ID: 922730289

View in Genome Browser
Species Human (GRCh38)
Location 1:227945860-227945882
Sequence CCAGCAGCCCAGATGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 236}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922730275_922730289 20 Left 922730275 1:227945817-227945839 CCAGCCCAACCTTGGGAACTGAC 0: 1
1: 0
2: 2
3: 5
4: 112
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730269_922730289 27 Left 922730269 1:227945810-227945832 CCCCTCCCCAGCCCAACCTTGGG 0: 1
1: 2
2: 7
3: 73
4: 631
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730271_922730289 26 Left 922730271 1:227945811-227945833 CCCTCCCCAGCCCAACCTTGGGA 0: 1
1: 0
2: 3
3: 54
4: 547
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730272_922730289 25 Left 922730272 1:227945812-227945834 CCTCCCCAGCCCAACCTTGGGAA 0: 1
1: 0
2: 1
3: 32
4: 364
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730277_922730289 15 Left 922730277 1:227945822-227945844 CCAACCTTGGGAACTGACTTACA 0: 1
1: 0
2: 2
3: 5
4: 114
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730274_922730289 21 Left 922730274 1:227945816-227945838 CCCAGCCCAACCTTGGGAACTGA 0: 1
1: 1
2: 0
3: 11
4: 143
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730276_922730289 16 Left 922730276 1:227945821-227945843 CCCAACCTTGGGAACTGACTTAC 0: 1
1: 0
2: 0
3: 11
4: 90
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730280_922730289 11 Left 922730280 1:227945826-227945848 CCTTGGGAACTGACTTACAGGGG 0: 1
1: 0
2: 2
3: 6
4: 134
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236
922730273_922730289 22 Left 922730273 1:227945815-227945837 CCCCAGCCCAACCTTGGGAACTG 0: 1
1: 0
2: 3
3: 27
4: 240
Right 922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG 0: 1
1: 0
2: 3
3: 14
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922730289 Original CRISPR CCAGCAGCCCAGATGGAACC TGG Intronic
901701106 1:11045152-11045174 CCCAGAGCCCAGGTGGAACCAGG + Intronic
903392739 1:22976238-22976260 CAAGCAGCCCAGAGAGAGCCTGG + Intergenic
903768096 1:25747527-25747549 CCCGGAGCCCACATGGAGCCTGG - Intronic
905261830 1:36724802-36724824 GCATCAGCCCAGAGGCAACCTGG - Intergenic
906212436 1:44019664-44019686 GCAGCAGCCCAGCTGGGCCCTGG + Intronic
906542347 1:46597049-46597071 CCAACTACCCAGATGGACCCTGG + Intronic
907305028 1:53508566-53508588 CCCGCAGCCCAGGTGGAACCAGG - Intronic
913562026 1:120031180-120031202 CCAGTAGCCCAGGTGCAAGCTGG + Intronic
913636098 1:120762414-120762436 CCAGTAGCCCAGGTGCAAGCTGG - Intergenic
914282610 1:146190571-146190593 CCAGTAGCCCAGGTGCAAGCTGG + Intronic
914543640 1:148641287-148641309 CCAGTAGCCCAGGTGCAAGCTGG + Intronic
914622981 1:149429722-149429744 CCAGTAGCCCAGGTGCAAGCTGG - Intergenic
