ID: 922728244

View in Genome Browser
Species Human (GRCh38)
Location 1:227936051-227936073
Sequence CTGCATCTTGTTATGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922728236_922728244 10 Left 922728236 1:227936018-227936040 CCTTCAGAGCCCACGCTCTGCCC 0: 1
1: 0
2: 2
3: 36
4: 331
Right 922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG 0: 1
1: 0
2: 4
3: 10
4: 140
922728234_922728244 21 Left 922728234 1:227936007-227936029 CCTCCATGGCACCTTCAGAGCCC 0: 1
1: 0
2: 2
3: 18
4: 215
Right 922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG 0: 1
1: 0
2: 4
3: 10
4: 140
922728239_922728244 -10 Left 922728239 1:227936038-227936060 CCCTCACTCCTTCCTGCATCTTG 0: 1
1: 0
2: 5
3: 52
4: 636
Right 922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG 0: 1
1: 0
2: 4
3: 10
4: 140
922728238_922728244 0 Left 922728238 1:227936028-227936050 CCACGCTCTGCCCTCACTCCTTC 0: 1
1: 0
2: 1
3: 64
4: 769
Right 922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG 0: 1
1: 0
2: 4
3: 10
4: 140
922728235_922728244 18 Left 922728235 1:227936010-227936032 CCATGGCACCTTCAGAGCCCACG 0: 1
1: 0
2: 1
3: 21
4: 190
Right 922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG 0: 1
1: 0
2: 4
3: 10
4: 140
922728237_922728244 1 Left 922728237 1:227936027-227936049 CCCACGCTCTGCCCTCACTCCTT No data
Right 922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG 0: 1
1: 0
2: 4
3: 10
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922728244 Original CRISPR CTGCATCTTGTTATGCAGCA GGG Intronic
907595255 1:55713629-55713651 CTGCCTCTTATTCTGCAGCTGGG - Intergenic
907859363 1:58336258-58336280 TTGCATCTTGTTAATCATCATGG + Intronic
910652432 1:89583920-89583942 CTGCATCTTTTTATGCTCAACGG + Exonic
911683820 1:100749962-100749984 TTGCATTTTCTAATGCAGCATGG + Intergenic
913533750 1:119751832-119751854 ATGCATGTTGTTTTGCAGCATGG - Intronic
915083743 1:153370120-153370142 CTGGATCTTCTTCAGCAGCAGGG - Intergenic
915840037 1:159206021-159206043 CTGCACCCTGATATACAGCACGG + Exonic
917865143 1:179187216-179187238 CTGCATCTGGTATTGCAGAAAGG - Intronic
919007173 1:191912096-191912118 CTGCATCTTGTTATTAGGCCAGG - Intergenic
919601665 1:199630797-199630819 CTACATTTATTTATGCAGCAGGG - Intergenic
920931548 1:210393623-210393645 CTGCATCTTGTTACCAGGCAGGG + Intronic
922349002 1:224720648-224720670 CTGCCTCTAGTTACTCAGCACGG - Intronic
922728244 1:227936051-227936073 CTGCATCTTGTTATGCAGCAGGG + Intronic
1069080694 10:64085370-64085392 CTGCACCTTGCTCTGCTGCATGG - Intergenic
1070964636 10:80522172-80522194 CTGCATCTTATATTCCAGCAGGG + Exonic
1071011654 10:80947479-80947501 CTGCAACTTGTTTATCAGCAAGG + Intergenic
1071675405 10:87651169-87651191 CTGCATCCTGTTAATCAGCAAGG - Intergenic
1071838477 10:89444014-89444036 GTTCTTCTTGTTATCCAGCATGG - Intronic
1073959061 10:108904994-108905016 CTGCATCCTCTTATGCAGCTGGG - Intergenic
1077921546 11:6645538-6645560 CTTCATCTTTGTATGTAGCATGG + Intronic
1078035974 11:7805884-7805906 CTGCATCTTGTCCTGCAACCTGG + Intergenic
1079250458 11:18783226-18783248 CTGCCTCATGATAAGCAGCAAGG + Intronic
