381073 6:120743194-120743216 AGGTGGTGGCATTAGAAGGTAGG + Intergenic
1014613698 6:123576654-123576676 AGGTGATGGCATTAGGAGTTGGG - Intronic
1014809017 6:125864549-125864571 ACGTGATAGTATCAGGAGGTGGG + Intronic
1014885991 6:126781893-126781915 AAGTGATGGTATTAGGAGGTAGG - Intergenic
1015094644 6:129400246-129400268 AGGTGATAGGATTAGGAAGTGGG - Intronic
1015307451 6:131725526-131725548 AGGTGATGGTATTAGGAGGTGGG - Intronic
1015345060 6:132146799-132146821 AGGAGATAGTATTAGGAGGTGGG + Intergenic
1015392446 6:132697924-132697946 AAGTGGTGGAATAAGTAGGTTGG + Intronic
1015560191 6:134506148-134506170 AGGTGATAGTATTAGGAGTTGGG - Intergenic
1015613343 6:135049361-135049383 AGGTGATGGTATTAGGAGGTGGG - Intronic
1015656536 6:135525040-135525062 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1015837065 6:137431883-137431905 AAGTGGTGGCATTTGCAGCTAGG - Intergenic
1015869206 6:137759226-137759248 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1015948756 6:138530109-138530131 ATGTGATGGTATTAGGAGGTGGG + Intronic
1016362188 6:143279418-143279440 AAGTGGAAAGATTAGGAGGCTGG - Intronic
1016422156 6:143896713-143896735 AAATGGAAGCTTAAGGAGGTTGG + Intronic
1016439805 6:144071273-144071295 AAGTGATGGTATTAGGAAGTGGG + Intergenic
1016460088 6:144272825-144272847 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1016536577 6:145113242-145113264 ATGTGGTGGTATTAGGAGATGGG + Intergenic
1016546929 6:145234305-145234327 AAGTAATGGTATTAGGAGGTGGG - Intergenic
1016665538 6:146635675-146635697 AAGTGGGAGTGTTGGGAGGTGGG - Intronic
1016757044 6:147698311-147698333 AGATGATAACATTAGGAGGTGGG - Intronic
1016888553 6:148982474-148982496 ATGTCATAGTATTAGGAGGTGGG - Intronic
1017380616 6:153824337-153824359 ATATGGTAGCATGAGAAGGTAGG - Intergenic
1017450967 6:154553944-154553966 ATGTGATAGTATTTGGAGGTGGG + Intergenic
1017807627 6:157959842-157959864 AGGTGATAGTATTAAGAGGTGGG + Intergenic
1017847147 6:158268593-158268615 ATGTAATAGCATTACGAGGTGGG - Intronic
1017904290 6:158746196-158746218 ATGTGATGGTATTAGGAGGTAGG - Intronic
1018082561 6:160270967-160270989 ATGTGATAGTATTAAGAGGTGGG + Intronic
1018464246 6:164028799-164028821 ATGTGGTAGTATTAAGAGGCAGG + Intergenic
1018494510 6:164336388-164336410 TAGTGATAGTATTAGGAGGCGGG + Intergenic
1018645661 6:165945489-165945511 AGGTGATAGTATTAGGAGGTGGG + Intronic
1019200361 6:170308779-170308801 AAGAGGAAGAAGTAGGAGGTAGG - Intronic
1020033368 7:4948572-4948594 ATGTGATAGTATTAGGAGGCGGG + Intronic
1020383341 7:7569480-7569502 AAGTGGAAGCATGAGGAAATAGG + Intronic
1020511677 7:9064617-9064639 ATTTGATAGTATTAGGAGGTAGG + Intergenic
1020684220 7:11273496-11273518 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1020907231 7:14078474-14078496 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1020981047 7:15069585-15069607 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1021173758 7:17426145-17426167 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1021184545 7:17548328-17548350 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1021254776 7:18377302-18377324 ATGTGATGGTATTAGGAGGTGGG - Intronic
