ID: 922728779

View in Genome Browser
Species Human (GRCh38)
Location 1:227939433-227939455
Sequence GCTTGGGGATTGGGCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 179}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922728768_922728779 17 Left 922728768 1:227939393-227939415 CCGCTCCTCTGGCTAGGCCTGAT No data
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
922728766_922728779 19 Left 922728766 1:227939391-227939413 CCCCGCTCCTCTGGCTAGGCCTG No data
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
922728767_922728779 18 Left 922728767 1:227939392-227939414 CCCGCTCCTCTGGCTAGGCCTGA 0: 1
1: 0
2: 0
3: 31
4: 212
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
922728764_922728779 21 Left 922728764 1:227939389-227939411 CCCCCCGCTCCTCTGGCTAGGCC 0: 1
1: 0
2: 1
3: 14
4: 225
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
922728765_922728779 20 Left 922728765 1:227939390-227939412 CCCCCGCTCCTCTGGCTAGGCCT 0: 1
1: 0
2: 0
3: 14
4: 195
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
922728769_922728779 12 Left 922728769 1:227939398-227939420 CCTCTGGCTAGGCCTGATGCTGC 0: 1
1: 0
2: 2
3: 12
4: 180
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
922728771_922728779 0 Left 922728771 1:227939410-227939432 CCTGATGCTGCCATGTCCTGGCT 0: 1
1: 1
2: 8
3: 37
4: 284
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179
922728775_922728779 -10 Left 922728775 1:227939420-227939442 CCATGTCCTGGCTGCTTGGGGAT 0: 1
1: 0
2: 2
3: 28
4: 207
Right 922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG 0: 1
1: 0
2: 0
3: 19
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922728779 Original CRISPR GCTTGGGGATTGGGCCACCC TGG Intronic
900161387 1:1225588-1225610 GGCTGGGGACGGGGCCACCCGGG + Intronic
903369417 1:22825685-22825707 GCCAGGGGCTAGGGCCACCCTGG + Intronic
906117797 1:43367512-43367534 GCTTGGGGAGAGGTCCTCCCAGG - Exonic
906241982 1:44247868-44247890 GCCTGGGGACTGGGGCACGCGGG + Intronic
906316543 1:44789934-44789956 GCTTGGGAATTGGACAAACCTGG + Intergenic
908194681 1:61737247-61737269 TCTTGGGGAGTGGGACACACTGG - Intergenic
909183069 1:72449771-72449793 GCCTGGGGACTAGTCCACCCAGG + Intergenic
909712325 1:78666028-78666050 GCTTGGGGGATGGGCATCCCTGG + Intergenic
910946739 1:92600831-92600853 GCCTGGGGGTTGGGAAACCCTGG + Intronic
912321501 1:108717906-108717928 GCCTGGGGAATTGGCCACCGTGG - Exonic
914430824 1:147619378-147619400 GCTTTGGGATTGGGCCATCATGG - Exonic
915191760 1:154156634-154156656 GCTTTGGGTTTGTGGCACCCTGG - Intronic
915233495 1:154463656-154463678 GCTTGGGGCACTGGCCACCCTGG + Intronic
916418647 1:164615875-164615897 ACTTTGGGATTTGGCCTCCCTGG + Intronic
916566578 1:165984009-165984031 GGGTGGGGATTGGGCCCCCAAGG + Intergenic
919852655 1:201683663-201683685 GCCTGGGGATTGGGAAGCCCTGG + Intronic
920397915 1:205660063-205660085 GCGTGGGGTTTGGGCCATCAGGG - Intronic
922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG + Intronic
923338661 1:232990411-232990433 GCCGGGGGATTGGGGCACCAAGG + Intronic
1064148887 10:12846943-12846965 ACTTAGGGATTAGGCAACCCTGG + Intergenic