915826651 1:159085223-159085245 CTTGCAGCCCAGATGGACACAGG - Intronic
916202403 1:162284428-162284450 CTGGCAGCCGTGATGGAACCTGG + Intronic
916282400 1:163066288-163066310 GCAGCAGCCTAGATAGAACTGGG - Intergenic
922345673 1:224694325-224694347 CCAGCAGCCCTCATGGCAGCAGG + Intronic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
922749495 1:228063931-228063953 CCAGCAGCGGAGATAGAGCCTGG - Intergenic
922778251 1:228227546-228227568 CTAGCAGCCCTCATGGACCCAGG - Intronic
924069357 1:240260046-240260068 ACAGCAACCTAGATGGAACTGGG - Intronic
924594575 1:245434382-245434404 CTTGCAGCCCAGCTGGACCCTGG - Intronic
1062974452 10:1672994-1673016 CCAACAGCCCGGAGGGGACCAGG + Intronic
1063147119 10:3305686-3305708 CCAGAAGCCCAGATGCAAGAAGG - Intergenic
1063367134 10:5498474-5498496 CCAGCAGCTCAGGCAGAACCTGG + Intergenic
1063523015 10:6758061-6758083 CCAGCATCCCAAATGGGAACAGG - Intergenic
1065116910 10:22492197-22492219 CCAGCAGCCAATATGGTGCCAGG + Intergenic
1065378860 10:25068817-25068839 CCACCACCCCAGCTGGAACAAGG + Intergenic
1066258387 10:33704188-33704210 GCAGAAGCCCAGATGGATCAGGG + Intergenic
1066336876 10:34486745-34486767 CCAGCAGCACTGATGTCACCAGG - Intronic
1067288752 10:44926570-44926592 CCAGCAGGGCAGCTGGAACCTGG + Intronic
1071069040 10:81670113-81670135 CCAGCACCCAAGGTGGAAGCAGG + Intergenic
1071290549 10:84185804-84185826 CCATCAGCCCAGAGGGGGCCTGG - Intergenic
1073232798 10:101986708-101986730 CCTGCTGCCCAGCTGGAAGCAGG + Intronic
1075632413 10:124008807-124008829 GCAACAGCCCAGGTGGGACCTGG - Exonic
1076141149 10:128079209-128079231 CCAGCAGCACAGTTGGCACCTGG - Intronic
1076406456 10:130215310-130215332 TCAGAAGCCCAGAAGGACCCAGG - Intergenic
1077376690 11:2208608-2208630 CCAGCAGGCCAGGGGGCACCAGG - Intergenic
1077474227 11:2778845-2778867 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1077474379 11:2779453-2779475 GCTGCAGCCGAGATGGAAGCAGG - Intronic
1078141166 11:8694010-8694032 ACAGCAGCCCAGAGGGTCCCAGG + Exonic
1078526420 11:12104908-12104930 CCAGCACCCCAGATAGATCTGGG + Intronic
1078857889 11:15221329-15221351 CCAGGACCCCATGTGGAACCAGG - Intronic
1083269238 11:61562966-61562988 CCAGCTGCCCAGAGGGGAACGGG + Intronic
1083749300 11:64752640-64752662 CCAGCCGCCCAGATGGGGCACGG + Intronic
1084095786 11:66910337-66910359 CCAGCTGCCCTGATGGCACAAGG - Intronic
1084311713 11:68320553-68320575 CCAGGAGAACAGCTGGAACCCGG - Intronic
1084445634 11:69202051-69202073 CCCGCAGCCCTGAGGGAGCCAGG + Intergenic
1084955630 11:72689780-72689802 CCTGCAGCCCAGTTGGTTCCAGG - Intronic
1086222881 11:84471128-84471150 CTGGCAACCCAGATGGAACTGGG + Intronic
1087045089 11:93838083-93838105 TGTGCAGCCCAGATAGAACCTGG - Intronic
1088132188 11:106506727-106506749 ACAGCAGCCCAGAAGGGACATGG + Intergenic
1089973417 11:122712456-122712478 TCAGCAGCCCAAATGGACCCAGG + Intronic
