ID: 922730656

View in Genome Browser
Species Human (GRCh38)
Location 1:227947450-227947472
Sequence CCGTGTCCTTGCCAAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922730656_922730662 -5 Left 922730656 1:227947450-227947472 CCAGCCTTTTGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 16
4: 137
Right 922730662 1:227947468-227947490 CACGGCGGCCCAAGGAAGTCGGG No data
922730656_922730666 22 Left 922730656 1:227947450-227947472 CCAGCCTTTTGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 16
4: 137
Right 922730666 1:227947495-227947517 GATCCCAGTCCCTAAGCGCGAGG 0: 1
1: 0
2: 0
3: 0
4: 31
922730656_922730661 -6 Left 922730656 1:227947450-227947472 CCAGCCTTTTGGCAAGGACACGG 0: 1
1: 0
2: 0
3: 16
4: 137
Right 922730661 1:227947467-227947489 ACACGGCGGCCCAAGGAAGTCGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922730656 Original CRISPR CCGTGTCCTTGCCAAAAGGC TGG (reversed) Intronic
902891535 1:19447800-19447822 CGGTGGCCTTGCCAGAATGCTGG + Intronic
903242157 1:21990283-21990305 CCCTGAACTTGCCACAAGGCAGG - Intronic
903245667 1:22013470-22013492 CCCTGAACTTGCCACAAGGCAGG - Intergenic
904483108 1:30806449-30806471 CCGTGAGCTTGGCAAAGGGCAGG - Intergenic
905422943 1:37860401-37860423 CCCTGTCCTTTCCAAATGCCTGG + Intergenic
906203205 1:43972861-43972883 GTCTGTCCTTGTCAAAAGGCAGG + Exonic
907962210 1:59294313-59294335 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
909585397 1:77282546-77282568 CAGGGTCCTTGTCAGAAGGCTGG + Intronic
909818515 1:80027795-80027817 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
909863016 1:80632778-80632800 CTCTGTCCTTGCTATAAGGCAGG + Intergenic
911587243 1:99705011-99705033 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
920897763 1:210074921-210074943 CTCTGTCCTTGCGATAAGGCAGG - Intronic
921046011 1:211478674-211478696 CCTAGGTCTTGCCAAAAGGCAGG + Exonic
921116132 1:212093365-212093387 CTCTGTCCTTGCGATAAGGCAGG - Intronic
922510877 1:226166313-226166335 CCCTGTCTCTGCCAAAAGACAGG - Intronic
922730656 1:227947450-227947472 CCGTGTCCTTGCCAAAAGGCTGG - Intronic
923124469 1:231023137-231023159 CAGTGACCTGGGCAAAAGGCTGG - Intronic
923386483 1:233470322-233470344 CTGTGTCCTCGACAAATGGCTGG - Intergenic
924455743 1:244217643-244217665 TGGTGTCCTGGCCCAAAGGCGGG - Intergenic
1063357726 10:5416919-5416941 CCCTGTCCTTGAAATAAGGCAGG - Intronic
1064364966 10:14699437-14699459 CCGGGTCCAAGCCCAAAGGCCGG + Intronic
1065371536 10:24991774-24991796 CTCTGTCCTTGTCATAAGGCAGG + Intronic
1069352944 10:67551509-67551531 CCCTGTCCTTGAGATAAGGCAGG + Intronic
1072095916 10:92179681-92179703 CCCTAACCCTGCCAAAAGGCAGG + Intronic
1074721667 10:116270772-116270794 CCGTGTCCCTCCCCGAAGGCAGG - Intronic
1076850857 10:133092001-133092023 TCGGGTCCTGGCCCAAAGGCAGG + Intronic
1077586647 11:3459056-3459078 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
1080289570 11:30655711-30655733 CCGTGCCCCTGCCAATAGGATGG + Intergenic
1081352115 11:42066534-42066556 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1083826374 11:65206356-65206378 CCTTGTCCTGGCCAAGGGGCTGG - Intronic