1067278080 10:44851959-44851981 GCCTGGAGAAGGGGCCACCCAGG + Intergenic
1068415932 10:56723055-56723077 GCCTGGGGATTGGGGACCCCTGG - Intergenic
1069916191 10:71788840-71788862 GGTTGGGGATTGGGGCACAGAGG - Intronic
1070266190 10:74905541-74905563 GCTTGGGAATTGGGCTGCCTAGG + Intronic
1070334850 10:75446204-75446226 GCTTTGGGGTTGGACCATCCTGG + Intronic
1071452559 10:85810898-85810920 GCTTGGGGACTGGCTCACCGGGG - Intronic
1071517730 10:86310186-86310208 GCTTGGGGATGGGGCCAGGAAGG - Intronic
1072296861 10:94017090-94017112 GGTTGGGGGTGGGGCTACCCAGG - Intronic
1073139558 10:101238393-101238415 GCTTGGGGACTAGGCCCCACAGG - Intergenic
1077304702 11:1863900-1863922 GCTGGGGGGTTGGGCCCACCAGG + Intronic
1079098105 11:17524005-17524027 GCTTTGGGATTGGACCACCTAGG + Intronic
1079225796 11:18603692-18603714 GCTTAGGCATTTGGCCTCCCAGG - Intergenic
1084175472 11:67420336-67420358 CCTGGGGGCCTGGGCCACCCTGG - Intronic
1084950444 11:72662373-72662395 GCCTGGGCCTTGGGCCTCCCTGG - Intronic
1088858741 11:113780208-113780230 GATTGTGGCATGGGCCACCCAGG - Exonic
1089860756 11:121588200-121588222 GCATGGGGGTTTGGCCACCCTGG + Intronic
1090398821 11:126435568-126435590 GCATGGGGATGGGGGCACCAAGG + Intronic
1091551038 12:1535001-1535023 GCTTTGGGCTTGGGCCTGCCAGG + Intronic
1092930692 12:13312702-13312724 GGTTGAGGATTAGGCAACCCAGG + Intergenic
1093542068 12:20299053-20299075 CCTTGGGGATTGGGCATTCCTGG + Intergenic
1096677887 12:53235236-53235258 GCTTGGGGACCAGGGCACCCAGG + Intergenic
1096976708 12:55703534-55703556 GCTTGGGGATGGGGCCAAGGAGG - Intronic
1097029615 12:56081409-56081431 GCTTGGGGTTTGGCACAGCCAGG + Intronic
1097354621 12:58587249-58587271 GCCTGGGGATTGGGGACCCCTGG + Intronic
1098704002 12:73664762-73664784 CCTTGGGGAATGGGCATCCCTGG - Intergenic
1100386682 12:94110399-94110421 GCTTGGGGGTTGGGGACCCCTGG - Intergenic
1102219931 12:111187566-111187588 GGCTGGGGATTGGGGTACCCTGG + Intronic
1103353689 12:120303849-120303871 GCTGGCGGATTGGGGCACTCCGG - Exonic
1104297407 12:127529287-127529309 GCTTGGAGATAGGGCCAATCAGG + Intergenic
1104803886 12:131572595-131572617 GCTTTGGGAGTTGGCCCCCCAGG + Intergenic
1107338380 13:39380328-39380350 GCTCGGGGGTTGGGTCCCCCTGG - Intronic
1108884628 13:55164998-55165020 CCTTGGGGGTTGGGCGACCCTGG - Intergenic
1113507039 13:110824157-110824179 GCTTAGAGATTGGACCAGCCTGG - Intergenic
1118471624 14:66079943-66079965 GCATGGGGAAAGGGGCACCCAGG - Intergenic
1119229692 14:72970354-72970376 GCCTGGGGAGTGAGCCTCCCTGG - Exonic
1121550672 14:94797199-94797221 GAATGGTGAATGGGCCACCCAGG + Intergenic
1121583655 14:95048432-95048454 GATTGGGGTTTTGGCCACCCTGG - Intergenic
1122773113 14:104105910-104105932 GCAGGGGGATGGGGCCTCCCTGG + Intronic
1124063062 15:26313222-26313244 GCTTGGGGTTTGGGCCTCTGTGG - Intergenic
1124874651 15:33580622-33580644 GCTTGGGGCTTAAGACACCCAGG + Intronic
1125249061 15:37678379-37678401 GCCTGGGAATTGGGAAACCCTGG + Intergenic
1127335671 15:57980656-57980678 GCTGCGGGATGGGGCCACACGGG + Intronic
1127711153 15:61599541-61599563 GTTTGGGCATTTGGCTACCCCGG + Intergenic
1127850622 15:62909093-62909115 GCTTGACACTTGGGCCACCCTGG + Intergenic
1129228331 15:74182541-74182563 GCTTTGGGATTGGGCAGGCCTGG + Intronic