1090854288 11:130598433-130598455 CCAGGAGCCCCGATGGCTCCAGG + Intergenic
1091885836 12:4016398-4016420 GCAGCAGCCCAGATAGAAACAGG + Intergenic
1094813384 12:34162965-34162987 CCTGTGCCCCAGATGGAACCAGG + Intergenic
1095103528 12:38205560-38205582 CCTGTTCCCCAGATGGAACCAGG - Intergenic
1095487453 12:42699805-42699827 CCAACAGCCCAGAAGAAAACAGG - Intergenic
1099801126 12:87457591-87457613 GCAGCAGCATAGATGGAACTGGG + Intergenic
1103912695 12:124361027-124361049 CCAGCAGCCTCGGTGGACCCCGG + Intronic
1104819541 12:131666900-131666922 CCAGGACCCCAGAAGGAAACGGG + Intergenic
1105849740 13:24323267-24323289 CCAGCAGTCCCGTTGCAACCCGG + Intergenic
1106465802 13:30013604-30013626 CCAGCCATCCTGATGGAACCCGG - Intergenic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1118730336 14:68661498-68661520 CCAGCATCACAGAAGGAACCAGG - Intronic
1118738075 14:68716702-68716724 CCAGCACCACAGATGAACCCAGG + Intronic
1119977249 14:79038842-79038864 CCAGAGATCCAGATGGAACCAGG - Intronic
1124999117 15:34753251-34753273 CCTGCAGCCCGGCTGTAACCAGG - Exonic
1127397677 15:58555743-58555765 ACAGCAGGACAGATGGAGCCAGG + Intronic
1129170941 15:73807464-73807486 CCAGCAGGGCAGAGGGAACATGG - Intergenic
1129886298 15:79040195-79040217 CCAGCCTCTCAGACGGAACCTGG + Intronic
1134012625 16:10866533-10866555 CCAGCAGCCGAGAGGGGCCCCGG + Intergenic
1137564503 16:49524782-49524804 CCTGCTGCCCAGATGGCAGCCGG - Intronic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1138657575 16:58500016-58500038 CCAGCAGCCAATATGGGAGCTGG + Intronic
1139391600 16:66609210-66609232 ACAGCAGCCCCGCTGGACCCGGG + Intronic
1140517004 16:75550474-75550496 CCAGCATCTCAGCAGGAACCTGG + Intronic
1141031625 16:80594193-80594215 CCAGGAGCCCAGCTGAGACCTGG - Intergenic
1142005341 16:87687148-87687170 CCAGCAGCCGAGAAGGCCCCGGG - Intronic
1142317507 16:89357349-89357371 CCAGCACCTCACAGGGAACCAGG + Intronic
1143337881 17:6187121-6187143 ACAGCAGCCCAGATGGATTAAGG + Intergenic
1144821213 17:18076049-18076071 CCAGCAAGCCAGATGGATGCTGG - Intergenic
1146186505 17:30727817-30727839 ATAGCAGCGCAGAGGGAACCAGG + Intergenic
1146619996 17:34389684-34389706 CACGCAGACCAGATGGAAGCTGG - Intergenic
1146666977 17:34711755-34711777 CAAACAGCCTAGATGGAAACAGG - Intergenic
1147322850 17:39656592-39656614 CCATCAGCCCAGATGGATTATGG + Intronic
1147914162 17:43876861-43876883 CCAGCAGCCCTGATGCAAGTGGG + Intronic
1148083591 17:44980810-44980832 ACAGGGGCCCAGATGAAACCAGG + Intergenic
1148113684 17:45162231-45162253 CCAGAAGCACAGCTGGGACCTGG - Intronic
1150124649 17:62628183-62628205 CCAGCAGCCTAGGAGGAAGCGGG + Intronic
1151785394 17:76272626-76272648 ACAGGAGCCCAGCTGGAGCCTGG + Intergenic
1152250749 17:79211481-79211503 CCAGCAGCTCTGCTGAAACCTGG - Intronic
1152255767 17:79238594-79238616 ACATCAGCCCAGATGGGAGCTGG + Intronic
