ID: 922728241

View in Genome Browser
Species Human (GRCh38)
Location 1:227936046-227936068
Sequence CTGCATAACAAGATGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922728241_922728251 16 Left 922728241 1:227936046-227936068 CCTTCCTGCATCTTGTTATGCAG 0: 1
1: 0
2: 3
3: 12
4: 173
Right 922728251 1:227936085-227936107 TGAGGTCGGCACCAGCTTGTTGG 0: 1
1: 0
2: 1
3: 5
4: 96
922728241_922728245 -2 Left 922728241 1:227936046-227936068 CCTTCCTGCATCTTGTTATGCAG 0: 1
1: 0
2: 3
3: 12
4: 173
Right 922728245 1:227936067-227936089 AGCAGGGCCTCCACCTCCTGAGG 0: 1
1: 0
2: 3
3: 41
4: 371
922728241_922728246 2 Left 922728241 1:227936046-227936068 CCTTCCTGCATCTTGTTATGCAG 0: 1
1: 0
2: 3
3: 12
4: 173
Right 922728246 1:227936071-227936093 GGGCCTCCACCTCCTGAGGTCGG 0: 1
1: 0
2: 2
3: 21
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922728241 Original CRISPR CTGCATAACAAGATGCAGGA AGG (reversed) Intronic
900981398 1:6048107-6048129 CTTCACAACAAGATGGTGGAAGG - Intronic
901874796 1:12161376-12161398 CTGCAGGAAAGGATGCAGGATGG - Intergenic
904999034 1:34653696-34653718 CTGCATAGTAAGATGAAGAAAGG + Intergenic
905341979 1:37284677-37284699 CAGACTAAGAAGATGCAGGATGG - Intergenic
905674950 1:39818525-39818547 CTGCATAAGACAGTGCAGGATGG + Intergenic
907277300 1:53323946-53323968 CTGAATACCAAGAGGCTGGAAGG - Intronic
908868947 1:68585500-68585522 CAGCATAACAAAATCCTGGACGG + Intergenic
910265089 1:85330144-85330166 ATGCAGAGAAAGATGCAGGAAGG + Intronic
911432824 1:97814129-97814151 CTGAATAGCAAGAAGCAGCAAGG + Intronic
911705028 1:101001107-101001129 CTCCCTAGGAAGATGCAGGATGG + Intronic
915696825 1:157751800-157751822 CTGCATCACAAGATGCAGGTAGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
917442721 1:175081167-175081189 GTACAGAACAAGATGGAGGATGG + Intronic
919835961 1:201573544-201573566 CTGCAAAACAGGAGGCAGGGAGG - Intergenic
920493023 1:206433164-206433186 CTGCAAAAAGAAATGCAGGAAGG + Intronic
921899380 1:220434576-220434598 GTCCAAAACAAGATGAAGGAAGG - Intergenic
921972459 1:221165148-221165170 CTTCATACCAAAATGAAGGAAGG + Intergenic
922509757 1:226154367-226154389 CTGCATAACAAATTACAGGCTGG - Intronic
922728241 1:227936046-227936068 CTGCATAACAAGATGCAGGAAGG - Intronic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1069190684 10:65484368-65484390 GTGCAGAACAAGATGCACGAGGG - Intergenic
1069571142 10:69495124-69495146 CTGTAAAACAAGAGGCTGGATGG + Intronic
1070717920 10:78735882-78735904 CTGAATACCAGGTTGCAGGAGGG + Intergenic
1071395738 10:85222024-85222046 ATTCTTAACATGATGCAGGAAGG - Intergenic
1074532207 10:114305495-114305517 CTGCAGGAGGAGATGCAGGAGGG + Intronic
1074990997 10:118707845-118707867 CTGCATAAAAAGGTGCACTAAGG + Intronic
1075053267 10:119199035-119199057 CTGCATCACAGGAGGGAGGAAGG - Intergenic