1021339008 7:19440067-19440089 ATGTGATAGTATTAAGAGGTAGG + Intergenic
1021365862 7:19776984-19777006 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1021465453 7:20938091-20938113 AGGTGATAGTATTAGTAGGTAGG - Intergenic
1021611855 7:22465526-22465548 AAGTTGTAGTATTAGTAGGATGG - Intronic
1021694983 7:23267739-23267761 AGGTGATAGCATTAGGAGGGGGG - Intronic
1022001491 7:26230369-26230391 AATTGAAAGCAGTAGGAGGTGGG - Intergenic
1022864004 7:34398504-34398526 ATGTGATGGCACTAGGAGGTAGG - Intergenic
1022958459 7:35402463-35402485 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1023572663 7:41588464-41588486 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1023715274 7:43037574-43037596 ATGTGGCAGTATTGGGAGGTGGG + Intergenic
1024202025 7:47117495-47117517 AGGTGATGGCATTAGAAGGTGGG + Intergenic
1024605460 7:51019201-51019223 AGATGGTGGTATTAGGAGGTGGG + Intronic
1024657936 7:51467693-51467715 ATGTGGTGGTCTTAGGAGGTGGG - Intergenic
1024683631 7:51720259-51720281 ATGTGGTACTATTAAGAGGTGGG + Intergenic
1024701689 7:51910436-51910458 ATGTGATGGCATTAGGAGGCAGG - Intergenic
1024915136 7:54490621-54490643 CAGTGATAGTATTAGGAGGTGGG - Intergenic
1026068894 7:67100182-67100204 AGGTGGTAGGATGATGAGGTTGG + Intronic
1026122468 7:67549921-67549943 AGGTGATGGCGTTAGGAGGTGGG - Intergenic
1026425053 7:70282601-70282623 AGGTGATGGTATTAGGAGGTGGG - Intronic
1026708016 7:72712146-72712168 AGGTGGTAGGATGATGAGGTTGG - Intronic
1027547191 7:79542357-79542379 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1027672389 7:81118061-81118083 AGGTGAGAGTATTAGGAGGTGGG - Intergenic
1028665040 7:93332402-93332424 ATGTGATAGCATTTGGAGGTGGG - Intronic
1028730501 7:94142559-94142581 AAGTGGCAGAATTAGCAGGCGGG + Intergenic
1029892922 7:103950226-103950248 AAGTGATGGTATTAGGAAGTAGG - Intronic
1030353528 7:108518185-108518207 AAGTGATGGTATTAAGAGGTAGG - Exonic
1030424523 7:109357352-109357374 AAGTGATAGTATTAAGAGGTGGG + Intergenic
1030605975 7:111639517-111639539 AGGTGATGGCATTAGGAGGTGGG + Intergenic
1031326955 7:120412820-120412842 AAATGGAAGCATTAGGAGTTTGG - Intronic
1031516987 7:122712925-122712947 AGGTGATGGTATTAGGAGGTGGG - Intronic
1031628292 7:124015853-124015875 ATGTGATAGTATTAGCAGGTAGG - Intergenic
1032073496 7:128824583-128824605 AAGTGATAATATTAGGAGGGGGG + Intergenic
1032363221 7:131275317-131275339 AGGTGATGGTATTAGGAGGTGGG - Intronic
1033138927 7:138808012-138808034 AGGTGATGGCATTTGGAGGTGGG - Intronic
1033625037 7:143101987-143102009 AAGTGATAGTATTAAGAGGTAGG - Intergenic
1033805066 7:144944565-144944587 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1033876363 7:145823388-145823410 AAGTGATGGTATTAGGAAGTGGG - Intergenic
1033889329 7:145990279-145990301 ATGTGATATTATTAGGAGGTAGG + Intergenic
1034232043 7:149537999-149538021 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1034362230 7:150510200-150510222 AAGTGATGGTATTAAGAGGTAGG + Intergenic
1034402723 7:150876209-150876231 TAGTGGTAGCATTAGGAGATGGG - Intergenic
1034546368 7:151792323-151792345 AAGTGATTGCATTTGGTGGTGGG - Intronic