1152446255 17:80346146-80346168 CCATCAGCCTAGATGAAAACGGG + Exonic
1152592453 17:81220351-81220373 GCAGCACCCCAGAGGGAGCCTGG + Intronic
1152722700 17:81930728-81930750 CCAGCAGGCCAGGTGGGCCCTGG - Intergenic
1152878964 17:82804583-82804605 CCAACAGCCCACAAGGCACCGGG - Intronic
1156215759 18:34996513-34996535 CCAGCACCCAACATGGTACCTGG + Intronic
1160060013 18:75521517-75521539 CCAGCAGCTCAGATGGGAGGTGG - Intergenic
1160754477 19:750544-750566 CCAGCAGCCCTGAGGGAGCCCGG + Intergenic
1161043050 19:2120350-2120372 CCTGCGGCCCACCTGGAACCTGG + Intronic
1162972337 19:14188240-14188262 ATAGCAGCGCAGAGGGAACCAGG - Intronic
1164502350 19:28830646-28830668 CCAGCAGCTCAGAGGGAATTTGG + Intergenic
1165886808 19:39084447-39084469 CCAGCTGCCAGGATGGAGCCGGG - Intronic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
925933508 2:8731035-8731057 CCAGCAGCCCTGAAGAAAACTGG - Exonic
926753747 2:16219827-16219849 CCAGCAGGCCAGTTGGCACCTGG - Intergenic
927679020 2:25127934-25127956 GCTGGAGCCCAGATGGTACCAGG + Intronic
931636643 2:64346563-64346585 GCAGCTGCCCACATGCAACCTGG - Intergenic
931988864 2:67769117-67769139 CCACCAGCCCAGAAGGAGCAGGG + Intergenic
932479882 2:72032777-72032799 CGAGCAGCAGAGCTGGAACCCGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933748716 2:85589393-85589415 CCTGGAGCCAAGATGGACCCAGG - Intronic
934984164 2:98872016-98872038 CCAGCAACACAGATGGAGCTGGG + Intronic
935361997 2:102253127-102253149 CAAACTCCCCAGATGGAACCAGG - Intergenic
936525725 2:113240345-113240367 CCAGCAGCCCAGACGGTCACTGG + Intronic
937322131 2:120967144-120967166 CCACCAGCCCATGGGGAACCCGG + Intronic
944214334 2:197239023-197239045 GCAGCAAGACAGATGGAACCTGG - Intronic
944235355 2:197437138-197437160 CCAGCAGACTGGATGGTACCTGG - Intergenic
944353464 2:198757922-198757944 CCAGAAGGCCACATGGAATCTGG - Intergenic
945058623 2:205889336-205889358 CCTGCAGCCAGGATGGAATCAGG - Intergenic
945342449 2:208673183-208673205 CCATCAGCCAATATTGAACCAGG - Intronic
945356984 2:208852325-208852347 CAAGCTGCCAAGATTGAACCAGG - Intronic
946735700 2:222752288-222752310 ACAGCAGCCCAGATGGACAAAGG + Intergenic
947379646 2:229532840-229532862 CCAGCAGCCCACAGGGGGCCAGG - Intronic
947875791 2:233467548-233467570 CCAGCAGCCCAGGAGGGAGCAGG - Intronic
948864527 2:240768578-240768600 CCAGCAGCCCAGGTGGGGCATGG - Intronic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169041640 20:2500406-2500428 CCAGCAGCCAAGATGAAATATGG + Intronic
1170981786 20:21221014-21221036 CCAGCAGCCCAGCTGGGCTCAGG - Intronic
1171097582 20:22346646-22346668 CCAGCAGGACAGATGACACCCGG + Intergenic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1171297925 20:24034912-24034934 GCACCAGCACAGATGGGACCTGG - Intergenic