1084830359 11:71763916-71763938 CTCTGTCCTTGCAATAAGGCGGG + Intergenic
1088238507 11:107750276-107750298 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1092384552 12:8026234-8026256 CCCTGTCCTTGTCTAAAGGCAGG + Intergenic
1092412875 12:8267789-8267811 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
1092470341 12:8772802-8772824 CTTTGGCCTTGCCAAAAGGAAGG - Intronic
1094496847 12:30994121-30994143 CCTTGTCCATGCCAACAGCCTGG + Exonic
1097838817 12:64301236-64301258 CAGTGTCCTTTCACAAAGGCTGG + Intronic
1099171161 12:79366443-79366465 CCCTGACCTTGCCAAGAGGCAGG + Intronic
1099271203 12:80513126-80513148 CTCTGTCCTTGCGATAAGGCAGG - Intronic
1100641318 12:96484549-96484571 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
1101455204 12:104824593-104824615 CTCTGTCCTTGCGATAAGGCAGG + Intronic
1101963274 12:109265550-109265572 TCGGGTCCTTGCCAGGAGGCTGG - Intronic
1104791433 12:131484365-131484387 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
1106169881 13:27279888-27279910 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
1109172859 13:59117827-59117849 CTTTGTCATTGCCATAAGGCAGG - Intergenic
1109459637 13:62638832-62638854 CCTTGTACTTGCCCAAAGGCAGG - Intergenic
1111156768 13:84337998-84338020 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1112813808 13:103250036-103250058 TGCTGTCCTTGCGAAAAGGCAGG - Intergenic
1112814114 13:103252013-103252035 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1114822989 14:26044004-26044026 CCATCTCCTTGCCAAAAAGGAGG - Intergenic
1115531881 14:34335296-34335318 CAGTGTCCTTACACAAAGGCTGG - Intronic
1119697641 14:76726398-76726420 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
1126475631 15:49062819-49062841 CTCTGTTCTTGCCATAAGGCAGG - Intergenic
1128114619 15:65097342-65097364 CAGAGTCCTGGCCAAAAAGCTGG - Intronic
1133354085 16:5123294-5123316 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
1136275636 16:29177858-29177880 CGGTGTCCTTGCGAAGAGGAAGG - Intergenic
1136279985 16:29202753-29202775 CCCAGTGCTTGCCAAACGGCAGG - Intergenic
1138128307 16:54456851-54456873 CCCTGCCCTTGCGATAAGGCAGG - Intergenic
1139229228 16:65266680-65266702 CCTTGCCCTTCCCAAAATGCTGG - Intergenic
1141671124 16:85492165-85492187 CTGTGTCCCCGCCAAAAAGCTGG - Intergenic
1142079992 16:88143913-88143935 CGGTGTCCTTGCGAAGAGGAAGG - Intergenic
1142084346 16:88168691-88168713 CCTAGTGCTTGCCAAACGGCAGG - Intergenic
1203143594 16_KI270728v1_random:1784850-1784872 TCCTGTGCTTGCCAAAATGCTGG - Intergenic
1143159314 17:4858850-4858872 CCTTGTACTTCCAAAAAGGCAGG - Intronic
1147533118 17:41298723-41298745 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1148130040 17:45257001-45257023 CAGTGTCCAGGCCAAAAGGCTGG - Intronic
1149772544 17:59332428-59332450 CGGTGTCCTTGCCAAGGGGGTGG + Intronic
1150470902 17:65436706-65436728 TCGTGCTCTTGCTAAAAGGCAGG + Intergenic
1152647058 17:81474169-81474191 CCGTCTCCTTGCCCAACTGCAGG - Intergenic
