ID: 922729395

View in Genome Browser
Species Human (GRCh38)
Location 1:227942000-227942022
Sequence GCCTGTGTGCTCTTTCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 171}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922729389_922729395 1 Left 922729389 1:227941976-227941998 CCAGAGCCTCCAGGAGGTATCCG 0: 1
1: 0
2: 1
3: 14
4: 166
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729383_922729395 14 Left 922729383 1:227941963-227941985 CCTGCCCCAGGGTCCAGAGCCTC 0: 1
1: 1
2: 9
3: 51
4: 542
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729380_922729395 21 Left 922729380 1:227941956-227941978 CCTCCTCCCTGCCCCAGGGTCCA 0: 1
1: 1
2: 7
3: 120
4: 920
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729390_922729395 -5 Left 922729390 1:227941982-227942004 CCTCCAGGAGGTATCCGTGCCTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729384_922729395 10 Left 922729384 1:227941967-227941989 CCCCAGGGTCCAGAGCCTCCAGG 0: 1
1: 1
2: 3
3: 53
4: 410
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729387_922729395 8 Left 922729387 1:227941969-227941991 CCAGGGTCCAGAGCCTCCAGGAG 0: 1
1: 0
2: 3
3: 40
4: 392
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729381_922729395 18 Left 922729381 1:227941959-227941981 CCTCCCTGCCCCAGGGTCCAGAG 0: 1
1: 0
2: 7
3: 78
4: 653
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729391_922729395 -8 Left 922729391 1:227941985-227942007 CCAGGAGGTATCCGTGCCTGTGT 0: 1
1: 0
2: 0
3: 13
4: 104
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729382_922729395 15 Left 922729382 1:227941962-227941984 CCCTGCCCCAGGGTCCAGAGCCT 0: 1
1: 0
2: 4
3: 54
4: 390
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171
922729386_922729395 9 Left 922729386 1:227941968-227941990 CCCAGGGTCCAGAGCCTCCAGGA 0: 1
1: 0
2: 6
3: 41
4: 324
Right 922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922729395 Original CRISPR GCCTGTGTGCTCTTTCCTAG GGG Intronic
900292460 1:1929307-1929329 GCCTGTGGGCTCTGTCATGGAGG - Intronic
900564859 1:3327268-3327290 GCCTGTGAGGTCTTTGCTGGAGG + Intronic
903080391 1:20806422-20806444 GCATGTGTGCCCATTCCTGGGGG - Intronic
904962887 1:34348786-34348808 GCCTGTGTGCATTTTACTGGAGG - Intergenic
905368961 1:37472607-37472629 GCTTGCTTGCTCTTACCTAGCGG - Intergenic
907526041 1:55054674-55054696 GCCTGTGAGCTCTGGCCCAGTGG - Intronic
907810607 1:57866018-57866040 CCCTGTGGTCTCTTTCATAGGGG + Intronic
910588489 1:88903667-88903689 GGCTGTGGTTTCTTTCCTAGTGG - Intergenic
912010052 1:104948169-104948191 GCTTGTATTCTCTTTCCCAGGGG - Intergenic
914698727 1:150110651-150110673 AACTGTGTCCTCTTTCCCAGAGG + Intronic
916786814 1:168092547-168092569 GCCTTTGTGCTTTTTTCTTGAGG - Intronic
917222190 1:172743649-172743671 GCCTGGTGGCTCCTTCCTAGAGG - Intergenic
917690891 1:177467625-177467647 GCCTGTGTGGTCTGACTTAGAGG + Intergenic
917808218 1:178633447-178633469 CCCTGTGTCCTGCTTCCTAGAGG + Intergenic
918303606 1:183226526-183226548 GCCTGTGTGCTCAGTCACAGTGG + Intronic