1172072754 20:32270501-32270523 ACAGCAGCCCTGAGGGAAGCAGG + Intergenic
1172358328 20:34295037-34295059 CCAGCAGCCATGATGGGTCCAGG + Intronic
1174580364 20:51567104-51567126 CCACCCTCCCAGCTGGAACCTGG + Intergenic
1175055200 20:56191470-56191492 CCCCCAGCCCAGGTGGATCCAGG + Intergenic
1175601639 20:60279149-60279171 CCAGCAGCTGGGATGGAATCAGG + Intergenic
1175962494 20:62644185-62644207 CCAGCAGCACAGAGGGAAGTCGG - Intronic
1176108257 20:63399519-63399541 CCAGCAGCCCTCATGGAACTCGG + Intergenic
1177164357 21:17582866-17582888 CCAGCAGCCAACATTGAACTTGG - Intronic
1178605157 21:34029865-34029887 CACGTAGCCCAGATGGAAGCGGG + Intergenic
1179155831 21:38850376-38850398 CCATCAGTCCAGGTGGAAGCTGG - Intergenic
1179709574 21:43205531-43205553 CCAGCAGCCCAGCTGGAGCCTGG - Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1182358809 22:29734901-29734923 ACAGCAGCCCTGATGCACCCTGG - Intronic
1184109501 22:42386844-42386866 CCAGCAGGCCAGCTGCCACCAGG + Intronic
1184519127 22:44982039-44982061 CCACCAGCCCCGAGGGAACGGGG + Intronic
1184596811 22:45518898-45518920 CCCGCAGCCTGGATGGATCCGGG - Intronic
949593874 3:5523485-5523507 CAAGCTGCCAAGATTGAACCAGG - Intergenic
950955315 3:17046809-17046831 CCACCAGCTCAGATCTAACCTGG + Intronic
951987162 3:28633360-28633382 CCATCAGGCCATATGGAAACTGG - Intergenic
956253847 3:67263215-67263237 CCAGCAGCACAGAGGGAAGGGGG + Intergenic
956799507 3:72744119-72744141 CCACCAGCCCAGAGGGCCCCTGG - Intergenic
957638212 3:82814938-82814960 CCAGCACCCATGCTGGAACCTGG - Intergenic
958879494 3:99653728-99653750 CCAGCATCCTAGATGCATCCTGG + Intronic
960635746 3:119782697-119782719 CCAGCAGGCCAAAAGGAATCAGG - Exonic
961328302 3:126124533-126124555 CCAGCAGCCCAGCAGCAAGCTGG + Intronic
962835807 3:139187515-139187537 CCAGGATCCCAGCTGGAGCCAGG - Intronic
963935374 3:151046888-151046910 TCAACAGCCCACATGGAAACAGG + Intergenic
966757457 3:183384762-183384784 CCTGCTGCCCAGACAGAACCAGG - Intronic
966904719 3:184513842-184513864 CCAGCAGCCCAGGGGGACTCCGG - Intronic
967525370 3:190486659-190486681 CTAGCAGCACAGATGGCACTGGG + Intergenic
967883404 3:194317132-194317154 CAAGCAGCCGGGATGGAGCCCGG - Intergenic
968446220 4:653665-653687 CCACAAGCTCAGATGAAACCTGG + Intronic
968453183 4:684584-684606 CCAGCAGCTCATGTGGAACAAGG - Exonic
968529103 4:1080859-1080881 CCAGCATCCCAGAGAAAACCCGG - Intronic
969099352 4:4757192-4757214 TCAGCTGCCCAGATTCAACCTGG - Intergenic
970345455 4:15148480-15148502 ACAGCAGCCCAAATGGCAGCCGG + Intergenic
978719414 4:111889807-111889829 AATGCAGCCCAGCTGGAACCTGG + Intergenic
980081341 4:128347679-128347701 TCATCACCCCAGATGGAAACAGG + Intergenic
981275679 4:142896154-142896176 ACAGCCCCCCAGATTGAACCAGG - Intergenic
981538636 4:145825480-145825502 GCAGCAGTCCAGATGGGACGTGG + Intronic
981637577 4:146898350-146898372 CCAGGAGCTCAGAAGGCACCAGG - Intronic