1079930124 11:26548285-26548307 CAGCACATTGTTATTCAGCAAGG + Intronic
1084099066 11:66933573-66933595 CTTCATCTTGAAATGCAGGATGG - Intronic
1085047878 11:73363825-73363847 CTGCATCTTGTAAGGCCCCAGGG + Exonic
1087485934 11:98759479-98759501 CTCCATCTTGTTTTGCATCCTGG + Intergenic
1089315693 11:117589536-117589558 CTGCGTCTTCGTATGCACCAGGG + Intronic
1089570174 11:119402599-119402621 CTGCACCTTCCTAAGCAGCAAGG - Intergenic
1091494759 12:962542-962564 TTTCATCTTGTTAGGCAGGATGG + Intronic
1092386501 12:8039611-8039633 CTACATCTTATTGTGGAGCAGGG - Intronic
1093555341 12:20466150-20466172 CTGAACCGTGTTATGCAACATGG + Intronic
1094140237 12:27173248-27173270 CTCCATCTTGTTTTCCAGAATGG + Intergenic
1094272021 12:28627410-28627432 CTGCATATTCTTATGCAGAGAGG + Intergenic
1095442831 12:42255063-42255085 CTGCATCTTGTAAGATAGCATGG + Intronic
1098491023 12:71078302-71078324 CTGCATCTTGATGTGCAAAATGG - Intronic
1098532513 12:71557019-71557041 CTGCATCCTCTCATTCAGCAGGG - Intronic
1099018769 12:77377773-77377795 CTGCATCTTGTATTGTTGCAAGG + Intergenic
1099415147 12:82375319-82375341 CTACATCTTCACATGCAGCAGGG - Intronic
1099620712 12:84999780-84999802 CTGCACCTTATTCTGCAGTAAGG + Intergenic
1101571014 12:105953823-105953845 CTGCAACTTGTTCTGCAACAGGG + Intergenic
1102588116 12:113937323-113937345 CTGCACCCTGAGATGCAGCATGG - Intronic
1109030637 13:57183695-57183717 CTGAATTATGTTATGCAGGAAGG - Intergenic
1112813175 13:103242742-103242764 CTGTATCTTCTTCTTCAGCAGGG + Intergenic
1113761524 13:112851019-112851041 CTGCATTGTGTTCTGCAGGAGGG + Exonic
1115331012 14:32198489-32198511 CTGTATCATTTAATGCAGCATGG - Intergenic
1120280893 14:82436560-82436582 CTCCATCTTGAAATCCAGCAAGG - Intergenic
1122178926 14:99940776-99940798 CCGCATCTGGTTAGGCAGGACGG - Exonic
1123837696 15:24212623-24212645 CTGCTTGTAGTTTTGCAGCATGG - Intergenic
1132655230 16:1039174-1039196 CTGCCTCTCGTTCCGCAGCAGGG - Intergenic
1137411932 16:48235951-48235973 TTCCATGTTCTTATGCAGCAGGG + Intronic
1138046071 16:53726725-53726747 CTGCCTATTGTGAAGCAGCAAGG - Intronic
1138778320 16:59752441-59752463 CTCCATCTTCTTAACCAGCAAGG + Intronic
1138780004 16:59772329-59772351 ATGCCTCTTGTCATCCAGCAGGG + Intergenic
1139317212 16:66083492-66083514 CTGCCCCTTGTTATGTAGGAAGG + Intergenic
1140075885 16:71698406-71698428 GTGCTCCTTGTTATGCAGCTTGG + Intronic
1147378693 17:40039041-40039063 CTGCAGGTTGGTATCCAGCAAGG - Intronic
1147648667 17:42049726-42049748 CTGCCTTTTGTTCTGCAGAATGG - Intronic
1148435304 17:47679580-47679602 ATGCATCTAGTTATCCAGCTTGG + Intronic
1150103554 17:62444821-62444843 CTGCATCCTGTGGAGCAGCAGGG - Exonic
1150216787 17:63475835-63475857 GTGCACCTTGCTGTGCAGCATGG - Intergenic
1150283503 17:63943085-63943107 CTGGATCTTGTTCTGCAGCATGG + Exonic
1150509281 17:65732343-65732365 CTGCAGCTTGGTTTACAGCATGG - Intronic
1152683444 17:81682065-81682087 CTGCAAGTTGTTCTGCAGAAAGG + Exonic
1154391307 18:13938796-13938818 CTGCAGCTGTTCATGCAGCATGG + Intergenic
1156684142 18:39623799-39623821 CAGCATCTTGTTTTGAAGCATGG + Intergenic
1156874025 18:41984155-41984177 CTGCATTCTGTTAAGCAGAAAGG - Intronic