1154350696 18:13580702-13580724 CCGTGCCCTTGTCCAGAGGCAGG + Intronic
1154368732 18:13737610-13737632 ACGTTTCCTTCCCAAAAGGAAGG + Intronic
1159721648 18:71898883-71898905 CTTTGTCCTTGCGATAAGGCAGG - Intergenic
1160886101 19:1349054-1349076 CCTTGCCCTTCCCAAAATGCTGG + Intergenic
1162506613 19:11089736-11089758 CGGGGTCCTTCCCAAACGGCTGG + Intronic
1165389321 19:35529354-35529376 CCCTGCCCTTGCCCAAGGGCTGG - Intergenic
1165600826 19:37054744-37054766 TCTTGTCCTTGACAACAGGCAGG + Intronic
1167055858 19:47111606-47111628 CCGTGTTTTTGCTAAAGGGCAGG - Intronic
1167334028 19:48873664-48873686 CAGTGTCCTTATCAGAAGGCTGG - Exonic
1202653080 1_KI270707v1_random:24257-24279 CCCTTTCCTTGCCAAATTGCAGG + Intergenic
928537898 2:32257970-32257992 CTCTGTCCTTGCAATAAGGCAGG - Intronic
930763666 2:55062286-55062308 CTCTGTCCTTGCAATAAGGCAGG + Intronic
931034728 2:58227307-58227329 CTTTGTCCTTGCAATAAGGCAGG - Intronic
932858892 2:75267695-75267717 CCGTGTGCTTGGGAAAAGGAGGG - Intergenic
935249144 2:101246318-101246340 CAGTGTCCTTGTACAAAGGCTGG - Intronic
937240659 2:120460280-120460302 CTGTGTCCTTGCCAAATCTCAGG - Intergenic
937648978 2:124298818-124298840 CAGTGTCCTTACAAAAAGGCTGG - Intronic
937820739 2:126307951-126307973 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
938030261 2:127986142-127986164 CTCTGTCCTTGCCATAAGGCAGG + Intronic
944313069 2:198257001-198257023 CAGTGTCCCTGCCTAAAGGTTGG - Intronic
946219736 2:218216512-218216534 GAGTGTGCGTGCCAAAAGGCAGG - Intergenic
1169229191 20:3875752-3875774 GGGTGTCCTTGGCACAAGGCAGG + Exonic
1173408138 20:42785230-42785252 CCCCGGCCTTGCCAAAAGTCTGG + Intronic
1173421645 20:42906508-42906530 CTCTGTCCTTGCAATAAGGCAGG + Intronic
1175448984 20:59046279-59046301 CAGTGTCCTTACACAAAGGCTGG - Intergenic
1175525609 20:59631410-59631432 CCCTGTCCCTGCAGAAAGGCAGG - Intronic
1176092656 20:63325869-63325891 CTGTGGCCTGGCCAGAAGGCTGG + Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177339546 21:19782286-19782308 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1177564090 21:22796075-22796097 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1179792776 21:43764958-43764980 CCGTGCCCCTGCCAAAGAGCTGG + Intergenic
1185231456 22:49686543-49686565 CAGCGTCCTTGACCAAAGGCTGG - Intergenic
951549409 3:23861922-23861944 CTCTGTCCTTGCCATAAGGCAGG + Intronic
952298760 3:32085509-32085531 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
954036766 3:47854958-47854980 CCGTGGCCTTCTCAAATGGCTGG + Intronic
954077942 3:48194937-48194959 CCCTGTCCTTCCCAAAGTGCTGG + Intergenic
954885091 3:53866143-53866165 CCTTGGCCTTGCCAAAGTGCTGG - Intergenic
958550904 3:95610367-95610389 CCGTGGCTTTGACACAAGGCTGG - Intergenic
961890436 3:130126442-130126464 CTCTGTCCTTGCAATAAGGCGGG - Intergenic
967316095 3:188153667-188153689 CAGTGGCTTTGCCAAAAGGTGGG - Intronic
968731905 4:2273107-2273129 CCGTGTCCCTGCCCACAGGGAGG - Intronic
969485980 4:7472626-7472648 CCGTGTCCTTCCCAGAAGCGCGG - Intronic
969536100 4:7756917-7756939 CCGTGTCCTTTCCACAGGACTGG + Intergenic