1129968580 15:79758013-79758035 GCCTGGGGAGTGAGCCTCCCAGG - Intergenic
1130889564 15:88121910-88121932 GCTTGGGGAAGGGGTCACCTTGG - Intronic
1136153106 16:28365015-28365037 GCTGCGGGCCTGGGCCACCCGGG - Intergenic
1139341667 16:66271493-66271515 GCCTGGGGATGGGTCCACCAGGG + Intergenic
1140205504 16:72929347-72929369 GCTTGGGGAGAGGTCCACCCGGG + Intronic
1141664933 16:85461141-85461163 GGTGGGGGATTGGCTCACCCTGG + Intergenic
1142872047 17:2827461-2827483 GCTGGGGGAAGGGGCTACCCTGG + Intronic
1143625724 17:8109369-8109391 GGGTGGGGATTGGGCCGGCCCGG - Intronic
1144950647 17:18991872-18991894 TCTTGGGCATTGGGCCTCCTGGG - Intronic
1145774243 17:27516360-27516382 GATGTGGGATTGGGCCACCCTGG + Intronic
1147165561 17:38591388-38591410 GCTGGGGGGCTGGGCCACACAGG - Intronic
1150629636 17:66870281-66870303 GCCATGGGATTGGGCCACCTTGG - Intronic
1150905186 17:69328738-69328760 GCCTGGGGATTGGGGACCCCTGG + Intergenic
1151374955 17:73681794-73681816 GGTTGGGGATTGGGCTAGGCAGG + Intergenic
1151947657 17:77328197-77328219 GCCTGGGCATGGGGACACCCTGG - Intronic
1152427749 17:80227694-80227716 GCCTGGGCATTGGGCCTCCCTGG + Intronic
1154184749 18:12173054-12173076 GGTGGGGCATTGGGTCACCCAGG - Intergenic
1156629661 18:38951661-38951683 GTTTGGGGATTGGGCTAAGCTGG + Intergenic
1157757566 18:50232143-50232165 GCTTGGGGATGGTGCAACTCAGG - Intronic
1158648317 18:59266283-59266305 GCTTGGGGACGGGGGAACCCTGG + Intergenic
1160846396 19:1168009-1168031 GCTGGGGGAGGGGGCCACACAGG + Intronic
1161326178 19:3665257-3665279 TCTTTGGGGTGGGGCCACCCTGG + Intronic
1161852376 19:6744445-6744467 GCTTGGGGCTGGGGCCAGCGTGG + Intronic
1162881958 19:13666469-13666491 GCCTGGGGATTGGGAACCCCTGG + Intergenic
1163171445 19:15534333-15534355 GCTTGGGTTCTGGGCCAGCCAGG - Intronic
1163755766 19:19105442-19105464 GCATGGAGATGGGGTCACCCCGG + Intronic
1164322564 19:24163051-24163073 CATTGGAGATTGTGCCACCCAGG - Intergenic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1166750541 19:45162229-45162251 GTTTGGGGAGTGGGCCAGGCGGG + Intronic
1167567240 19:50264405-50264427 CCTGGGGCCTTGGGCCACCCTGG - Intronic
1168720211 19:58550641-58550663 ACTGGGGGATGGGGCCACCAGGG - Exonic
925483127 2:4298535-4298557 GCATGGGTCTTGGGCCACCTGGG + Intergenic
927694453 2:25230680-25230702 GCTTTGGGATTGTGCCAACTTGG - Exonic
931550988 2:63446169-63446191 GCTTGGGCATTGGGGACCCCTGG - Intronic
931728237 2:65130673-65130695 GCTTGAGGCTTGCGCCACCCTGG + Intergenic
932054332 2:68429572-68429594 GCCTGGGGGTTGGGGAACCCTGG - Intergenic
932570738 2:72937109-72937131 GCGTGTGGATTAGGCCACCAGGG - Intergenic
934622977 2:95826800-95826822 GCTGGTGGATTGGCCCACCTGGG - Intergenic
934810789 2:97275288-97275310 GCTGGTGGATTGGCCCACCTGGG + Intergenic
934826903 2:97432651-97432673 GCTGGTGGATTGGCCCACCTGGG - Intergenic
935222705 2:101028608-101028630 GCTTGTGGATTGGGCTCCACAGG + Intronic
936098327 2:109551931-109551953 GCCTGGGGATTGGGGACCCCTGG - Intronic
937220015 2:120337330-120337352 GCTGGGGGCTGGAGCCACCCTGG - Intergenic
937904407 2:127045912-127045934 GCTTGGGAAGAGGCCCACCCTGG - Intergenic
947607029 2:231493059-231493081 CCTTTGGCATTGGGGCACCCAGG - Intergenic