1035640014 8:1177848-1177870 CAGTGGTGGTATTATGAGGTGGG - Intergenic
1035725138 8:1819628-1819650 ACGTGATAGCAGTAAGAGGTGGG - Intergenic
1035830358 8:2688624-2688646 AAGTGTTGGTATTAGGAGGCTGG - Intergenic
1035931713 8:3786891-3786913 AGGTGCTAGTATTAGGAGGTGGG - Intronic
1036067316 8:5396299-5396321 AGGTGATAGTATTAGGAGTTGGG - Intergenic
1036118905 8:5993002-5993024 AAGTGATTGTATTAGGAGATGGG - Intergenic
1036161480 8:6392940-6392962 AACTGATGGCACTAGGAGGTGGG + Intergenic
1036622848 8:10437345-10437367 AGGTGATTGTATTAGGAGGTGGG + Intergenic
1037307315 8:17519071-17519093 ATGTGATAGTATTTGGAGGTAGG - Intronic
1037555577 8:20018918-20018940 AGGTGATAGTATTAGAAGGTAGG + Intergenic
1037626815 8:20615368-20615390 AAGTGATGGTGTTAGGAGGTAGG - Intergenic
1037944930 8:22983013-22983035 ATGTGGTAGTATTAAGAGGTGGG - Intronic
1038096906 8:24323272-24323294 AGGTGGTGGTGTTAGGAGGTGGG - Intronic
1038143996 8:24876897-24876919 AGTTGGTAAGATTAGGAGGTTGG - Intergenic
1038231484 8:25704717-25704739 AGGTGGTAGTATTATGAGGTGGG - Intergenic
1038282872 8:26181733-26181755 AGGTGACAGTATTAGGAGGTGGG + Intergenic
1038491855 8:27977216-27977238 AAGTGATGGGACTAGGAGGTGGG - Intronic
1038680498 8:29662890-29662912 AAGAGATGGTATTAGGAGGTGGG - Intergenic
1038681856 8:29676031-29676053 ATGTGGTAGTATTGAGAGGTGGG + Intergenic
1038849055 8:31256298-31256320 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1038854544 8:31317186-31317208 ATGTGATAGTATTAGGAGGTAGG + Intergenic
1038888101 8:31688230-31688252 AAGTGATGGTATTAAGAGGTAGG + Intronic
1038984438 8:32793214-32793236 AAGTGAAAGCATTAAGAGGTAGG - Intergenic
1039083505 8:33757220-33757242 ATGTGATAGCATTAAGAGGTGGG - Intergenic
1039083784 8:33759826-33759848 AAGTGATAGCATTAAGAGGGGGG - Intergenic
1039088864 8:33806714-33806736 AAGTGATAGGTTTAGGAGATGGG + Intergenic
1039316040 8:36373486-36373508 ATGTGGTGGCATTTGGAGTTGGG + Intergenic
1039384982 8:37127638-37127660 ATGTGGTTGTATTAAGAGGTGGG + Intergenic
1040389225 8:46935340-46935362 AAGTGATGGTATTAGGAAGTGGG + Intergenic
1040542781 8:48374776-48374798 TGATGGTAGTATTAGGAGGTGGG - Intergenic
1040588535 8:48766981-48767003 AAGTGATGGTATTAGGAGGTGGG + Intergenic
1040669126 8:49665862-49665884 AAGTGATAGTTTTAGGAAGTGGG - Intergenic
1040895898 8:52367739-52367761 AACTGGTAGTATTAGGGAGTGGG + Intronic
1040967287 8:53096266-53096288 ACGTGATAGTATTAGAAGGTGGG + Intergenic
1040984535 8:53279502-53279524 TTGTGGTGGTATTAGGAGGTGGG + Intergenic
1041036773 8:53799695-53799717 AGGTGATGGTATTAGGAGGTGGG + Intronic
1041316663 8:56570514-56570536 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1041348858 8:56929171-56929193 AAGTGGTAGGGTAAGCAGGTTGG - Intergenic
1041728598 8:61042573-61042595 ATGTGATAGTATTGGGAGGTGGG - Intergenic
1041748063 8:61231004-61231026 AGGTGATGGTATTAGGAGGTGGG - Intronic
1041776649 8:61529931-61529953 AGGTGATAGTATTAAGAGGTGGG - Intronic
1041948625 8:63475228-63475250 AATTGGTGGTATTAAGAGGTGGG + Intergenic
1042117349 8:65446838-65446860 AGATGATGGCATTAGGAGGTGGG + Intergenic