982289330 4:153764125-153764147 TCATCAGCCAAGATGGGACCTGG - Intergenic
982312735 4:154002748-154002770 CCACCAGGCCAGGTGGCACCTGG - Intergenic
982719412 4:158844222-158844244 CCAGCAGCTCATATAGTACCTGG + Intronic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
987324632 5:16801437-16801459 CAAGCAGGCCAGATGAAGCCAGG - Intronic
992385485 5:76280569-76280591 CCAGCTGTCAAGATGGAGCCCGG + Intronic
997740851 5:136252560-136252582 CCAGCAGCCCTTTTGGCACCAGG + Intronic
998080210 5:139268948-139268970 CCAGCAGCACAGATGCAAAGGGG - Intronic
999121411 5:149212422-149212444 CCAGAAGCCCAGCTCTAACCAGG - Intronic
1001564047 5:172688156-172688178 CCATCAGCCCAGATGTGATCTGG - Exonic
1001589523 5:172855814-172855836 CTCACAGCCCACATGGAACCTGG - Intronic
1002840198 6:898893-898915 CTAGCAGCATAGATAGAACCAGG - Intergenic
1003711323 6:8594023-8594045 GCAGCAACACAGATGGAACTGGG + Intergenic
1004002479 6:11607824-11607846 CCAACAGACAAGATGGAAACTGG + Intergenic
1006670286 6:35726076-35726098 CCAGCAGCCCAGGTGACACCCGG + Intronic
1007397341 6:41585351-41585373 CCAGGAGCCCAGATGGGACAGGG + Intronic
1017067388 6:150541772-150541794 CCAGCCACTCAGATGAAACCAGG - Intergenic
1017522755 6:155216325-155216347 CCAACAGCCCAGGTTCAACCAGG - Intronic
1017827041 6:158089340-158089362 CCAGCACCCCAGAGGCATCCCGG - Intronic
1017905136 6:158752818-158752840 CCAGCTGCCCAGATGGCCCCTGG - Intronic
1017951898 6:159142105-159142127 CCAGCAGCCCATGGGGTACCTGG - Intergenic
1018776693 6:167023710-167023732 GCAGCAGAGGAGATGGAACCAGG + Intronic
1019297340 7:285110-285132 CCAGCACCCTAGAGGGAGCCCGG - Intergenic
1019433543 7:1010615-1010637 CCTGCAGCCCAGGGGGAGCCAGG - Intronic
1019491942 7:1318321-1318343 GGAGCAGCCCAGAAGGACCCTGG + Intergenic
1019812442 7:3174683-3174705 CCAGCAGGCCAGAGGGAAGGTGG - Intergenic
1019904509 7:4051622-4051644 CCAGAAGCTGAGATGGAACAGGG - Exonic
1020932306 7:14413223-14413245 TCAGCATCCCAGATGGGGCCAGG + Intronic
1021808777 7:24382281-24382303 CCAGCAGACCAGGTGGACACCGG - Intergenic
1021927236 7:25545424-25545446 CCAGCAGGACAAATGGAGCCAGG + Intergenic
1022246853 7:28568728-28568750 TCAGGAGTCCAGATGGAAACTGG - Intronic
1022286109 7:28957155-28957177 CCAGCAGCGCAGTTGGCAGCTGG + Exonic
1023896108 7:44434268-44434290 CCAGCAACCCAGACGTAGCCTGG + Intronic
1023988895 7:45116162-45116184 CCAGCAGCCCAGATGGAATAAGG + Intergenic
1024128297 7:46323396-46323418 CCAGGAGCCCAGGTGGGACAAGG + Intergenic
1024649599 7:51392153-51392175 CCAGCAGCCTAGATAGGCCCAGG - Intergenic
1025021911 7:55486904-55486926 ACAGCAGGGCAGATGGACCCAGG - Intronic
1025941857 7:66080994-66081016 CCAGAAGCCCTGGTGGAACAGGG + Intronic
1026574583 7:71561569-71561591 CCAGCAGGCCAGTGGGAATCAGG + Intronic
1026858016 7:73767798-73767820 CCAGCAGCCCCTGTGGAACTGGG - Intergenic
