ID: 922728935

View in Genome Browser
Species Human (GRCh38)
Location 1:227940129-227940151
Sequence CTGTGTCTGCAGCATCCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 7, 3: 39, 4: 285}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922728920_922728935 30 Left 922728920 1:227940076-227940098 CCTGCTGAAAGCACCGTGTCCCA 0: 1
1: 0
2: 0
3: 9
4: 79
Right 922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG 0: 1
1: 0
2: 7
3: 39
4: 285
922728926_922728935 1 Left 922728926 1:227940105-227940127 CCCCTGGAATAAGCCCTGCCCTG 0: 1
1: 0
2: 0
3: 28
4: 210
Right 922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG 0: 1
1: 0
2: 7
3: 39
4: 285
922728922_922728935 17 Left 922728922 1:227940089-227940111 CCGTGTCCCATGGCAGCCCCTGG 0: 1
1: 0
2: 2
3: 61
4: 542
Right 922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG 0: 1
1: 0
2: 7
3: 39
4: 285
922728928_922728935 -1 Left 922728928 1:227940107-227940129 CCTGGAATAAGCCCTGCCCTGTC No data
Right 922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG 0: 1
1: 0
2: 7
3: 39
4: 285
922728924_922728935 11 Left 922728924 1:227940095-227940117 CCCATGGCAGCCCCTGGAATAAG 0: 1
1: 0
2: 0
3: 8
4: 181
Right 922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG 0: 1
1: 0
2: 7
3: 39
4: 285
922728927_922728935 0 Left 922728927 1:227940106-227940128 CCCTGGAATAAGCCCTGCCCTGT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG 0: 1
1: 0
2: 7
3: 39
4: 285
922728925_922728935 10 Left 922728925 1:227940096-227940118 CCATGGCAGCCCCTGGAATAAGC No data
Right 922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG 0: 1
1: 0
2: 7
3: 39
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922728935 Original CRISPR CTGTGTCTGCAGCATCCATG GGG Intronic
900540797 1:3201704-3201726 ATGTGTCACCAGCATCCAAGCGG - Intronic
900715092 1:4139082-4139104 ATGTGTCTGCTGCATTCTTGGGG - Intergenic
901322529 1:8348518-8348540 GTGTGTCTGCAGAATCCACTCGG + Intergenic
901378703 1:8858263-8858285 CTGTGTCTCCAGGGTCAATGTGG + Intergenic
901583647 1:10267532-10267554 CTTTGTTCCCAGCATCCATGAGG - Exonic
902229431 1:15018492-15018514 CTCTGTCTGCAGCCGTCATGGGG + Intronic
902712571 1:18250239-18250261 CTGTGTCTTCAGCATCAGTTTGG + Intronic
902883041 1:19385471-19385493 CTGTGCCTGCTGCATCCCCGGGG + Intronic
904716354 1:32470693-32470715 CTGTGACTGCAGCATCATTGTGG + Exonic
904936445 1:34132856-34132878 CTGGGTCTGCAGCTTACAGGTGG + Intronic
906952072 1:50343046-50343068 CTGACTTTGCAGCATCCATGAGG + Intergenic
907238433 1:53067236-53067258 CTGAGTCTCCATCAACCATGTGG + Intronic
907243806 1:53094690-53094712 CTGGGTCTGCATCAGCCAGGCGG - Intronic
908643208 1:66247999-66248021 CTGTGTGTGCAGTTTTCATGAGG + Intronic
910529336 1:88217654-88217676 CTGTATCTGCAGCTTTCATCTGG + Intergenic
910794572 1:91084951-91084973 CTGTGTCTGTAGCCTCACTGTGG + Intergenic
912177004 1:107171607-107171629 CTGTGTGTGGAACCTCCATGGGG + Intronic
915008593 1:152663762-152663784 GTGTGTCTACAGCACCCATCTGG + Intronic
915085341 1:153384337-153384359 CTGTGTCTGTACAATCCCTGAGG + Intergenic
916168895 1:161986104-161986126 CTGTGAGGGCAGCATTCATGTGG - Intronic