947622700 2:231601017-231601039 TTGTGGGGATTGGGCCACCTGGG - Intergenic
948738986 2:240030706-240030728 GCTTTGGGTTTTGCCCACCCTGG - Intergenic
948928617 2:241116095-241116117 GCTTGAGGATTGGGTGTCCCTGG - Intronic
1171900542 20:30852232-30852254 TCTTGAGGTTTGGGCCACACAGG + Intergenic
1172813841 20:37670857-37670879 GCTGGGGTATTGGCCCAACCTGG + Intergenic
1173051993 20:39572140-39572162 GCCTGGGGATTGGGGAACCCTGG + Intergenic
1173570003 20:44069897-44069919 TCTGGAGGATGGGGCCACCCAGG + Intergenic
1173664880 20:44756417-44756439 GATTGGGCATGGGGCGACCCAGG - Intronic
1175529672 20:59665923-59665945 CCGTGGGCATTGGGCAACCCAGG + Intronic
1176030182 20:63007893-63007915 GGTGGGAGACTGGGCCACCCTGG + Intergenic
1176213916 20:63939384-63939406 GCTTGGAGGCGGGGCCACCCGGG - Intergenic
1177431634 21:20998045-20998067 GCGTGGGGATGGGGGCAGCCTGG - Intergenic
1179710599 21:43210961-43210983 GCTTGGGGTGTGGGCCTCCCAGG + Intergenic
1181775657 22:25158497-25158519 ACCTGGGGATGGGGCCAGCCAGG + Intronic
1183413013 22:37666305-37666327 GCCTTTGGATTGGTCCACCCAGG - Exonic
1184687274 22:46102320-46102342 GCTGGGGGCCTGGCCCACCCCGG - Intronic
1185018315 22:48358528-48358550 GCTTTGGGTCTGGGCCACTCTGG - Intergenic
949493072 3:4607734-4607756 GCTTCTGGGTTGGGCCACTCAGG + Intronic
953455873 3:43041970-43041992 GCTGGGGGCATGGGCCACCAGGG + Intronic
953903495 3:46856818-46856840 GAGTGGGGAGTGGGCCACACTGG - Intergenic
953913728 3:46905413-46905435 GGGTGGGGATTGGGGCTCCCTGG - Intergenic
957088660 3:75707112-75707134 TCTTGAGGTTTGGGCCACACAGG + Intergenic
959840508 3:110969196-110969218 TCTGGGGGATTGGGCCTCCCCGG - Intergenic
961745762 3:129062630-129062652 GCTTCTGGTGTGGGCCACCCTGG + Intergenic
963179540 3:142339196-142339218 GCTTGGGGATGGGGTGACACAGG - Intronic
967004955 3:185375303-185375325 GTTCGGGGATTTGCCCACCCAGG - Intronic
967460909 3:189744609-189744631 GCCTGGGGTCTGGCCCACCCAGG + Intronic
968932650 4:3590074-3590096 GCTTGGAGATTTTGCCAGCCTGG + Intronic
969134880 4:5021454-5021476 GCCTGGGGCATGGGCCTCCCTGG + Intergenic
972270176 4:37503014-37503036 GCCTGGGGAATGGGCGTCCCTGG + Intronic
980472108 4:133265012-133265034 GCTTGGGGATTTGCCTGCCCAGG - Intergenic
982344638 4:154344021-154344043 TCTTGGGGATTAGGGCAGCCTGG + Intronic
985577528 5:680452-680474 GCTTGGTGACTGGGCTTCCCAGG + Intronic
985592460 5:772548-772570 GCTTGGTGACTGGGCTTCCCAGG + Intergenic
987034647 5:14007437-14007459 GCTTCCAGATTGGGCCACCAGGG - Intergenic
988963641 5:36393594-36393616 GCTTGGGCATTGGGAGACCAAGG + Intergenic
990289470 5:54334035-54334057 GCCTGGGGATTGATCCACCCTGG + Intergenic
998142980 5:139710144-139710166 GCTTAGGGACTGGGCCAGCCTGG - Intergenic
998206079 5:140157660-140157682 CCTGGGGGATTGGGCCAGCCGGG - Intergenic
999666603 5:153919282-153919304 GCTAGGGGATTTGGAAACCCAGG + Intergenic
1005283330 6:24298318-24298340 GCCTGGGGGTTGGGGAACCCTGG + Intronic
1007407324 6:41642517-41642539 CCTAGGGGTCTGGGCCACCCGGG + Intronic
1010141620 6:72620946-72620968 GCATAGGCTTTGGGCCACCCGGG + Intergenic
1011559532 6:88600621-88600643 TCCTGGGGCTTGGGCCACCAGGG - Intergenic