1075271872 10:121059462-121059484 CTGAATTACAAGATGGAGGAGGG + Intergenic
1075566229 10:123506440-123506462 CTGCATGGGAAGATGCAGGAAGG - Intergenic
1076533530 10:131160977-131160999 CCGCATATCACGCTGCAGGATGG - Intronic
1076590344 10:131578213-131578235 CTGCAGAACAAGAGGAAGGATGG - Intergenic
1077384520 11:2262732-2262754 CTGGATCACAACAGGCAGGACGG + Intergenic
1081233887 11:40621638-40621660 CTGAATTTCAAGATGCAGGAGGG + Intronic
1081975891 11:47234565-47234587 CTACAAAACCAGATGCTGGAGGG - Exonic
1082611009 11:55297478-55297500 CACCAGAACAAGATGCTGGAAGG - Intergenic
1085006216 11:73093098-73093120 CTGCATACCAAGACTCAGGTAGG + Intronic
1086353942 11:85972593-85972615 CTGCAAATCAAGATGCAGAGTGG + Intronic
1087490156 11:98815196-98815218 CTGCATGACAAGAGTCATGAAGG + Intergenic
1088356967 11:108954377-108954399 TTGCCTAATAAAATGCAGGAGGG - Intergenic
1089092136 11:115886722-115886744 CTCCAGAACAAGATACAGGTCGG - Intergenic
1091680266 12:2521999-2522021 CTGGAAAACAAGATGCAGTCTGG - Intronic
1091689795 12:2588187-2588209 CGGGAGAACAAGAAGCAGGAAGG - Intronic
1096077093 12:48812716-48812738 CTGCAGAGCAAGATGGAGAAGGG + Intergenic
1098251345 12:68572840-68572862 CTGCATTCCAAGCAGCAGGAAGG - Intergenic
1100882221 12:99031617-99031639 CTGCATTCCCAGATGGAGGAAGG - Intronic
1101416478 12:104513037-104513059 CTGCATACCTAGACTCAGGAGGG - Intronic
1101571012 12:105953818-105953840 TTGCAGAACAAGTTGCAGCACGG - Intergenic
1101805336 12:108058426-108058448 CTGCATAGCAGGAGGCAGGCAGG + Intergenic
1103200159 12:119081654-119081676 CTGGGGAACAGGATGCAGGAAGG + Intronic
1104074195 12:125375014-125375036 CTGCAGACCAAGATACAGAAAGG + Intronic
1107605887 13:42056262-42056284 CCTCATAACAAAAAGCAGGAGGG - Intronic
1107744932 13:43493966-43493988 CTTCTTCACAAGGTGCAGGAGGG + Intronic
1110165778 13:72441426-72441448 CTGTATAATAAGTTGCAGCAAGG + Intergenic
1117084903 14:52189828-52189850 CTGGATAACAAGATCTAGGTTGG - Intergenic
1119104797 14:71913797-71913819 TTGCTTAACAAGAAGCAGGGAGG - Intergenic
1119678184 14:76572082-76572104 CTTAATAAGAAGATGCAGGCTGG - Intergenic
1120800553 14:88683469-88683491 CTGTATAACATAATTCAGGAAGG - Intronic
1122573355 14:102724209-102724231 CTGCAAAACAAAATGAAGAATGG + Intronic
1122782538 14:104149738-104149760 CTGCACAGCAGGAGGCAGGAAGG - Intronic
1124365740 15:29070335-29070357 CTGGATACCGGGATGCAGGAGGG + Intronic
1125975747 15:43950039-43950061 CTGCATACCAAGAAGGAAGAAGG - Intronic
1128652201 15:69425557-69425579 CTGTATGACAAGATGAAGGTTGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1132113545 15:99119466-99119488 CTGGAAGACAAGATGAAGGATGG + Intronic
1135069810 16:19341986-19342008 CTGCATGCCAAGTAGCAGGAAGG - Intergenic
1135661594 16:24301743-24301765 CTGCATGCGAAGATGAAGGAAGG - Intronic