916241483 1:162644269-162644291 CTGTATCTGAAGCCTCCATAAGG + Intronic
917664988 1:177217853-177217875 ATGTGATTGCAGCATCCATATGG - Intronic
918668046 1:187177280-187177302 CTGTTTCTCCTGCCTCCATGTGG - Intergenic
919431320 1:197496001-197496023 CTGTATCTGCCGAATCCCTGAGG + Intergenic
919569868 1:199234694-199234716 CTCAGAATGCAGCATCCATGTGG - Intergenic
919973121 1:202593450-202593472 TTGTGTCTGCAGAATCAGTGTGG - Exonic
920199732 1:204252152-204252174 CTGGGCTGGCAGCATCCATGAGG + Intronic
920855592 1:209658757-209658779 CTGTGTGTGAAGCACACATGGGG - Intergenic
921283621 1:213589977-213589999 GTGTGTCTGGAGCAGCAATGAGG + Intergenic
921477899 1:215632477-215632499 CTGTGTCAGAATCCTCCATGAGG - Intronic
921829575 1:219711848-219711870 TTCTGTCTGCAGCCTCCTTGAGG - Intronic
922659513 1:227417620-227417642 CTGAGTGTTCAGCATCTATGGGG - Intergenic
922728935 1:227940129-227940151 CTGTGTCTGCAGCATCCATGGGG + Intronic
1062849189 10:729811-729833 CTGGGGCTGCAGCATCAGTGAGG + Intergenic
1062942027 10:1429513-1429535 TCACGTCTGCAGCATCCATGTGG - Intronic
1063121501 10:3107925-3107947 CTGTGGCTCCAGCAGCCACGGGG + Intronic
1063156632 10:3385193-3385215 CTTTGTATGAAGCTTCCATGGGG + Intergenic
1063515183 10:6688308-6688330 CTCTTTCTGCAGCCTCCATCTGG + Intergenic
1064168117 10:13003891-13003913 ATGTGTCTGCTGAATCCATGAGG - Intronic
1064207891 10:13339915-13339937 CTGTATCTGCAGAATCCTCGTGG - Intronic
1065061265 10:21903625-21903647 CTGTGTCTGTAGCATCAAACAGG - Intronic
1065998408 10:31081208-31081230 CTCTGCCTGCAGCCTCCATGTGG - Intergenic
1067153341 10:43753921-43753943 CTGCCTCTGCAGCCTCCATGGGG + Intergenic
1068428815 10:56905885-56905907 CTGTATGTGCAGCATCCACCTGG - Intergenic
1068773672 10:60849422-60849444 CTATGTCTCAAGCATGCATGAGG - Intergenic
1069851541 10:71408630-71408652 CTGTGTCTGCTGCCTGCCTGAGG + Intronic
1070457706 10:76633546-76633568 CTGTATCTGCAGCATCTGTGAGG - Intergenic
1071383702 10:85098407-85098429 ATGTGGCTGAAGCATTCATGTGG + Intergenic
1071535286 10:86423832-86423854 CTGTCTCTGCAGGAACAATGGGG - Intergenic
1072756613 10:98025724-98025746 CTGTATCTGCAGCCTGCAGGAGG + Intronic
1072762093 10:98065064-98065086 CAGTGTCTCCAGCAGCTATGTGG + Intergenic
1075859298 10:125661230-125661252 CTGTGTCTGCTCCATCTCTGGGG - Intronic
1075873601 10:125788863-125788885 CTGACTCAGCAGCAGCCATGGGG + Exonic
1075929583 10:126284373-126284395 CCGTATCTGTAGCAGCCATGTGG + Intronic
1076632829 10:131861968-131861990 ATGTGTATCCAGCATCCTTGGGG + Intergenic
1077229701 11:1453223-1453245 CTGTGACTCCAGCACCCACGTGG - Intronic
1077496381 11:2888564-2888586 CAGGGTCTGCAGCCTCCATCTGG - Exonic
1077798412 11:5515038-5515060 CTGTGTCTGCTGCAGGAATGTGG + Exonic
1078060050 11:8037469-8037491 CTGGGTCTCCAGCGTCCATTTGG + Intronic
1081351687 11:42061439-42061461 CTGTGTTAGGTGCATCCATGTGG - Intergenic
1082260692 11:50074567-50074589 TTGGGCCTGCAGCAGCCATGAGG + Intergenic
1082591257 11:55013591-55013613 CTGTTTTGGCAGAATCCATGAGG + Intergenic
1083620758 11:64048289-64048311 CTCTGTCTGCACCTCCCATGGGG - Intronic
1085174524 11:74474423-74474445 CTGTGTCAGCACCATCCAGGTGG - Intergenic
1085740094 11:79070977-79070999 CAGTGTCTGCCCCATCCATCTGG + Intronic