970234464 4:13944633-13944655 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
972575563 4:40348178-40348200 CAGTGTCCCTGGCCAAAGGCCGG - Intronic
977877176 4:102163646-102163668 CAGTGTCCTTACACAAAGGCTGG - Intergenic
982004215 4:151049116-151049138 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
982658017 4:158173124-158173146 GCGTGTCCTAGCACAAAGGCAGG + Intronic
988267249 5:28967843-28967865 CTCTGTCCTTGCGATAAGGCAGG + Intergenic
990585521 5:57207596-57207618 CTCTGTCCTTGCGATAAGGCAGG - Intronic
992776537 5:80094016-80094038 CAGTGTCCTTACACAAAGGCTGG + Intergenic
1001181174 5:169522019-169522041 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1001634275 5:173198502-173198524 CCTTGTCCTTGGCACAGGGCTGG + Intergenic
1003131243 6:3396926-3396948 CTGTGTCCTTGCAATAAGGCAGG + Intronic
1003278081 6:4669320-4669342 TCGTGTCCTTTGCAAAATGCTGG - Intergenic
1007854923 6:44845915-44845937 CTCTGTCCTTGCGATAAGGCAGG + Intronic
1011151480 6:84278437-84278459 CCATCTCCTTGCCAAAGGGAAGG + Intergenic
1013400316 6:109788812-109788834 CAGTGTCCTTGCCAGAAGCCAGG + Intronic
1015729637 6:136334877-136334899 CTCTGTCCTTGCCATAAGGCAGG + Intergenic
1018773128 6:166989639-166989661 CCCTTTCTTTGCCTAAAGGCAGG - Intergenic
1018794764 6:167177257-167177279 CCATGTCCTTGGAAAAACGCAGG - Intronic
1018821555 6:167377810-167377832 CCATGTCCTTGGAAAAACGCAGG + Intronic
1019664134 7:2242884-2242906 CTCTGTCCTTGCGATAAGGCAGG - Intronic
1031219465 7:118946053-118946075 CTTTGTCCTTGCGACAAGGCAGG + Intergenic
1032971082 7:137164495-137164517 CCGGTGCCTTGCCAAAATGCCGG - Intergenic
1033048175 7:137981028-137981050 CCGAGTCCTTGCAATAAAGCAGG + Intronic
1033812423 7:145031341-145031363 GCGTGACCTTGCATAAAGGCAGG + Intergenic
1037754627 8:21702945-21702967 CCGTGCCGTTGCCAAAGGCCTGG + Exonic
1039086292 8:33783471-33783493 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1046138352 8:110060370-110060392 CTCTGTCCTTGCAATAAGGCAGG + Intergenic
1047322548 8:123801670-123801692 CCTTCTCCTTGCCCCAAGGCTGG - Intronic
1047577267 8:126170904-126170926 CCTTTTCCTAGCCAAGAGGCAGG - Intergenic
1048801660 8:138199507-138199529 CCTGGTCCTTGCCCCAAGGCCGG - Intronic
1049332043 8:142059743-142059765 CAGGGTCCTTCCCACAAGGCTGG - Intergenic
1051103559 9:13550824-13550846 CTCTGTCCTTGCAATAAGGCAGG - Intergenic
1055054357 9:72010415-72010437 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1057868199 9:98698194-98698216 TGATGTCCTTGCCAAATGGCAGG + Intronic
1061115449 9:128607837-128607859 CGGTGTTCCTGCCAAAAGGAGGG - Exonic
1188541978 X:31260943-31260965 CCATGTCCTTACCTAAAGACTGG + Exonic
1192748475 X:73963661-73963683 CTCTGTCCTTGCCATAAGGCAGG - Intergenic
1195367274 X:104138578-104138600 CTCTGTCCTTGCAATAAGGCAGG - Intronic
1195990747 X:110679790-110679812 CTGTGTCCATGCCAAACCGCTGG + Intronic
1199142604 X:144331302-144331324 CTCTGTCCTTGCGATAAGGCAGG - Intergenic
1200282323 X:154787641-154787663 CCATGTCCTTTGAAAAAGGCAGG - Intronic
1201318168 Y:12668626-12668648 GAATGTCCTTGCCAAAAGGAAGG + Intergenic