1139633403 16:68244319-68244341 CTGCTTACCAAGAAGAAGGAAGG + Intergenic
1141858064 16:86698252-86698274 CTGCTTAACAGGAAGCAGGCTGG - Intergenic
1145055159 17:19698066-19698088 CTACAAAACAAGCTGCTGGATGG - Intronic
1147648669 17:42049731-42049753 CTGCAGAACAAAAGGCAGGTAGG + Intronic
1147674936 17:42198635-42198657 ATGCAAAAGAACATGCAGGAAGG - Intergenic
1148026747 17:44593955-44593977 CTGAGGAACAAGTTGCAGGAAGG - Intergenic
1153169633 18:2301166-2301188 CTGCCTTTCAAGATGGAGGAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154290388 18:13101685-13101707 CTGAACAACAAGGTCCAGGAGGG - Intronic
1157404056 18:47408869-47408891 ATTCATAACAAGAGGGAGGAGGG + Intergenic
1158008825 18:52704960-52704982 CTTCATATTAAGATGCATGAAGG - Intronic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1160067854 18:75594175-75594197 CTGGTTTACAAGATGGAGGAAGG + Intergenic
1160622927 18:80183225-80183247 CTGCAAAACAAGCTGCAGATAGG + Intronic
1163481739 19:17560547-17560569 CTGCAAAACAACATTAAGGATGG - Intronic
1163592676 19:18203205-18203227 CTGCATCACATGATACAGGAGGG + Intronic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1165287541 19:34854181-34854203 CTGCATCAGAAGATGCAGGGTGG + Intergenic
1167766207 19:51484280-51484302 CTGGACTACAAGATTCAGGAGGG + Intronic
925024379 2:596110-596132 CTGCAAAACCAGATCCAGGCAGG + Intergenic
925024393 2:596172-596194 CTGCAAAACCAGATCCAGGCAGG + Intergenic
925024407 2:596234-596256 CTGCAAAACCAGATCCAGGCAGG + Intergenic
925132237 2:1502202-1502224 CTGCATAACGGGATGCAGGAGGG + Intronic
925835076 2:7936722-7936744 CTGCCTAATAAGTTGCAGAAGGG + Intergenic
926753822 2:16220371-16220393 CTGCCTGACAGGATGCAGGGTGG + Intergenic
928635616 2:33242969-33242991 CTGGAAAAGAAGATTCAGGAAGG - Intronic
930002844 2:46872859-46872881 CTGCATCACAACATGGTGGAAGG + Intergenic
930128160 2:47820384-47820406 CGGCATAACAAAATTCATGATGG - Exonic
932877040 2:75463619-75463641 ATGCATAAGGAGATGCAGGTTGG - Intergenic
933785602 2:85838761-85838783 CTGCACAAGCAGTTGCAGGAAGG + Intergenic
934909921 2:98242329-98242351 CTTCATTACAAGATGCAAAATGG + Intronic
941039847 2:160608930-160608952 CTGCAAAACATGAAGCAGGCAGG - Intergenic
942028411 2:171934407-171934429 TACCATAACAAGATGAAGGAGGG + Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
945883141 2:215347523-215347545 GTGCCTAACAAAATGCTGGATGG + Intronic
947025132 2:225729464-225729486 CTGCCTGACAAGAAGCAAGAGGG + Intergenic
1169954982 20:11091826-11091848 TTGCATAACAATCTCCAGGAGGG - Intergenic
1171058659 20:21934024-21934046 CTGCATTCCAACATGGAGGACGG - Intergenic
1173324244 20:42018246-42018268 CTGCAGAACAAGAAGCATGCAGG - Intergenic
1174756107 20:53160133-53160155 CTGAAGAACAGAATGCAGGAGGG + Intronic
1176991969 21:15507878-15507900 CTGCATCATAAGATGGTGGAAGG - Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1180161981 21:46002195-46002217 CTGCATAGCAAAGGGCAGGAAGG - Intronic