1085744452 11:79102743-79102765 CTGTATCTGCACTGTCCATGTGG + Intronic
1086432957 11:86753563-86753585 CTGTGTTTACAGAATCAATGAGG - Intergenic
1089880152 11:121765945-121765967 CCGTCTCTTCACCATCCATGCGG + Intergenic
1090718974 11:129455485-129455507 CTGCGGCTGCAGCAAACATGGGG + Intergenic
1091281851 11:134386169-134386191 CTGTTCCTGAAGCTTCCATGAGG - Intronic
1091652612 12:2320976-2320998 CTGCTGCTGCAGCATCCGTGTGG - Intronic
1091686396 12:2565825-2565847 CTGTGTGTGCCACATCCATATGG - Intronic
1091802776 12:3334836-3334858 CTGTGGCTGCAGCTGCCATTGGG + Intergenic
1095071267 12:37851564-37851586 CTGTTTTTGCAAAATCCATGTGG - Intergenic
1095371557 12:41473575-41473597 CAGTGTGTGCAGTTTCCATGGGG - Intronic
1097708552 12:62894036-62894058 CTGTGGCTGGACCATCCAAGGGG - Intronic
1097734085 12:63163061-63163083 CTGTGTCTTCAGAAACAATGGGG - Intergenic
1099613813 12:84911307-84911329 CTTAGTCTGCACCATCCTTGCGG - Intronic
1100597327 12:96082838-96082860 CTGTGTCAGCAGCATTTATTAGG + Intergenic
1104034048 12:125086387-125086409 CTTTGTTTGCAGCAGCAATGAGG + Exonic
1104245626 12:127038331-127038353 CTGTGTCTGCTGCAATCCTGGGG + Intergenic
1104898083 12:132173932-132173954 GTGTGTCTGCAGCCTCCCAGTGG - Intergenic
1104937869 12:132376141-132376163 CTGTGTCTGCATCACTCAAGAGG + Intergenic
1107708887 13:43133253-43133275 CTGTTTCTCCAGCAGACATGGGG - Intergenic
1108558698 13:51621784-51621806 CTGGTTCTGGAGCAGCCATGTGG + Intronic
1111041998 13:82760127-82760149 CTGAGTTTGCTGCATCCCTGAGG - Intergenic
1111101992 13:83599952-83599974 CTGTGTGTGCAGCATCCACCCGG - Intergenic
1112610662 13:100951877-100951899 CTGTGTCCTCAGCATCTATCAGG - Intergenic
1113033842 13:106026239-106026261 CTTTGTCTTCAGCTTCCCTGGGG - Intergenic
1115026467 14:28752704-28752726 GTGTGTCTTCAGCTTCCCTGAGG + Intergenic
1115576665 14:34717975-34717997 CTGAGTCTTCAGAATCAATGAGG - Intergenic
1116493756 14:45536547-45536569 CTGTGTCTGTAGAATACAGGTGG + Intergenic
1117322613 14:54638215-54638237 GTGTGTCTGCATGATTCATGGGG + Intronic
1117387029 14:55225682-55225704 CTGTATCTGTACTATCCATGTGG - Intergenic
1117836333 14:59810329-59810351 CTGTGTGTGCAGCGTCCATGTGG + Intronic
1118425025 14:65651075-65651097 CTGTGGCTGTAGCATCCATTGGG - Intronic
1118897754 14:69960376-69960398 CTTTTTCTGCAGCATCCAAAGGG - Intronic
1120265174 14:82239499-82239521 CTGTGTATGCAGCATCGACCTGG - Intergenic
1121112628 14:91322604-91322626 GTGTCTCTGCAGAATTCATGGGG + Intronic
1121730955 14:96186806-96186828 CTGCGTGCGTAGCATCCATGGGG + Intergenic
1121991065 14:98557919-98557941 CTGTGTCTGCTGCATCTAATGGG - Intergenic
1123137201 14:106038945-106038967 CTGTGGCTACTGCAGCCATGTGG - Intergenic
1123480314 15:20625057-20625079 CTGTGTATGCTGCAGCCAGGAGG - Intergenic
1124243940 15:28054390-28054412 CTGTGCCTGCAGGAGCCATTTGG - Intronic
1126317040 15:47381465-47381487 CTGGGTCTGCAGCATGAATGAGG - Intronic
1128103580 15:65026588-65026610 CTGTGTTTGCAGCATTCCTTGGG + Intronic
1129172541 15:73817020-73817042 CTGGGTCTGGGGCCTCCATGGGG + Intergenic
1129655119 15:77518994-77519016 CATTGCCTGCAGCATCCCTGGGG - Intergenic
1129736711 15:77970591-77970613 GTCTGGCTGCAGCATCCAAGTGG + Intergenic