1157694418 18:49709464-49709486 CTTTATCTTGTTATGCTTCAAGG - Intergenic
1157773365 18:50370652-50370674 GTGCATCTTGTTAAGAAGTAGGG + Intergenic
1158224872 18:55190314-55190336 CGGCCTCTTGCTATGCAGCCCGG - Intergenic
1159531962 18:69666307-69666329 CTGATCCATGTTATGCAGCAGGG - Intronic
1161450755 19:4344062-4344084 CTGAAGCTTGTCCTGCAGCAAGG - Intronic
1162477469 19:10909119-10909141 CTGCATCATGTTCTGCTGCTGGG - Exonic
1166221419 19:41367238-41367260 GTACATCTTGCTATGCTGCAGGG + Intronic
1166461241 19:42990493-42990515 TTTCATCTTGTTATCCAGGATGG - Intronic
1168039585 19:53747385-53747407 TTTCATCTTGTTAGGCAGGATGG + Intergenic
925753139 2:7107983-7108005 CTGCATCATGGCCTGCAGCAGGG - Intergenic
925839431 2:7977876-7977898 CTGAATGTTATTATGGAGCATGG + Intergenic
931001372 2:57787519-57787541 TTGCATCTTGTTACACTGCATGG - Intergenic
932404263 2:71503288-71503310 CTGCTTCTTGGTGTCCAGCAGGG - Exonic
935990190 2:108712464-108712486 CTGCTCCTTGTTCTGCAGCTTGG + Intergenic
940286045 2:152033904-152033926 CTGCATCTTGTTAATAAGGAAGG - Intronic
943575436 2:189626004-189626026 CTGCATCTTGTCATCAATCATGG - Intergenic
946277740 2:218643716-218643738 CTGCTTCTTGTGATGCAGGTGGG + Exonic
947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG + Intergenic
947947611 2:234120044-234120066 CTGCAGCTTGTTGTGCATAAGGG + Intergenic
1174308293 20:49630894-49630916 CTGCCCCTTGTTCTGGAGCACGG - Intergenic
1175150067 20:56926681-56926703 CTGCTTAGTGTTCTGCAGCATGG + Intergenic
1176282885 20:64324957-64324979 CTCCATCTTGTCCTGCATCATGG + Intergenic
1177553795 21:22662304-22662326 CTGCATCATGTGATGCAGCATGG - Intergenic
952175929 3:30862894-30862916 CAGCATCTTGTTTAGCATCAGGG + Intronic
952774631 3:37032887-37032909 CAGCATCTTTTTCTGCAGCAAGG - Intronic
952997982 3:38903901-38903923 CTCCATCTTGTGATGCTCCATGG + Exonic
953813905 3:46137439-46137461 CTGCGTCTTGCCATGAAGCATGG + Intergenic
955679443 3:61485335-61485357 CTGCAGCTAGTTATCCAGAAAGG - Intergenic
957003018 3:74908805-74908827 AGGCATCATGTTATGAAGCAAGG + Intergenic
957483587 3:80829733-80829755 TTGCACCTTGTTATCCAGGATGG + Intergenic
960388130 3:117045567-117045589 CTGCAGCTTGCCATGCAGGATGG + Intronic
962151046 3:132893670-132893692 CTGCATCTTGGGATGGACCATGG - Intergenic
962443249 3:135442614-135442636 CTCCATCTCCTGATGCAGCATGG - Intergenic
962706989 3:138053108-138053130 CTGCATCTTTACATCCAGCAGGG + Intergenic
963953469 3:151227736-151227758 CTGCATCTTGGTAGTCAGGATGG + Intronic
965351163 3:167613363-167613385 CTGCAGCTTGTTCTGTAGCATGG - Intronic
969135182 4:5023544-5023566 CTGTACCTTCTTATGCAGAACGG + Intergenic
973933914 4:55822457-55822479 TAGCATCTTCTTATGAAGCAGGG + Intergenic
975971517 4:80043962-80043984 CTGCCTCTTGTCATGTAGAAAGG - Intronic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978442301 4:108746293-108746315 ATGCATCTTGTTATTCATGATGG - Intronic
982084923 4:151824694-151824716 TTCCACCTTATTATGCAGCACGG - Intergenic
987620272 5:20331249-20331271 CTACATATTGTTATGCAAAAAGG - Intronic
989306143 5:39958909-39958931 CTGCATTTTGTAATGCAGCAAGG + Intergenic
989442160 5:41485713-41485735 CTATATCTGGTTATGCAGCCCGG + Intronic