1181326147 22:22048069-22048091 CTTCATCCCAGGATGCAGGATGG - Intergenic
1181495090 22:23283212-23283234 ATGCAGACCAAGATGCAGAAAGG + Intronic
1183553427 22:38506713-38506735 CTTGATAACAATATGGAGGACGG - Intronic
1185202746 22:49518036-49518058 GTGCATGACAGAATGCAGGAGGG - Intronic
950648276 3:14391465-14391487 CTTACTGACAAGATGCAGGACGG - Intergenic
950739010 3:15034788-15034810 CTGCAGAACAGCATCCAGGAAGG + Exonic
953366973 3:42353377-42353399 CTGCAGAGCAGGATGCAGGGTGG - Intergenic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
962309913 3:134318259-134318281 CTGCATTACAGGCGGCAGGATGG - Intergenic
962592931 3:136909036-136909058 CTACATAACAACAAGGAGGAAGG - Intronic
963490619 3:145995553-145995575 CTGGATATGAAGATGGAGGAAGG - Intergenic
964544916 3:157823215-157823237 CTGCATCACAATATGAAGCAAGG - Intergenic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
970730050 4:19091963-19091985 CTGTATCCCAAGATCCAGGATGG - Intergenic
973344088 4:49035953-49035975 CTACTTAACAAGATGCTGGAGGG + Intronic
976598997 4:86920621-86920643 CTGCATCACAACATGGTGGAAGG + Intronic
979513564 4:121581522-121581544 CTGGATAACAAGCTACATGAAGG + Intergenic
983329269 4:166303519-166303541 CTGCTTGAAAAGATGCAGAATGG + Intergenic
986401558 5:7386810-7386832 TTCCATAACAAGAAGCAGAAGGG - Intergenic
987191332 5:15481464-15481486 CTCCAGACCAAGATGCAGTAAGG - Intergenic
988503039 5:31799303-31799325 CTGCAGAACAGCCTGCAGGAAGG + Exonic
989306692 5:39966038-39966060 CTGTTTAAAAAGATGCAGGAAGG - Intergenic
990087469 5:51996338-51996360 CTGCATCCAAAGATGCAGTATGG + Intergenic
990192814 5:53279556-53279578 CTGCATACCAAAATCCAGAAGGG - Intergenic
990890392 5:60642543-60642565 CTTCATCACAGGATGAAGGATGG - Intronic
991689359 5:69211617-69211639 CTGCATGAAAGGATGCAGAAAGG - Intergenic
991692536 5:69238856-69238878 CAGAATAACAAGTTGCAGGCTGG - Intronic
996427202 5:123327130-123327152 CTGCATAAAATGATGTAGGGAGG + Intergenic
996937296 5:128964279-128964301 CTGCAGAACATGAGGCAGAAGGG + Intronic
997477357 5:134152025-134152047 GTGCATATCAAGATGAAGTATGG - Exonic
998439758 5:142148401-142148423 CTTCATAACAAAATGCCAGAAGG + Intronic
998595772 5:143528492-143528514 CTGAATGACAAGATGCAGTTAGG + Intergenic
1003284262 6:4721131-4721153 CAGGATAACCATATGCAGGAAGG + Intronic
1003665926 6:8111348-8111370 CTGCACAGCCAAATGCAGGAAGG - Intergenic
1003790694 6:9544068-9544090 CTGAATGACAAGAGGCAGGTCGG + Intergenic
1008852184 6:56035733-56035755 CTGCATTTCAAGATACAGAAAGG - Intergenic
1009631894 6:66210632-66210654 CAGCAAAACAAGATCCAAGAAGG - Intergenic
1011391244 6:86856066-86856088 ATGCATCATAAGATTCAGGATGG + Intergenic