1130103552 15:80912245-80912267 CTGTATCTGGAGCAGCCACGTGG + Intronic
1130227860 15:82073377-82073399 CTGGGTCTGCAGCTGCCATTTGG + Intergenic
1131014933 15:89050327-89050349 ATGTCTCAGCAGCAACCATGTGG + Intergenic
1132590994 16:726422-726444 CAGTGGCAGCAGCAGCCATGGGG - Exonic
1134670657 16:16052620-16052642 CTTGGTCAGCAGCATCCACGTGG + Intronic
1135878897 16:26232944-26232966 CTGGGTTTGAAGCATGCATGAGG - Intergenic
1136022534 16:27449154-27449176 CTCTGACTGCAGCAGCCCTGTGG + Exonic
1136489627 16:30598363-30598385 CTGTGTGTCTAGCATCCATCTGG - Intergenic
1136693329 16:32052995-32053017 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1136793820 16:32996218-32996240 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1137282859 16:46992798-46992820 CTGGGTCTGCAGCCTCCCTATGG + Intergenic
1137722248 16:50634051-50634073 CGGGATCTGCAGCATCTATGTGG + Exonic
1138668808 16:58596262-58596284 TTCTGGCTGCAGCATCCAGGAGG + Intronic
1140333713 16:74082986-74083008 CTGTGGCTGCAGAATACTTGAGG + Intergenic
1140709141 16:77660232-77660254 CTGTGTATGCAGCATTCTTGTGG + Intergenic
1140904290 16:79397207-79397229 CTGTGTCTTCCACAACCATGGGG + Intergenic
1141126873 16:81407213-81407235 CTGTGGCTGCAGCCTTCCTGGGG - Intergenic
1141475223 16:84268385-84268407 CTGTGTCAGCACCATCCCTGGGG + Intergenic
1141863990 16:86737192-86737214 GTGTGTCTGCCGCATGCAGGGGG + Intergenic
1142354612 16:89596671-89596693 CTCTGTCTGCAACATGCTTGGGG + Exonic
1203096082 16_KI270728v1_random:1257911-1257933 CTGTGGCTCCTGCAGCCATGTGG + Intergenic
1142787586 17:2236180-2236202 CTGGGTCTGCAGCCTTCAAGAGG + Intronic
1143115794 17:4581374-4581396 GTGTGTGTGCACCATGCATGTGG + Intergenic
1143404652 17:6669179-6669201 CTGTTTTTACAGCATCCATGTGG + Intergenic
1148791388 17:50175245-50175267 CTGTGCCTCCAGCATCCAGATGG + Exonic
1151661149 17:75518922-75518944 CTGTGTCTGGAGAAACCATTTGG + Intronic
1152899100 17:82929793-82929815 CTGTGTCTGATGCCTGCATGTGG + Intronic
1153031021 18:712755-712777 CTGGGACTGCAGCTCCCATGGGG - Intergenic
1153962394 18:10150578-10150600 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1153962396 18:10150610-10150632 CTCTGTGTACAGCATCCACGTGG + Intergenic
1153962398 18:10150642-10150664 ATGTGTGTGCAGCATCCACGTGG + Intergenic
1153962400 18:10150674-10150696 ATGTGTGTGCAGCATCCACGTGG + Intergenic
1153962403 18:10150734-10150756 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1153962406 18:10150766-10150788 CTGTGTGTGCTGCATCCACGTGG + Intergenic
1153962408 18:10150798-10150820 CTGTGTGTGCTGCATCCACGTGG + Intergenic
1153962410 18:10150830-10150852 CTCTGTGTGCTGCATCCACGTGG + Intergenic
1153962412 18:10150862-10150884 CTGCGTGTGCTGCATCCATGTGG + Intergenic
1153962414 18:10150892-10150914 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1153962416 18:10150924-10150946 CTGTGTGTGCTGCATCCACGTGG + Intergenic
1153962418 18:10150956-10150978 CTCTGTGTGCTGCATCCACGTGG + Intergenic
1153962420 18:10150988-10151010 CTGCGTGTGCTGCATCCATGTGG + Intergenic
1153962422 18:10151018-10151040 TTCTGTGTGCTGCATCCATGTGG + Intergenic
1155505244 18:26526674-26526696 CTGGGTCTCCAGCATCCCTCTGG - Intronic