1042205828 8:66328844-66328866 AAGGGGCAGCATCAGGAAGTTGG - Intergenic
1042353832 8:67804416-67804438 ATGTGATAGTATTCGGAGGTGGG - Intergenic
1042357229 8:67841517-67841539 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1042425543 8:68643718-68643740 GTGTGGTAGTATAAGGAGGTAGG - Intronic
1042539641 8:69895203-69895225 AAGTGGTAGTATTGAGAGGTGGG - Intergenic
1043011660 8:74888609-74888631 AAGTGATGGTATTAGAAGGTAGG - Intergenic
1043065549 8:75566298-75566320 GAGTGATGGTATTAGGAGGTGGG - Exonic
1043374543 8:79633724-79633746 ATGTGATAGTATTTGGAGGTGGG - Intronic
1043604004 8:81977243-81977265 AGGTGATAGTGTTAGGAGGTGGG + Intergenic
1043867865 8:85396078-85396100 ATGTGATAGTATTAAGAGGTGGG - Intronic
1044064425 8:87682196-87682218 ATGTGATGGCATTAGGAGGTGGG + Intergenic
1044106161 8:88209926-88209948 AGGTGATAAAATTAGGAGGTAGG + Intronic
1044180491 8:89187758-89187780 TTGTGGTAGTATTAAGAGGTGGG + Intergenic
1044220690 8:89665528-89665550 AGGTGCTGGTATTAGGAGGTGGG + Intergenic
1044278204 8:90326520-90326542 AGGTAGTGGTATTAGGAGGTGGG + Intergenic
1044409717 8:91869306-91869328 ATGTGATAGTATTTGGAGGTAGG + Intergenic
1044422711 8:92016444-92016466 AGGTGGGAGCATCACGAGGTCGG + Intronic
1044646138 8:94445289-94445311 AGGTGGTGATATTAGGAGGTAGG - Intronic
1044791646 8:95853512-95853534 AAGTAATAGTATTAGGAGGTGGG - Intergenic
1044926288 8:97211547-97211569 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1045030121 8:98127200-98127222 AGGTGATGGTATTAGGAGGTGGG - Intronic
1045399263 8:101795605-101795627 AAGTGATGGTGTTAGGAGGTGGG - Intronic
1045495679 8:102706352-102706374 AGGTGATGGTATTAGGAGGTAGG + Intergenic
1045766908 8:105683143-105683165 AAGTAATAGTATTAGGAGGTAGG - Intronic
1045983294 8:108217948-108217970 AAGTGGTAGCAGTAGGAATTAGG + Intronic
1046015782 8:108603509-108603531 ATGTGGTAGTATTAAGAGGTGGG - Intergenic
1046332709 8:112741558-112741580 AGGTGATAGTATTAGGAGGTGGG - Intronic
1046897880 8:119492842-119492864 ATGTGGTAGTATTAAGAAGTGGG + Intergenic
1047171862 8:122501436-122501458 TAGTGGTAGCATGAGTAGGGTGG + Intergenic
1047192640 8:122692175-122692197 AAGTGTTTGAATTAGCAGGTGGG + Intergenic
1047463830 8:125093288-125093310 AGGTGATGGTATTAGGAGGTGGG - Intronic
1047906347 8:129477025-129477047 ATGTGGTGGTATTTGGAGGTGGG + Intergenic
1047962581 8:130021616-130021638 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1048049159 8:130801008-130801030 AGGTGATGGTATTAGGAGGTGGG - Intronic
1048206573 8:132420236-132420258 GTGTGATAGTATTAGGAGGTGGG - Intronic
1048377520 8:133835518-133835540 AGGTGCTTACATTAGGAGGTCGG + Intergenic
1048526568 8:135208357-135208379 ATGTGATAGCATTTGGAGATGGG + Intergenic
1048547605 8:135402412-135402434 ACGTGATGGCATTAGGAGGTGGG - Intergenic
1048713340 8:137238820-137238842 AAGTGATGGTATTAGGACGTGGG - Intergenic
1049073154 8:140372602-140372624 AGGTGATGGAATTAGGAGGTGGG + Intronic
1049284643 8:141767896-141767918 ATGTGGTAGTGTTGGGAGGTGGG - Intergenic
1049388399 8:142355650-142355672 TAGTGATAGCATTAGGGTGTAGG - Intronic
1049501508 8:142970222-142970244 AAGTGGTAACAAAAGGAAGTGGG + Intergenic