1011628223 6:89300454-89300476 GAGTGGAGATTGCGCCACCCGGG + Intronic
1012307367 6:97675266-97675288 GCTTGGTGCTTGGGCCACAAGGG + Intergenic
1013413022 6:109898365-109898387 GCTGGGGGACTGGGCATCCCAGG + Intergenic
1016995139 6:149956272-149956294 GCTTGGGAATTGTGCTACTCAGG - Intergenic
1017007150 6:150036291-150036313 GCTTGGGGACTGTGCTACTCAGG + Intergenic
1017820089 6:158043070-158043092 GCTGGGGGTTGGGGCCTCCCAGG - Intronic
1019412163 7:911429-911451 GCTTGGGGAGGGGGGTACCCTGG - Intronic
1019492335 7:1321313-1321335 GCCTGGGGAGGGGGCCTCCCTGG + Intergenic
1023902881 7:44497451-44497473 GTTTGGGGATTGGGCCTCCAAGG + Intergenic
1024596464 7:50941572-50941594 GGCTGGGGTGTGGGCCACCCTGG + Intergenic
1031083516 7:117280401-117280423 GCTTGGGGCTTGGGGCACAAGGG + Intronic
1031644174 7:124203003-124203025 GTTTGGGGAATGGGCCAGGCTGG + Intergenic
1034554221 7:151839781-151839803 GCTTGGGTAGTGGTCCATCCAGG + Intronic
1036029596 8:4953878-4953900 GCTTAGAGATTGGACTACCCAGG + Intronic
1041303168 8:56434240-56434262 GCCTGGGGATTGGGAACCCCTGG + Intergenic
1041452081 8:58016354-58016376 GCTTCTGGCTTGGGCCTCCCGGG + Intronic
1043294529 8:78646645-78646667 GCTTCAGGATTCGGCCACTCAGG + Intergenic
1043684318 8:83067873-83067895 CCTTCTGGATTGGGCTACCCAGG - Intergenic
1045324341 8:101106560-101106582 GCTTGGGGATTGGGGACCCCTGG + Intergenic
1049586857 8:143436329-143436351 GGTGGGGGATTGGGACACCATGG + Intergenic
1050409803 9:5351184-5351206 GCTTGGGAGTTGGGGCACACAGG + Intergenic
1051557919 9:18405482-18405504 GGTTTGGCATTGGGCCACCCTGG + Intergenic
1051812539 9:21066662-21066684 GCAGGGGGACTGGGCCACTCAGG - Intergenic
1052309105 9:27045066-27045088 GCCTGGGGATTGGGGACCCCTGG - Intronic
1054457472 9:65441821-65441843 GCTTGGAGATTTTGCCAGCCTGG - Intergenic
1055744340 9:79426647-79426669 GCTTGGAAATTGGTCCACCAAGG + Intergenic
1056512803 9:87321699-87321721 GCTTGGGCCTTGGGATACCCTGG + Intergenic
1061400554 9:130365955-130365977 TCTTGGGGAAGGGGACACCCCGG - Intronic
1061788693 9:133046707-133046729 TCATGGGGAGTGGGCCACACTGG + Intronic
1062191261 9:135249064-135249086 GCATGGGGTGGGGGCCACCCAGG - Intergenic
1062308277 9:135921714-135921736 GCTTGGGGATCAGGTCACCCAGG - Intergenic
1203369356 Un_KI270442v1:288301-288323 TCTTGAGGTTTGGGCCACACAGG - Intergenic
1185433651 X:24490-24512 GCCGGGGGAATGGGGCACCCTGG + Intergenic
1185442856 X:236558-236580 GCCGGGGGAATGGGGCACCCTGG + Intergenic
1185623701 X:1468541-1468563 GCTTGCGGTTTGGGCCCCGCCGG + Intronic
1187292686 X:17970297-17970319 GCTATGGGAATGGGCCACCTTGG - Intergenic
1187644111 X:21328251-21328273 CCTAGGGGATTGGGCATCCCTGG - Intergenic
1192719603 X:73678402-73678424 GCCTGAGGACTGGCCCACCCAGG - Intronic
1194310613 X:92301397-92301419 CCTTGGGGAATGGGCGTCCCTGG + Intronic
1195000332 X:100637071-100637093 GCTCTGAGATTGGGCCTCCCTGG + Intronic
1197760472 X:130024477-130024499 TCTTGGGGACAGAGCCACCCCGG - Intronic
1198271088 X:135056451-135056473 GCCTGGGGATTGGGGTCCCCTGG + Intergenic
1200618895 Y:5415683-5415705 CCTTGGGGAATGGGCGTCCCTGG + Intronic
1200775519 Y:7167010-7167032 GGCTGGGGAATGGGGCACCCAGG - Intergenic
1201068927 Y:10126660-10126682 TCTTGAGGTTTGGGCCACACAGG + Intergenic