1155670270 18:28362371-28362393 CTGTGTCTAAATCATCCCTGAGG + Intergenic
1156134793 18:34024821-34024843 ATGTATCTGTAGGATCCATGTGG + Intronic
1157813955 18:50717631-50717653 GTGTGTCCTTAGCATCCATGTGG + Intronic
1158234262 18:55295443-55295465 ATTTGGCTGCAGCATCCAGGAGG - Intronic
1160248550 18:77180849-77180871 CTGTGTCTACAGCCTCAGTGGGG - Intergenic
1160568218 18:79799543-79799565 CTGTGTCCGCATCTTCCCTGGGG + Intergenic
1161267514 19:3371286-3371308 CTGAATCTGCAGCAGCCCTGAGG - Intronic
1164847093 19:31441683-31441705 GTGGGTCTGGAGCATCCATGTGG + Intergenic
1165198588 19:34126975-34126997 GTGTGGCTTCAGCTTCCATGGGG - Intergenic
1165348880 19:35266177-35266199 CCATTTCTGCAGCATCCCTGAGG - Intronic
1166872887 19:45881791-45881813 CTGTGTCTGCCTCATCTCTGAGG + Intergenic
1167597861 19:50436709-50436731 CTGTGGCTTCAACATCGATGTGG + Exonic
1167748583 19:51367125-51367147 CTGTGACTGCAGCCTGCCTGGGG - Exonic
1168082957 19:54023835-54023857 CCGTGTCTGCAGCCTCTCTGCGG + Intergenic
1168115104 19:54217985-54218007 CTGTGTCTGCAGCTCCCATGGGG + Intronic
1168120797 19:54251677-54251699 CTGTGTCTGCAGCTCCCATGGGG + Intronic
1168124376 19:54275574-54275596 CTGTGTCTGCAGCTCCCATGGGG + Intronic
1168177611 19:54635964-54635986 CTGTGTCTGCAGCTCCCATGGGG - Intronic
1168181888 19:54667104-54667126 CTGTGTCTGCAGCTCCCATGGGG - Intronic
925058054 2:870632-870654 CTGTGTCTGCACCATCCTGCGGG - Intergenic
925131141 2:1494969-1494991 CTGTGTCTTCAGCAAACGTGCGG + Intronic
925165760 2:1714614-1714636 CTGTCTCTGCAGCAGGAATGCGG + Intronic
926673393 2:15596724-15596746 CTGTTTCTGCAGCCTGAATGAGG - Exonic
926816287 2:16800992-16801014 CTGTGTCTCCAGCATGGAGGAGG - Intergenic
927462813 2:23313632-23313654 CTTTATCTGCAGCATGCATTGGG - Intergenic
928702437 2:33912543-33912565 CTGTGACTGTAGCCACCATGGGG - Intergenic
928720885 2:34119510-34119532 CTGTGTGTGCAGCATTCATCCGG - Intergenic
930587804 2:53290074-53290096 CTGTGTATGCAGCATAAAAGAGG + Intergenic
932951860 2:76303005-76303027 CTGTGTATGCACCCTGCATGGGG - Intergenic
933876504 2:86625323-86625345 CTGTGTCTTTAGCTTCCATGTGG + Intronic
935597966 2:104894536-104894558 CTGGGTCTGCATCCACCATGGGG + Intergenic
937293826 2:120798077-120798099 CTGTGTCTGCACAGTCCATCTGG + Intronic
938308544 2:130270007-130270029 CTTGTTCTGCAGCACCCATGTGG + Intergenic
938446786 2:131386829-131386851 CTTGTTCTGCAGCACCCATGTGG - Intergenic
943843709 2:192613409-192613431 CAGTTTCTTCAGCATCCCTGAGG - Intergenic
944660735 2:201919496-201919518 CTATATCTCCAGCATTCATGTGG + Intergenic
944663469 2:201940073-201940095 CTGTCTCTGCTGTATCCCTGGGG + Intergenic
944909391 2:204294621-204294643 CAGTGTTTGCTGCAACCATGAGG - Intergenic
948482365 2:238258186-238258208 CTGTGTCCACAGAAGCCATGGGG + Intronic
948868258 2:240786037-240786059 CTGTGGCTGCTGCTTCGATGGGG - Intronic
1168811457 20:707356-707378 CTGTGTCTGCAGCCCCCAAGAGG + Intergenic
1169235093 20:3924442-3924464 GTGTCTCTGCTGCCTCCATGCGG - Intronic
1169529020 20:6464319-6464341 CTGTGTTTGCAGCATCACTCGGG - Intergenic
1169841890 20:9947868-9947890 CTGGGTCTTGAGTATCCATGTGG + Intergenic
1172122838 20:32608735-32608757 CTTTGTCTGTCTCATCCATGAGG + Exonic