921063752 1:211608326-211608348 GCCTGCGTGGCCTTTCCTAATGG + Intergenic
921934251 1:220781783-220781805 GCCTGTGTGATCCTTCTGAGAGG + Exonic
922551092 1:226495120-226495142 CCCTATGTGCTCTTTCTAAGTGG + Intergenic
922623991 1:227018650-227018672 GCCTGTATTCTGTTTCTTAGAGG - Intronic
922729395 1:227942000-227942022 GCCTGTGTGCTCTTTCCTAGGGG + Intronic
1063950875 10:11222120-11222142 GCCTCTGTGTTCTTTCCTAGTGG + Intronic
1066518464 10:36189818-36189840 GCCTTTGTGCTGTATCTTAGAGG + Intergenic
1067082609 10:43220015-43220037 GTCTGGGTGCTGTTTCCCAGAGG - Intronic
1067680139 10:48429576-48429598 CCCTTTGTGCTTTTTCCCAGAGG + Intronic
1068276344 10:54803487-54803509 GCCTTTGTGCTCTGGCTTAGGGG + Intronic
1068650309 10:59515262-59515284 GCCTATGTGATGTATCCTAGAGG + Intergenic
1069703627 10:70443198-70443220 GCCTTTGTCCTCTGTCTTAGGGG + Intronic
1069875476 10:71560385-71560407 ACCTCTGTTCTCTTACCTAGAGG + Intronic
1070442449 10:76460104-76460126 GCCTGTGACATCTCTCCTAGAGG + Intronic
1072793449 10:98336120-98336142 GCCTCTGTGCTCTCTGCAAGGGG - Intergenic
1073908209 10:108309036-108309058 TCCTGTCTGCTCTATTCTAGTGG - Intergenic
1074758540 10:116646697-116646719 GCCTGTGTGGTCTTTTTTTGAGG + Intergenic
1074814262 10:117133034-117133056 GCCGCTTTGCTCTTTCCTGGAGG + Intronic
1075876701 10:125813494-125813516 GCATGTGTACTCTTTCCCAGTGG - Intronic
1075889825 10:125938344-125938366 CACTGTGTGCTCATTCCTACTGG - Intronic
1076623867 10:131809846-131809868 GACTGTGTGCTCTTTGATGGTGG - Intergenic
1079444498 11:20546701-20546723 GCCTGTGTCCTTTCCCCTAGCGG - Intergenic
1083777511 11:64901543-64901565 GCCTGAGTGGTCTGTCCAAGAGG + Intronic
1086336800 11:85809273-85809295 CCCTGTTTGCTTTATCCTAGAGG - Intronic
1089025683 11:115267415-115267437 GCCAGTGTGCTATCTCCTTGAGG + Intronic
1089818532 11:121199681-121199703 GCCTGTGTGTGGATTCCTAGGGG + Intergenic
1093000592 12:13991693-13991715 TCCTGTGTTCTCTATCTTAGTGG - Intergenic
1093622226 12:21305689-21305711 GCCTGTGTTCTCTTCCTGAGCGG - Intronic
1096691438 12:53324592-53324614 GCCGGAGTGATTTTTCCTAGGGG - Intronic
1097761311 12:63468208-63468230 TCCTCTGTTTTCTTTCCTAGGGG + Intergenic
1100337231 12:93642575-93642597 TCCTGTGAGCTCTTTCCAAGTGG - Intergenic
1100397194 12:94195482-94195504 GCAAGTGTGCTCTTTCCTGTAGG - Intronic
1101346781 12:103893179-103893201 GCCTGTGTGCTCTGTTCGAAGGG + Intergenic
1102637334 12:114335780-114335802 GCCAGGGTGCCCTGTCCTAGAGG - Intergenic
1103341996 12:120225746-120225768 GCCAGTGTGATCCTTCCTTGTGG + Intronic
1109036295 13:57265512-57265534 GCCTGTGTGTTCATTTCTATTGG + Intergenic
1109208183 13:59505073-59505095 GCCTCTTGGCTCCTTCCTAGGGG - Intergenic
1113597287 13:111542305-111542327 GCCTGTGTCATCTGTCCTGGTGG + Intergenic
1114173587 14:20299031-20299053 TCCTTGGTGCTCTATCCTAGTGG - Intronic
1114227543 14:20752774-20752796 CCCTGTGGGCTCCTTCCAAGTGG - Intergenic
1115732466 14:36286092-36286114 GCCTTTTTGCTCTTTTCAAGAGG + Intergenic
1116999473 14:51357504-51357526 GCCTCTGTGCTTTTTCTCAGTGG + Intergenic
1117445137 14:55797065-55797087 GCCTGTTTGTTCTTTCCTCTGGG + Intergenic