1050103954 9:2146284-2146306 AGGTGATGGTATTAGGAGGTGGG - Intronic
1050166331 9:2768691-2768713 AAGTGATGGTATTTGGAGGTGGG - Intronic
1050219373 9:3369408-3369430 AAGTGATGGTATTAGAAGGTGGG - Intronic
1050367293 9:4884378-4884400 TGGTGGTGGTATTAGGAGGTAGG - Intronic
1050529546 9:6576421-6576443 AGGTGACGGCATTAGGAGGTGGG - Intronic
1050640445 9:7661775-7661797 AGGTGATAGTATTAGGAGGTGGG - Intergenic
1050696373 9:8283741-8283763 ATGTGATAATATTAGGAGGTGGG - Intergenic
1051211744 9:14752282-14752304 AAGTGAAAGGATTAGGAGGGAGG + Intronic
1051224030 9:14879986-14880008 ATGTGATGGGATTAGGAGGTAGG + Intronic
1051608925 9:18942816-18942838 AAATGTTAGCATTGAGAGGTGGG - Intronic
1051722102 9:20047776-20047798 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1051740521 9:20247410-20247432 AGGTGATGGCATTAGGAGGTAGG + Intergenic
1051811725 9:21056957-21056979 AAGTGATAGTATTAGGAGGTGGG + Intergenic
1051829592 9:21260775-21260797 AAGTGATGGTATTAGAAGGTAGG + Intergenic
1052008094 9:23374659-23374681 ACGTGGTAGTATTAGGAATTGGG - Intergenic
1052074300 9:24121725-24121747 GGGTGATAGTATTAGGAGGTGGG + Intergenic
1052252253 9:26412153-26412175 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1052622392 9:30930311-30930333 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1053639750 9:40059992-40060014 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1053766383 9:41405489-41405511 ATGTGTTAGCATTTGGAGGTGGG - Intergenic
1054318926 9:63632475-63632497 AAGTGGTTACATCATGAGGTTGG + Intergenic
1054320498 9:63656296-63656318 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1054544999 9:66316648-66316670 ATGTGTTAGCATTTGGAGGTGGG - Intergenic
1054704550 9:68449197-68449219 ACGTGATATTATTAGGAGGTAGG - Intronic
1054935362 9:70681882-70681904 ATGTGATAGCTTTAGGAGGTGGG + Intronic
1054941565 9:70748530-70748552 AGATGATAGTATTAGGAGGTGGG + Intronic
1055392973 9:75843288-75843310 ACGTGATAGCATTTGGAGATGGG + Intergenic
1055570617 9:77613188-77613210 ATGTGATAGTATTTGGAGGTGGG - Intronic
1055716711 9:79126141-79126163 ATGTGGTAGTCTAAGGAGGTGGG + Intergenic
1055722633 9:79192925-79192947 AGGTGATGGCATTAGGAAGTAGG - Intergenic
1055726670 9:79237567-79237589 AGGTGATAGTATTAGGAGATGGG - Intergenic
1055824835 9:80311526-80311548 CAGTGATAGTATTAAGAGGTGGG + Intergenic
1056294008 9:85173380-85173402 ATGTGATAGTATTAAGAGGTGGG + Intergenic
1056315561 9:85386080-85386102 AGGTGGTGGTATTAAGAGGTGGG - Intergenic
1056423498 9:86453320-86453342 AGGTGATCGTATTAGGAGGTGGG - Intergenic
1056485648 9:87054574-87054596 AGGTGACAGTATTAGGAGGTGGG - Intergenic
1056543882 9:87596910-87596932 AGGTGGTCGCATTGAGAGGTTGG + Intronic
1056700417 9:88901086-88901108 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1057415484 9:94858664-94858686 ATGTGATGGGATTAGGAGGTGGG + Intronic
1057556401 9:96091691-96091713 ATGTGGTAGTATTAAGAGGTGGG + Intergenic
1057688786 9:97263765-97263787 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1057706347 9:97397797-97397819 ATGTGATAATATTAGGAGGTGGG - Intergenic
1057855055 9:98595322-98595344 AACTGATGGTATTAGGAGGTAGG - Intronic