990354454 5:54952171-54952193 CTGCATCTTTTTATGCAGAAAGG + Intergenic
990984857 5:61631916-61631938 CAGCATATTTTTATGAAGCATGG + Intergenic
995294806 5:110507269-110507291 ATGCATACTGTTATGAAGCAAGG - Intronic
996362452 5:122664997-122665019 CTGGATTTTGGTATCCAGCAGGG + Intergenic
998301705 5:141028125-141028147 CTGAATGTTGTTAGGCAGAAGGG - Intergenic
998539803 5:142969982-142970004 TTGCATCTTGGTAGGCAGAAAGG + Intronic
1002326912 5:178415712-178415734 CTGCATCCCCTTGTGCAGCAGGG - Intronic
1003712902 6:8613577-8613599 CTGCATCTTGTAGTGCACTAAGG - Intergenic
1006379294 6:33688390-33688412 CTCCATCTCGTTGTGCAGGAAGG - Exonic
1014918906 6:127189172-127189194 CTTCACCTTGATCTGCAGCAGGG + Intronic
1015010371 6:128339098-128339120 CTGTATTTTATTATGGAGCATGG + Intronic
1015507337 6:134002796-134002818 CTGCTTCTTGTGATGCATCTTGG - Intronic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1017206760 6:151810389-151810411 CTGCCTGTTATTATCCAGCAAGG + Intronic
1018232472 6:161688794-161688816 GTGCACCTTGTTCTGAAGCAAGG + Intronic
1026901710 7:74040939-74040961 CTGAATCTTGTTAGCCAGCAGGG + Intronic
1028011852 7:85655495-85655517 CTGCATTTTGTCATGGAGCTCGG - Intergenic
1028270774 7:88786110-88786132 CTGCATTTAGTTATTCAGCAAGG - Intronic
1030307193 7:108030881-108030903 TTGCAACTTGGTCTGCAGCAGGG + Exonic
1032469539 7:132168393-132168415 CTCCAGCTTGCTCTGCAGCACGG + Exonic
1032798812 7:135301571-135301593 CTGCCTCTGGTTCTGCAGAAAGG - Intergenic
1036101629 8:5793319-5793341 CTGCTTATTGTTATGTTGCAAGG - Intergenic
1037498613 8:19464228-19464250 ATGCTTCTTGTTATCCAGCTGGG - Intronic
1042474684 8:69233783-69233805 CTGCATCTTTATATGGAGTAAGG + Intergenic
1044317874 8:90770677-90770699 CTGTGTCTTGCTGTGCAGCAAGG - Intronic
1045284638 8:100779876-100779898 CTGCTTTTTTTGATGCAGCATGG + Intergenic
1048007381 8:130430555-130430577 CTGAAGCTTGTTAAGCAGGAAGG + Intronic
1048928476 8:139291755-139291777 CAGCATCTTTTTAGGCACCAGGG + Intergenic
1055022889 9:71688935-71688957 CTGCCTCTGGTTATGCAGATAGG - Intronic
1055131271 9:72778200-72778222 CTGCATCTTGTTAGCCATCTTGG - Intronic
1055726463 9:79235386-79235408 TTGCATATTTTTATACAGCAAGG - Intergenic
1056950033 9:91034508-91034530 CAGCATCTGGGTCTGCAGCAAGG - Intergenic
1058087086 9:100759540-100759562 CTGCCTATTGCTATGCAACAAGG + Intergenic
1058316789 9:103578331-103578353 CTGCATATGGTTATGCAGTTTGG - Intergenic
1186753867 X:12649509-12649531 CTGCAACTCGGTCTGCAGCAAGG + Intronic
1189012514 X:37060670-37060692 CTGCATTCTAATATGCAGCAAGG + Intergenic
1190543045 X:51497256-51497278 CTGCATCATGTGACTCAGCAAGG - Intergenic
1194719221 X:97321139-97321161 CTGAATCATGTTATGCACTAGGG + Intronic
1196188813 X:112773529-112773551 CTCCATCTTATTCTGCAGTAAGG - Intergenic
1196651548 X:118173276-118173298 CTGGATGTTGTTATGGAGGAGGG - Intergenic
1198974189 X:142317224-142317246 CTGTATATGGTTATGCAGCTAGG - Intergenic
1199076722 X:143534090-143534112 CTGGCTCTTGTTATTCACCATGG - Intergenic
1199748753 X:150794462-150794484 CTGATTTTTGTTATGCAGCAAGG + Intronic
1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG + Intronic