1118599214 14:67459691-67459713 GCGTGTGTGCTCTTTAGTACTGG - Intronic
1126026191 15:44448263-44448285 GCCTGTGTGCTGGATGCTAGAGG + Intronic
1128456742 15:67835487-67835509 GCCTGCGTGTTATTTCATAGAGG - Intergenic
1130174944 15:81558968-81558990 GCCTGTGTGCTCTAACCCTGTGG + Intergenic
1131795139 15:96008528-96008550 GCCTGTGTCCCCTTTTCTTGAGG - Intergenic
1134440730 16:14298399-14298421 GCCTGTGGGCGCTTTCCTTGGGG - Intergenic
1136406268 16:30049477-30049499 TCCTGTCTGCCCTTTCCTAGGGG + Intronic
1136511855 16:30742960-30742982 GCCTGTGTAGCCTTTCCTAAAGG - Intronic
1136573292 16:31109158-31109180 GCCTGGGTCCTCAGTCCTAGCGG + Exonic
1138350021 16:56341537-56341559 GCCTGTCTGCTCTTGCCTTTAGG + Intronic
1138729714 16:59181950-59181972 GGCTGTGTGCTCTAACCTTGAGG + Intergenic
1143213163 17:5204337-5204359 GCCTGGGTCCTCTTTCATAAGGG - Intergenic
1144343578 17:14331152-14331174 TCCTGTGTCCTATTTCCTAGGGG - Intronic
1148330246 17:46809799-46809821 GCCTCTGTGCCCTCTCCCAGGGG + Intronic
1149355404 17:55834483-55834505 ACATGTGGGCTCTTTCCTGGTGG - Intronic
1149543632 17:57487314-57487336 CCCTGTGTGCTCCATCCTAGTGG + Intronic
1150455550 17:65304112-65304134 ACCTGAGTGCTCTTTCTGAGGGG - Intergenic
1151396408 17:73826140-73826162 GACTGTGTCCTCTCTCCAAGGGG + Intergenic
1151704965 17:75762672-75762694 GCCAGGGTGCTCTATCCTGGAGG - Intronic
1152401857 17:80071234-80071256 GCCTTTGTCCTATTTCCTGGCGG + Intronic
1155203814 18:23539923-23539945 GCCTGTGTACTTTGTCCTGGAGG - Exonic
1155436676 18:25819863-25819885 TGCTGCTTGCTCTTTCCTAGTGG - Intergenic
1158078111 18:53555300-53555322 GCCTTTGTGATTTTTCATAGAGG + Intergenic
1158837269 18:61344048-61344070 GCATGTGAACTCTTTCTTAGAGG + Intronic
1159938524 18:74387771-74387793 GCCTTTGTGATCTTTCCTCTTGG + Intergenic
1167793596 19:51695011-51695033 GTGTGTGTGTTCTATCCTAGAGG - Intergenic
924996764 2:368554-368576 GCCTGTGTGCCCTCACATAGAGG + Intergenic
926318249 2:11727518-11727540 GCTTGTGTGCTCACTGCTAGTGG + Intronic
931814819 2:65890155-65890177 GCCTGAGTGGTCTTGCTTAGTGG + Intergenic
934749366 2:96782897-96782919 ACCTGTGGGCTCTTTAATAGTGG + Intronic
938180374 2:129176823-129176845 GCCCGTGGGCTCTATCCTGGCGG - Intergenic
938557682 2:132440417-132440439 CCCTTTTTGCTCCTTCCTAGGGG + Intronic
940901173 2:159127973-159127995 GGCTGTCTGCCCTTTCCCAGTGG + Intronic
941055023 2:160777343-160777365 GGCTGTGTGCTCTTACCTTGAGG - Intergenic
941069733 2:160942518-160942540 GCCAGTGTGCCCATCCCTAGGGG + Intergenic
941305280 2:163856983-163857005 TCCTGGGAGCTCTTTCCTAAGGG + Intergenic
942926516 2:181439628-181439650 GCATGTTTGCTCTATCCAAGAGG - Intergenic
943048849 2:182891794-182891816 GACTGTCTTGTCTTTCCTAGAGG - Intergenic
947612737 2:231533766-231533788 GCCTGTGTGCTCCTTTCCACTGG - Intergenic
948020943 2:234732786-234732808 GCCAGTGTGCTCTGTCCTGGAGG - Intergenic
948508572 2:238448087-238448109 GGCTGTGTGCTGTTCCCGAGGGG + Exonic
1172426223 20:34858029-34858051 GGTTGTGTGCCCTTTCCTGGAGG - Intronic
1175060117 20:56234207-56234229 GCCTGTGACATCTTTCTTAGAGG + Intergenic