1058048243 9:100380333-100380355 ATGTGACAGTATTAGGAGGTGGG - Intergenic
1058126513 9:101201242-101201264 AAGTGGTAGTATTGAGAGATGGG - Intronic
1058295758 9:103304217-103304239 ACGTGATGGTATTAGGAGGTGGG - Intergenic
1058339542 9:103877878-103877900 GTGTGGTAATATTAGGAGGTGGG - Intergenic
1058600154 9:106660287-106660309 ATGTGATGGCATTTGGAGGTGGG - Intergenic
1058850312 9:109005428-109005450 ATGTGATGGTATTAGGAGGTGGG + Intronic
1058890715 9:109358408-109358430 ATGTGATGGCATTAGGAAGTGGG + Intergenic
1059035593 9:110750717-110750739 AAATGGTAGCATGACAAGGTTGG - Intronic
1059465169 9:114464563-114464585 AGCTGATAGTATTAGGAGGTGGG - Intronic
1059508551 9:114822371-114822393 AAAGAGTAGCATAAGGAGGTGGG + Intergenic
1059544333 9:115161078-115161100 ATGTGATGGTATTAGGAGGTGGG + Intronic
1059882880 9:118711300-118711322 ATGTGATAGGATTTGGAGGTGGG - Intergenic
1059949671 9:119449155-119449177 ATGTGATAGGATTAGGAGGTGGG + Intergenic
1059983032 9:119794205-119794227 ATGTGATAGTATTAGGATGTGGG + Intergenic
1060121082 9:120990465-120990487 AGGTGATAGTATTAGAAGGTGGG + Intronic
1060326697 9:122623234-122623256 AGGTGATAGTGTTAGGAGGTGGG - Intergenic
1060500449 9:124149685-124149707 ATGTGATGGCATTAAGAGGTGGG - Intergenic
1060898366 9:127234896-127234918 ACGTGGTAGTATTAAGAGATGGG - Intronic
1060908162 9:127326713-127326735 ATGTGGTGGTATTAGGAGGTGGG + Intronic
1061111215 9:128572680-128572702 AAGTGGTAGCAGAGGAAGGTGGG + Intronic
1061223728 9:129267786-129267808 AGGTGGTGGCATGAGGAGGTGGG + Intergenic
1062079189 9:134611455-134611477 AGGTGGCAGTATTAAGAGGTGGG + Intergenic
1202787568 9_KI270719v1_random:43306-43328 ATGTGTTAGCATTTGGAGGTGGG + Intergenic
1185869653 X:3653145-3653167 AAGTGATAGGATTAGGAGGTGGG + Intronic
1185936383 X:4261830-4261852 ATGTATTAGTATTAGGAGGTGGG + Intergenic
1185970912 X:4662531-4662553 ATATGACAGCATTAGGAGGTGGG - Intergenic
1186026999 X:5324181-5324203 AGGTGATGGCATTAGGAGATGGG + Intergenic
1186057072 X:5661176-5661198 AGGTGACAGCATTAGGAGGTGGG + Intergenic
1186274997 X:7928850-7928872 AGGTGATAGTATTAGGAGGTGGG + Intergenic
1186408731 X:9327031-9327053 AGGTGAGAGTATTAGGAGGTGGG + Intergenic
1186450935 X:9673107-9673129 AGGGGATGGCATTAGGAGGTGGG - Intronic
1186468830 X:9805434-9805456 AGGTGATGGTATTAGGAGGTGGG + Intronic
1186557317 X:10573537-10573559 ATGTGGTGGCATTGGGAGGAGGG - Intronic
1186725723 X:12356463-12356485 AAGTGATGGTATTAGGAGGTGGG + Intronic
1186836221 X:13441122-13441144 ATGTGATAGTATTAGGAGGTGGG - Intergenic
1186963514 X:14762451-14762473 AGGTAGTAGCATTAAGAGTTGGG - Intergenic
1186987033 X:15028368-15028390 AGGTGATGGTATTAGGAGGTAGG + Intergenic
1187064836 X:15823179-15823201 AAGTCGTGGCAGGAGGAGGTCGG + Exonic
1187105515 X:16237559-16237581 ACGGGGTGGCATTAAGAGGTGGG - Intergenic
1187402571 X:18974793-18974815 ATGTGATGGCATTAGGCGGTGGG - Intronic
1187523570 X:20034518-20034540 TGGTGGTGGTATTAGGAGGTGGG + Intronic
1187592023 X:20727193-20727215 ATGTGGCAGCATTTAGAGGTGGG - Intergenic
1187677556 X:21732798-21732820 ATGTGATAATATTAGGAGGTGGG + Intronic