1013866279 6:114700576-114700598 ATGCATACCAAGAAACAGGAAGG - Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1015378705 6:132541182-132541204 CTGCATACCAAGTTGCTGCAGGG + Intergenic
1016787384 6:148026736-148026758 CTGCAACACAAGCTCCAGGAAGG - Intergenic
1018517817 6:164606209-164606231 CTGGATTAGAAGATGAAGGAAGG + Intergenic
1020972014 7:14955609-14955631 CTGCCCAACAAGATGCTGGAAGG + Intronic
1022176044 7:27872861-27872883 CTGCATAAAAAGATAGGGGATGG + Intronic
1022514647 7:30967713-30967735 CTGCATAAAAAAAGGAAGGAGGG - Intronic
1022872618 7:34495047-34495069 CTGCAGAACATGATCCAGTAGGG - Intergenic
1025116559 7:56263385-56263407 CAGCAAAAGATGATGCAGGAGGG - Intergenic
1026901707 7:74040934-74040956 CTGGCTAACAAGATTCAGCAGGG - Intronic
1030498159 7:110326180-110326202 CTGCATATTAAGATGGAGCATGG + Intergenic
1030507553 7:110443918-110443940 CTGGATTCAAAGATGCAGGAGGG - Intergenic
1030886189 7:114940914-114940936 CTGGATAACAAGATGGAATAGGG - Intronic
1037751193 8:21683448-21683470 CTTCATATCAAGATGCAGGAGGG + Intergenic
1041333224 8:56751140-56751162 CTGCATCATAACATGGAGGAAGG + Intergenic
1044712145 8:95068220-95068242 ATGCATAAGAAGATGCTGAAAGG - Intronic
1044933913 8:97275999-97276021 CTGCAGAACATCAAGCAGGATGG + Exonic
1046611345 8:116429083-116429105 TTGAATAACAAGATAAAGGAAGG - Intergenic
1051433750 9:17007857-17007879 CTGTATAACCAGCTGAAGGAGGG + Intergenic
1052059679 9:23945220-23945242 CAGCAAAACAAGATCCAAGAAGG + Intergenic
1055313844 9:75013129-75013151 CAGCAGAAAAAGATGCATGATGG + Intronic
1055894099 9:81155913-81155935 CTGCAAGACAAGATGAAAGAGGG - Intergenic
1056106623 9:83353449-83353471 ATGGATGACAAGATGCATGAGGG + Intronic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1062527891 9:136985619-136985641 CTGCAAAACAAGGAGCAGGTGGG - Exonic
1187676011 X:21717300-21717322 CTTCTTCACATGATGCAGGAAGG - Intronic
1188583598 X:31745584-31745606 CTTCTTAAAAAGATGCATGAAGG - Intronic
1192388480 X:70698846-70698868 TTGCATATCAAGATGGAGGTGGG + Intronic
1193476741 X:81975399-81975421 CTGCATTATAAGATCCAGTATGG + Intergenic
1194235251 X:91374951-91374973 CTGCATAACAACATGATGGCAGG + Intergenic
1195096655 X:101507862-101507884 CTGCATAACAACATCAATGATGG + Intronic
1195959654 X:110372419-110372441 GTGCATAAAAAGATACTGGAAGG - Intronic
1196188816 X:112773534-112773556 CTGCAGAATAAGATGGAGGTGGG + Intergenic
1196196329 X:112841308-112841330 CTGCTTAAAATAATGCAGGAAGG + Intergenic
1196366544 X:114930744-114930766 CTGCATCATAATATGGAGGAAGG + Intergenic
1196949694 X:120864853-120864875 CTTCTTCACAAGGTGCAGGAAGG - Intergenic
1197316814 X:124976760-124976782 CTACATAACCAGATGAAAGAGGG + Intergenic
1197651442 X:129069417-129069439 CTGCTTAACAAGATGGGGGAAGG + Intergenic
1199684971 X:150257643-150257665 CTGGAGAACAAGATGGAGAAGGG - Intergenic
1200058531 X:153473893-153473915 CTGCATGCCAGGATGCAGGGTGG - Intronic