1172132477 20:32664827-32664849 CCTTGTGTGCAGCACCCATGGGG - Intergenic
1173006889 20:39146733-39146755 CTGTGTCTACTGCATACACGAGG - Intergenic
1174278896 20:49424145-49424167 CTGTGTGTGCAGAATCCATTTGG + Intronic
1176254990 20:64147073-64147095 CAGGGTCTGCAGCACCCACGGGG - Intergenic
1178344092 21:31810370-31810392 CTCTGTATGCAACATGCATGGGG + Intergenic
1181690590 22:24557062-24557084 CTGTATCTGCACCTTCCATAGGG + Intronic
1183075219 22:35422572-35422594 CTGTGCCTGCAGCATCCCAGAGG - Intronic
1183450807 22:37893907-37893929 CAGTGTCGGCAGCAGGCATGAGG + Intergenic
1183488269 22:38101992-38102014 CAGTGTGACCAGCATCCATGTGG + Intronic
1185029376 22:48433603-48433625 CTGTGTATCCAGCATCCAGTAGG - Intergenic
949304016 3:2619140-2619162 TTGTGTCTTCAGCATCCTTTAGG + Intronic
949482436 3:4506273-4506295 CAATGTCTGCAGCATTAATGGGG - Intronic
949881445 3:8664095-8664117 CTGGGTTTGCAGCAGCCTTGGGG - Intronic
950169344 3:10826979-10827001 CTCTGTCTGTATCATCCATGTGG + Intronic
950530764 3:13551133-13551155 CTGTGACTGCTGCATGCATTGGG + Intronic
953577007 3:44120900-44120922 CTGTGTTTGCACCATTCCTGTGG + Intergenic
954289726 3:49643238-49643260 CTGGGTCTGCAGCAGCCATGGGG + Intronic
954863045 3:53706028-53706050 CGGTGTCTGCATCCTCCCTGGGG + Intronic
955033732 3:55245848-55245870 ATGTGTCTGAAGCATCGGTGAGG + Intergenic
956109654 3:65857761-65857783 CTGTGTCTGTCCCATCTATGTGG - Intronic
957987491 3:87590291-87590313 AAGTGTTTGCAGCTTCCATGTGG - Intergenic
959221658 3:103529014-103529036 CTGTGTTTGCAGTGTCCATCTGG - Intergenic
960350814 3:116590524-116590546 CTGTGTGTGCAGCCACCAAGAGG + Intronic
961973982 3:131003187-131003209 CTGTATCTTCAGCATCCATATGG - Intronic
962878738 3:139556097-139556119 CTGTCTCTGCTTCATCCATGGGG - Intergenic
964470475 3:157048139-157048161 CTGTATCTTCAGGAACCATGGGG + Intergenic
965382437 3:168006578-168006600 CTGTGTGTGCAACATCCACTTGG - Intergenic
968374220 4:24567-24589 ATGTGTGTTCAGCAGCCATGTGG + Intergenic
968941190 4:3639563-3639585 CTGAGTCTGCAGCCTGCCTGGGG + Intergenic
969182821 4:5455239-5455261 TTCTGTCTGCAGCAGCCCTGTGG + Intronic
969573255 4:8022462-8022484 CTGTGTCCCCAGCTTCCCTGCGG - Intronic
969604417 4:8195393-8195415 CAGTGTCTGCAGCCTCCAGTTGG + Intronic
970766528 4:19556141-19556163 CTGTGTGTGAGGCACCCATGGGG + Intergenic
970962616 4:21890592-21890614 CTGTGTCTTCCTCATCCTTGTGG - Intronic
972621373 4:40750548-40750570 CTCTTTCTGCAGCACCCCTGTGG - Intronic
973554720 4:52071688-52071710 CCATGTCTGCAGCTTGCATGGGG - Intronic
974278536 4:59759455-59759477 CTGAGTCTGCAGCCACCATTTGG + Intergenic
975852873 4:78590585-78590607 CTCTGTCTGCCCCATCCATGGGG - Intronic
977551880 4:98451194-98451216 CTGTGTGTGAAGTATCCATCTGG + Intergenic
977711895 4:100135820-100135842 CTGTGTCTGAAGAATTCTTGGGG + Intergenic
978628095 4:110710620-110710642 CTGTTTCTGCACCATTCATTGGG + Intergenic
979282549 4:118884035-118884057 CTGTGTGTGTAGCATCCATCTGG - Intronic
979397954 4:120211437-120211459 CTTTGTCTGTAGCAGCTATGAGG - Intergenic
979753350 4:124306981-124307003 CTGAGTCTGCATCCTCCATGGGG - Intergenic
981854703 4:149274361-149274383 CTGTGTGCACAGCATCCATCTGG - Intergenic