1175315501 20:58044064-58044086 GCCTCTGTGCTACTTCCCAGAGG - Intergenic
1176116372 20:63433271-63433293 GTCTGTGTGCTCTGTCCTGTTGG + Intronic
1176343529 21:5719997-5720019 GCCTGGGGACTCTTTCCTACAGG - Intergenic
1176501298 21:7604459-7604481 GCCTGGGGACTCTTTCCTACAGG + Intergenic
1176537850 21:8118066-8118088 GCCTGGGGACTCTTTCCTACAGG - Intergenic
1178404245 21:32311559-32311581 GCCTGTGTGGCCTTCCCTATGGG + Exonic
1179801175 21:43812121-43812143 TCCTCTGTTCTCTTTCCCAGGGG + Intergenic
1184107228 22:42375012-42375034 GTGTGTGTGCTCTGTCCTAAGGG + Intergenic
1203242797 22_KI270733v1_random:34421-34443 GCCTGGGGACTCTTTCCTACAGG - Intergenic
953809939 3:46103649-46103671 CCCTGTGTGCTCTTTATTATGGG + Intergenic
955622669 3:60881509-60881531 GCCTTTGTGATCTGTCCTTGAGG - Intronic
955661206 3:61301204-61301226 GATTTTGTGCTATTTCCTAGAGG + Intergenic
959595496 3:108124703-108124725 GCCTGTGTTCTCTGCCCTTGAGG - Intergenic
960202668 3:114856435-114856457 GCCTGTGAGCTCTTGTTTAGGGG + Intronic
960812064 3:121635058-121635080 CCCTGTGTGTTCTTCCCAAGTGG + Intronic
960994505 3:123332111-123332133 GGCTGTGTGCCATTCCCTAGCGG - Intronic
961820899 3:129575221-129575243 GACTGTGTCCTGTTTCCTATGGG + Intronic
963102606 3:141621346-141621368 GCCTGTGTGCTCTTAACTGTTGG - Intergenic
964044985 3:152312828-152312850 GCCTGTATGCTCTTTTCTTTGGG + Intronic
966308679 3:178568510-178568532 GGTTTTGTGCTCTTTCCAAGCGG - Intronic
967619629 3:191617535-191617557 GCATGTGTTATCTCTCCTAGTGG - Intergenic
967938511 3:194748298-194748320 GCCTGTGTGCTCTGCCTGAGCGG - Intergenic
968191535 3:196671436-196671458 GCCTGTGTACTCTACCCTGGGGG - Intronic
968736309 4:2298515-2298537 GCCTGTGTGCGCCTTCCTTCCGG - Intronic
968748024 4:2370974-2370996 GCCTGGGTCCTCTTCCCTGGGGG - Intronic
969034859 4:4244965-4244987 CCCTGTGGGCTTTTTCCTTGTGG + Intronic
970884744 4:20975426-20975448 GCCTGAGTGCCCTGTCCTATTGG - Intronic
971595126 4:28517325-28517347 GCCTTTATGCTCTTTCTTACAGG - Intergenic
974675180 4:65079488-65079510 GTTTGTGTGCTCTTTCCTGGAGG + Intergenic
986385476 5:7229589-7229611 GCCTGTGTGGTTTCTACTAGTGG + Intergenic
986909154 5:12532807-12532829 GGCTGTGTGCTCTATCTTGGGGG - Intergenic
990134601 5:52630572-52630594 GGCTGTGTGCTCTTACCCTGGGG + Intergenic
994828935 5:104752375-104752397 TCCTGTGTGTTCTTTCATTGTGG + Intergenic
995788604 5:115859151-115859173 GCCTGTGCGATCTTTACTTGAGG + Intronic
998230324 5:140357538-140357560 GCCTGGGTGCCCTTTCTCAGGGG + Intergenic
999154135 5:149446065-149446087 GCGTGTGTGCTGTCTCCCAGTGG - Intergenic
999468332 5:151828457-151828479 GCTTGTTGCCTCTTTCCTAGAGG + Intronic
999762460 5:154713056-154713078 ACCTGTGGGCTCCTTCCTCGGGG - Exonic
1001037651 5:168309189-168309211 CCCTCTTTGCTCTTCCCTAGGGG + Intronic
1001037741 5:168309777-168309799 CCCTCTTTGCTCTTCCCTAGGGG + Intronic
1003816851 6:9851280-9851302 GCCTGTCTGGTCATTCCCAGAGG + Intronic
1004041796 6:11986406-11986428 GCCTGTGTTCTCCTTGGTAGAGG - Intergenic
1006592120 6:35166094-35166116 ATCTGTGTGTTCTTTCCTGGAGG - Intergenic