1187729220 X:22235637-22235659 ATGTGATGGCATTAGGAGTTGGG - Intronic
1187823749 X:23314602-23314624 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1188678146 X:32968641-32968663 AAGTGATAGTATTAGGAGATGGG + Intronic
1189074174 X:37898270-37898292 ATGTGATAGTATTAGGAGGTGGG - Intronic
1189158801 X:38788956-38788978 AAGTGATAGTATTTGGAGATGGG + Intergenic
1189170203 X:38901707-38901729 AGGTGATGGCATTAGGAAGTGGG + Intergenic
1189366880 X:40395643-40395665 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1189548830 X:42072193-42072215 AAGTGATGGTATTAGGAAGTAGG + Intergenic
1189666133 X:43356889-43356911 ATGTGATAGTATTACGAGGTGGG - Intergenic
1189668664 X:43384525-43384547 AGGTGATAGTATTAGGAGGTGGG + Intergenic
1189671330 X:43413393-43413415 ATGTGATGGGATTAGGAGGTGGG + Intergenic
1189773462 X:44449150-44449172 AGGTGGCAGTGTTAGGAGGTGGG + Intergenic
1189797437 X:44658976-44658998 ACGTGATGGTATTAGGAGGTGGG - Intergenic
1189834292 X:45005026-45005048 AAGAGGTACCATAAGGAGGGGGG - Intronic
1189920048 X:45894658-45894680 AAGTGGAAGCATTTGGAATTTGG + Intergenic
1190241076 X:48658680-48658702 ATGTGATAGTATTAGAAGGTGGG - Intergenic
1190372034 X:49751978-49752000 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1190950050 X:55134626-55134648 ATGTGATGGTATTAGGAGGTGGG - Intronic
1191971995 X:66827126-66827148 AGGTGATGGCATTAGGAGGTGGG - Intergenic
1192272666 X:69597405-69597427 ATGTGGTAGTATTAAGAGGTGGG - Intergenic
1192616791 X:72633212-72633234 ATGTGATAGCATTAAGAAGTAGG + Intronic
1193168922 X:78314185-78314207 ATGTGGAAGAATTAGGAGGAAGG + Intronic
1193234649 X:79092097-79092119 AAGTGGTGGTATTAAGGGGTGGG + Intergenic
1193943763 X:87707751-87707773 CAGTGGCAGCATTTGTAGGTAGG + Intergenic
1194001746 X:88438140-88438162 AAATGATAGAATTTGGAGGTGGG + Intergenic
1194083908 X:89502500-89502522 ATGTGGTAGTATTAATAGGTGGG + Intergenic
1194314423 X:92357451-92357473 AGGTGATAGTATTAGGAAGTGGG + Intronic
1194675950 X:96793733-96793755 ATGTGATTGTATTAGGAGGTGGG - Intronic
1194764406 X:97832666-97832688 AAGTAATAGTATTAGGAGATTGG - Intergenic
1194796911 X:98223229-98223251 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1194928359 X:99856799-99856821 AAGTGCTAACATTAGGGGCTTGG - Intergenic
1194945353 X:100060110-100060132 AAGTAGTAGGTTTAGGATGTGGG - Intergenic
1194957576 X:100198640-100198662 AGGTGATGACATTAGGAGGTTGG + Intergenic
1195069804 X:101267871-101267893 ATGTGTTAGTATTAAGAGGTAGG + Intergenic
1195125092 X:101800825-101800847 AGGTGATAGTATTTGGAGGTGGG + Intergenic
1195169601 X:102253107-102253129 AGGTGATGCCATTAGGAGGTGGG - Intergenic
1195179650 X:102344795-102344817 AGGTGATAGTATTTGGAGGTGGG - Intergenic
1195189256 X:102433992-102434014 AGGTGATGCCATTAGGAGGTGGG + Intronic
1195307450 X:103598380-103598402 AGGTGATAGTATTAGGAGTTGGG + Intergenic
1195651991 X:107294628-107294650 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1195779833 X:108449838-108449860 AGGTGATGGCATTAGGAGGTGGG - Intronic
1196076259 X:111579933-111579955 ATATGGCAGTATTAGGAGGTAGG - Intergenic
1196076358 X:111581215-111581237 ATATGGCAGTATTAGGAGGTAGG - Intergenic