982913329 4:161173996-161174018 CTGTGGCTGAAGCATGCATAGGG + Intergenic
983030613 4:162797076-162797098 CTGTGTTTGCAGGTTCCATCTGG + Intergenic
985095575 4:186409389-186409411 CTGTGTCTTCATCATCCTTGCGG - Intergenic
985220823 4:187702542-187702564 CTGTGTTTGCAGTAACCATAAGG - Intergenic
985460510 4:190101696-190101718 ATGTGTGTTCAGCAGCCATGTGG - Intergenic
985886209 5:2681459-2681481 CTGTGTGTGCAGCATCTCAGTGG + Intergenic
987185052 5:15408920-15408942 ATGTTTCTGCAATATCCATGTGG - Intergenic
987236509 5:15947498-15947520 TTGTGTCTGTAACATGCATGAGG - Intergenic
987806527 5:22776096-22776118 CTTTGTCAGCAGCATGAATGCGG + Intronic
989200946 5:38763217-38763239 CTGTGTTTGCAGCATTCCTTTGG - Intergenic
992370680 5:76140819-76140841 CTTTGTCCTCAGCATCTATGTGG + Intronic
997643145 5:135462927-135462949 CTTTCCCTGCAGGATCCATGGGG - Intergenic
1000403110 5:160853603-160853625 ATGTGTCTGTAGCATCCCTTGGG + Intergenic
1001270802 5:170310142-170310164 TTGTGTTTGCTGCATGCATGAGG + Intergenic
1001854601 5:174999965-174999987 CTCTGTCTGATGCCTCCATGTGG + Intergenic
1002934176 6:1657666-1657688 CTGTGGGAGCAGCAACCATGTGG + Intronic
1003975694 6:11341662-11341684 CTGTGTCTGCACCATCCAATAGG - Intronic
1004017876 6:11748873-11748895 CTGTGTCTGCAGCATTAAGCAGG + Intronic
1004750929 6:18561145-18561167 CTCTTTCTGCAGCAGCCATCTGG - Intergenic
1006118017 6:31785546-31785568 GTGAGTATGCAGCATCCCTGTGG - Intronic
1006404818 6:33838754-33838776 CTGTGGCTGCAGGTTCCCTGGGG - Intergenic
1007516006 6:42411907-42411929 CGGTGTCTGCAGAAGCCATCTGG - Intronic
1008662011 6:53678159-53678181 CTGTGTTTGCAAGTTCCATGAGG - Intergenic
1009519773 6:64666733-64666755 ATGTGTGTAGAGCATCCATGTGG - Intronic
1011726156 6:90212486-90212508 GTGTGTTTGCTGCCTCCATGTGG - Intronic
1013352537 6:109318602-109318624 CTGTGTTTGCTGCATCCAGGCGG + Intergenic
1013373979 6:109496345-109496367 CAGTGCCTGCAGCAGCCAGGAGG - Intronic
1013893205 6:115051141-115051163 CTGTTTCTGCATCTTCCAAGGGG - Intergenic
1014054272 6:116995513-116995535 CTGTATGTGCAGCATCCACTTGG - Intergenic
1014177257 6:118344228-118344250 CTGTGTGTACAGCATCCAACTGG + Intergenic
1015887384 6:137931734-137931756 CTGTGTCTGTAACATCTAGGAGG - Intergenic
1018728348 6:166630630-166630652 CTGTCTCTGGAGCATCCAGCAGG - Intronic
1019274738 7:170039-170061 CTGGGTGTGCAGGATCCAGGCGG - Intergenic
1019894814 7:3975599-3975621 CTGTGTCTGCCACACGCATGTGG + Intronic
1020568177 7:9823042-9823064 CTGGGTCTGCAGCAGCGATTTGG + Intergenic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1021702114 7:23329715-23329737 GAGTGTATGCAGCAGCCATGTGG + Intronic
1022795449 7:33727974-33727996 CTGAGTCTGCACCACCCATGGGG - Exonic
1023123484 7:36932919-36932941 CTGTCTCTGCAGCACCCCAGAGG - Intronic
1024986076 7:55194185-55194207 CTCTGTCTGGAGCATAGATGAGG - Intronic
1027951865 7:84826486-84826508 CTGTGGCTGAAGCAGCCCTGAGG + Intergenic
1028757221 7:94451594-94451616 CTGTGTCCACTGCATTCATGAGG + Intergenic
1028857235 7:95605676-95605698 CTCTGACTGCAGCCCCCATGTGG + Intergenic
1031988237 7:128177813-128177835 GGGTGTCAGCAGCATCCAGGGGG + Intergenic
1032382590 7:131500503-131500525 CTGTGTTTGCAGCAGACCTGAGG + Intronic