1007230951 6:40347537-40347559 GCCTGTATGCTGTGTCCTAGGGG + Intergenic
1007251022 6:40495044-40495066 ACCTGTGTGTTATTCCCTAGAGG - Intronic
1007338874 6:41176589-41176611 ACCTGTCTTCTCTTTCCTAACGG - Intergenic
1007654919 6:43446108-43446130 GCCAGTGTGCTCTTTCAAAGTGG - Intronic
1007780749 6:44252987-44253009 GCCTGTTTTCTCTTTCAAAGTGG + Intronic
1011611850 6:89159719-89159741 CACTGTGTGCTACTTCCTAGAGG - Intronic
1012927940 6:105286459-105286481 GACTTAATGCTCTTTCCTAGAGG - Intronic
1016278126 6:142379466-142379488 GCCTGTGAACTCTTTCTTAAAGG - Intronic
1017424519 6:154306629-154306651 CTGTGTGTGCTCTTTCCTAGGGG - Intronic
1018047599 6:159979050-159979072 GCCTGTGGGCTATGGCCTAGAGG + Intronic
1019208838 6:170387899-170387921 TCATGTGAGCTTTTTCCTAGTGG + Intronic
1024632824 7:51263254-51263276 GCCTGTGTGCTCTTGCTCATAGG - Intronic
1026312606 7:69200267-69200289 GGCTGTGTGCTCTTGCCTATGGG - Intergenic
1026926122 7:74195164-74195186 GTCTCTGTGCTCTTTCCTCTGGG - Exonic
1028165026 7:87528913-87528935 GCCTGTGTGCCCTGGCCCAGTGG - Intronic
1029274507 7:99396247-99396269 GCCTGGGTGCTCATTCAGAGAGG - Exonic
1029536861 7:101162454-101162476 GCCTGTGTGGTCCTTCCCAAGGG - Intergenic
1032498634 7:132382156-132382178 GCCTGTGTGCTTTGTCCAAGAGG - Intronic
1033057149 7:138067671-138067693 GCCTCTGTGGTCTTTTCTTGTGG + Intronic
1034446700 7:151117351-151117373 GACTGCGCGCTCTGTCCTAGGGG + Exonic
1035034220 7:155884765-155884787 GCAAGTGTGCTCTTTGCTACTGG - Intergenic
1035133245 7:156675277-156675299 GCCTGTGTGCTGTCTCCTCCCGG + Intronic
1035269749 7:157712153-157712175 ACCTGTGTGCTCTCCCCTTGGGG - Intronic
1039766514 8:40633934-40633956 GCCTGGTTGCTATTTCCTGGTGG - Intronic
1040894963 8:52356359-52356381 GTCTGTGTGCTGTTAGCTAGAGG - Intronic
1041346651 8:56906092-56906114 GCATGTATGCTGTCTCCTAGTGG + Intergenic
1045189948 8:99872338-99872360 GGCTGTGTTCTCTTTCCCACAGG + Intronic
1048429231 8:134353603-134353625 GACTGCGTGCTCCTTCCCAGAGG + Intergenic
1048668947 8:136695225-136695247 GCCTGTGTGCTCTCTGCCAATGG + Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052778162 9:32754058-32754080 TTCTGTGTCCTCTCTCCTAGGGG - Intergenic
1053024053 9:34715899-34715921 GCCCGTTTGCTCTTGCCTGGTGG + Intergenic
1056646282 9:88414583-88414605 GACTATGTGCTCTATCCTGGTGG + Intronic
1058955027 9:109938352-109938374 GCCTTTGTTCTCTTTACTGGAGG + Intronic
1059724120 9:116989370-116989392 GATTGTGTGCTCTTTCTGAGGGG + Intronic
1060412621 9:123410177-123410199 GGCTGTGCCCTCATTCCTAGAGG - Intronic
1061722872 9:132563981-132564003 GCTTGTGTGCTATTTCCTCAGGG + Intronic
1062605191 9:137344188-137344210 GCCTGTATCCTCTTTACTACTGG + Intronic
1203459123 Un_GL000220v1:17504-17526 GCCTGGGGACTCTTTCCTACAGG - Intergenic
1190481276 X:50879470-50879492 GGCTGTGTGCACTTGCCAAGTGG + Intergenic
1195012452 X:100746452-100746474 GCTTGTGTGCTCTTTGGGAGGGG - Intergenic
1195679660 X:107534988-107535010 GCATGTGTGCAGTTGCCTAGTGG + Intronic
1197750391 X:129959898-129959920 GCCTGACTGCCTTTTCCTAGGGG + Intergenic