1196081974 X:111642175-111642197 AAGTGATGGTATTAGGAGGTGGG - Intergenic
1196224688 X:113151981-113152003 ATGTGATAGTATGAGGAGGTGGG + Intergenic
1196407580 X:115380807-115380829 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1196822978 X:119718155-119718177 AAGTGATAGTATTAGGAGGTAGG - Intergenic
1196823389 X:119721661-119721683 AAGTGGTGGTGTTGGGAGGTGGG - Intergenic
1196964332 X:121039266-121039288 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1197017074 X:121637663-121637685 ATGTGATAGTATTAAGAGGTGGG - Intergenic
1197037461 X:121892192-121892214 ATGTGATAGTATTAGGAAGTGGG + Intergenic
1197121793 X:122901959-122901981 ATATGGTAGTATTAGGAGGTGGG - Intergenic
1197179250 X:123516765-123516787 ATGTGGTAGTATTAAGAAGTGGG - Intergenic
1197435841 X:126426880-126426902 AGGTGATGGTATTAGGAGGTAGG - Intergenic
1197787124 X:130209917-130209939 AAGTGATGGCATTAAGAGGTGGG + Intronic
1197824578 X:130575211-130575233 ATGTGATGGCATTAGGAGGTGGG - Intergenic
1198170596 X:134101670-134101692 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1198174587 X:134142900-134142922 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1198193585 X:134336519-134336541 AAGTGGGACCTTTAAGAGGTGGG - Intergenic
1198221857 X:134609860-134609882 ATGTGATGGCATTTGGAGGTGGG - Intronic
1198300777 X:135332357-135332379 AGGTGATAGTATTAGGAGGTGGG + Intronic
1198431348 X:136569739-136569761 AAGTGTTAGGATTAACAGGTGGG + Intergenic
1198463246 X:136882825-136882847 AGGTGATGGCATTAGGAGGCGGG + Intergenic
1198463957 X:136888229-136888251 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1198601124 X:138285295-138285317 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1198805827 X:140493427-140493449 AAGTGGTAAGATCAAGAGGTAGG - Intergenic
1198881961 X:141291492-141291514 AGGTGATGGCATTAAGAGGTGGG - Intergenic
1199045813 X:143170288-143170310 ATGTGATGGTATTAGGAGGTGGG - Intergenic
1199130219 X:144176219-144176241 ATGTGATGGTATTAGGAGGTAGG - Intergenic
1199156689 X:144557529-144557551 AAAGGTTAGTATTAGGAGGTGGG - Intergenic
1199191135 X:144972513-144972535 ATGTGGTGGTATTAGGAGGTGGG + Intergenic
1199211400 X:145215697-145215719 AGGTGATGGTATTAGGAGGTGGG + Intergenic
1199369668 X:147032808-147032830 ATATGATAGGATTAGGAGGTAGG + Intergenic
1199762458 X:150915606-150915628 ATGTGATGGTATTAGGAGGTGGG + Intergenic
1200180881 X:154150085-154150107 AGGTGATGGTATTAGGAGGTGGG - Intronic
1200186524 X:154187199-154187221 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1200192176 X:154224337-154224359 AGGTGATGGTATTAGGAGGTGGG - Intronic
1200197931 X:154262141-154262163 AGGTGATGGTATTAGGAGGTGGG - Intronic
1200326019 X:155240127-155240149 AGGTGATGGTATTAGGAGGTGGG - Intergenic
1200436555 Y:3158380-3158402 ATGTGGTAGTATTAATAGGTGGG + Intergenic
1200622481 Y:5468981-5469003 AGGTGATAGTATTAGGAAGTGGG + Intronic
1201148187 Y:11078019-11078041 ATGTGATGGCATTTGGAGGTAGG + Intergenic
1201227800 Y:11835000-11835022 AAGTGATGGCACTAGGAGGTGGG + Intergenic
1201446668 Y:14064495-14064517 AGGTGATGGCATTACGAGGTGGG + Intergenic