1034214953 7:149398114-149398136 CTGTTTCTGCAGAAACCCTGTGG - Intergenic
1034458818 7:151186905-151186927 CTGTGTCTCCCGCATCCTCGCGG - Exonic
1034648316 7:152668342-152668364 CTGTGGTTTCAGCATCCATTGGG + Intronic
1035449949 7:158970678-158970700 ATGTGTGTACAGCATCCCTGTGG + Intergenic
1035815776 8:2538539-2538561 CTGTGTGTGCAGCATCCCACTGG + Intergenic
1036791562 8:11724748-11724770 CTCTGCCTTCAGCCTCCATGTGG - Intronic
1036821471 8:11943109-11943131 CTGGGTCAGCAGCATGCATGCGG + Intergenic
1037247369 8:16850648-16850670 CTGTGTTTGTAGCATCCACGTGG - Intergenic
1037649752 8:20825570-20825592 CTGTGGCTTCTGCCTCCATGGGG + Intergenic
1037675333 8:21046098-21046120 CAATATCTGCAGCATCCCTGGGG - Intergenic
1037890003 8:22619024-22619046 CTGGGGCTGCAGCCACCATGGGG + Intronic
1038632174 8:29256344-29256366 CTGTATGTGCAGCACCCATCTGG + Intronic
1039753740 8:40500326-40500348 CTGTTTCTGCAGGACCTATGTGG - Intergenic
1042186384 8:66140527-66140549 CTTTGTTTGAAGCATCCCTGAGG + Intronic
1043752311 8:83953185-83953207 CTGTGTATATGGCATCCATGTGG + Intergenic
1044371382 8:91415428-91415450 CTGTGTGTGTGGCATCCATCTGG + Intergenic
1045316586 8:101048752-101048774 GTGTGTGTGGAGCATCCAGGTGG - Intergenic
1045389650 8:101702745-101702767 CTGTATCTCCAATATCCATGAGG - Intronic
1045946889 8:107806358-107806380 CTGAGTCTGCAGTCGCCATGGGG - Intergenic
1046640692 8:116727196-116727218 CTGTTTCTTCACCATCCGTGTGG - Intronic
1048365644 8:133735983-133736005 CTGTGCCAGGAGCATCCATATGG + Intergenic
1048906392 8:139093272-139093294 CTGTTCCTCCAGCAACCATGGGG - Intergenic
1049004836 8:139847948-139847970 CTGTGTCAGCAGCAGCCCTGGGG + Intronic
1049320384 8:141993110-141993132 CTGAGCCTGCAGCCTCCATCAGG + Intergenic
1050179091 9:2900520-2900542 CTTTGTCTTCAGCATCCAGCTGG + Intergenic
1053426781 9:38015355-38015377 CTGGGTATGCAGCATCCTGGGGG - Exonic
1053553415 9:39108172-39108194 CTGTGTGTGTAGCATCCACCTGG - Intronic
1053817519 9:41928329-41928351 CTGTGTGTGTAGCATCCACCTGG - Intronic
1054107775 9:61072001-61072023 CTGTGTGTGTAGCATCCACCTGG - Intergenic
1054613082 9:67259124-67259146 CTGTGTGTGTAGCATCCACCTGG + Intergenic
1055397311 9:75889786-75889808 CTGTGACTGCAGCAGGCAGGAGG - Intergenic
1055943698 9:81673882-81673904 CTGTATCTGCAGGCTGCATGGGG + Intronic
1058345958 9:103962815-103962837 TTGTGTCTTCAGCATTCATAAGG - Intergenic
1060872320 9:127052500-127052522 CTGTGCCAACAGCATCAATGTGG - Intronic
1061014861 9:127975740-127975762 CTGTGTCTGCCTCATGCACGTGG - Intronic
1188399776 X:29730328-29730350 TTGTATCTCCAGCATCCAGGGGG - Intronic
1189412980 X:40790409-40790431 CTGCATGTGCAGCATCCATATGG - Intergenic
1190919509 X:54839050-54839072 CTGTGGTTGCAGCGGCCATGGGG - Intergenic
1191755059 X:64583828-64583850 AAGTGTCTGTAGCAGCCATGAGG - Intergenic
1192784812 X:74325415-74325437 CTCTTTCTGCAGCATCTTTGTGG + Intergenic
1192803812 X:74492904-74492926 CTCTTTCTGCAGCATCTTTGTGG - Intronic
1195745574 X:108113921-108113943 CTGCATCTGCAACACCCATGTGG - Intronic
1195964048 X:110414086-110414108 GTCTTTCTGCTGCATCCATGAGG + Intronic
1200411806 Y:2868440-2868462 CTGTGTCTCCAGGGCCCATGGGG - Intronic
1200551027 Y:4578376-4578398 CTGGGTCTGCAGCAGCCCTTTGG + Intergenic