1027661977 7:80998075-80998097 TCAAGAGCCCAGATGGAGCCTGG - Intergenic
1029552309 7:101243961-101243983 AGAGCAGCCCAGATGGCAGCGGG + Intronic
1029933094 7:104394288-104394310 CCAGAGGCACAGATGCAACCTGG - Intronic
1030659353 7:112204233-112204255 CCAGCACCCCAGCTGTGACCTGG + Intronic
1032310493 7:130781700-130781722 CTAGCATCCCAGAGAGAACCTGG - Intergenic
1032346929 7:131124967-131124989 CCAGCTGCCCAGATCCAAGCTGG + Intronic
1033514070 7:142089111-142089133 CAAGCAGCCCACATGGACACAGG + Intronic
1035153073 7:156892133-156892155 CCAACAGCACACATGGAACATGG + Intronic
1035662189 8:1356488-1356510 CCACCAGCACAGACAGAACCAGG - Intergenic
1037456878 8:19072625-19072647 CCAGCTGCTCAAATGCAACCAGG + Intronic
1041030671 8:53732827-53732849 CCAGCAGCCCCCCAGGAACCAGG + Intronic
1044016314 8:87051901-87051923 CCAGCAGGACTGATGGATCCTGG - Intronic
1045586893 8:103547939-103547961 CCACCTGCCAAGATTGAACCAGG + Intronic
1047510207 8:125510001-125510023 ACAGCAGCCCAGAGGGCTCCTGG - Intergenic
1047720498 8:127634688-127634710 CCAGTGGCCCAGCTGGAATCAGG + Intergenic
1048386667 8:133918600-133918622 CCAGCTTCCCAGATGCAACAGGG - Intergenic
1049179948 8:141217130-141217152 CCAGCAGCCCATCTTGACCCCGG + Exonic
1049309050 8:141923716-141923738 CCAGCACCCCACATGGCAGCTGG + Intergenic
1049336809 8:142090988-142091010 CCAGCAGCCGCCCTGGAACCGGG - Intergenic
1052836650 9:33255123-33255145 CCAGCAGCCCTGAAGAAATCAGG + Exonic
1053415954 9:37946845-37946867 CCAGCACCCCAGAGGGTCCCTGG + Intronic
1056570427 9:87809986-87810008 TCAGCAGCCAAGAAGGACCCTGG + Intergenic
1056928726 9:90856952-90856974 CCAGCAGCCCAGTGAGCACCTGG - Intronic
1058636556 9:107043960-107043982 CCAGCATTCCAGAAGGAACAGGG - Intergenic
1060310057 9:122451830-122451852 CCCCCAGACCAGAGGGAACCTGG - Intergenic
1061012811 9:127965470-127965492 CCAGGAGCACAGCTGGAACCTGG - Intronic
1061190994 9:129082586-129082608 CCAACAAGCCAGAAGGAACCTGG + Intronic
1061411085 9:130422111-130422133 CCAGCAGCACTGATGGAATGGGG + Intronic
1062311296 9:135938859-135938881 CCATCAGCCCAGCTGGCACACGG + Intronic
1186736262 X:12467928-12467950 CCTGTAACCCAGATGAAACCAGG - Intronic
1189231511 X:39455727-39455749 CCAGCAGGTCAGAAGGAACACGG - Intergenic
1189873322 X:45407022-45407044 CCACCTCCCAAGATGGAACCAGG + Intergenic
1189878268 X:45460131-45460153 CCACCATCCCAGATTGAACCAGG - Intergenic
1192554288 X:72077716-72077738 CCTCCAGCCCAGAGGGATCCGGG + Intergenic
1195178901 X:102338315-102338337 CCAGCACCCATGCTGGAACCTGG - Intergenic
1196042765 X:111223472-111223494 CCAGTAGCCAAAATGGAACATGG - Intronic
1197166404 X:123382343-123382365 ACAGCAGCACAGATTAAACCAGG - Intronic
1198223576 X:134625186-134625208 CCTGGAGCCCAGCTGCAACCTGG - Intronic
1200284174 X:154805083-154805105 CCAGCAGCCCGGTACGAACCCGG + Intronic