ID: 922730740

View in Genome Browser
Species Human (GRCh38)
Location 1:227947758-227947780
Sequence GGCGGCCGGCGCGCACTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922730740_922730750 9 Left 922730740 1:227947758-227947780 CCCACCAGTGCGCGCCGGCCGCC 0: 1
1: 0
2: 0
3: 13
4: 72
Right 922730750 1:227947790-227947812 TACCCGAAGTAGGCGGCCGAAGG 0: 1
1: 0
2: 0
3: 0
4: 16
922730740_922730748 2 Left 922730740 1:227947758-227947780 CCCACCAGTGCGCGCCGGCCGCC 0: 1
1: 0
2: 0
3: 13
4: 72
Right 922730748 1:227947783-227947805 AGGCACCTACCCGAAGTAGGCGG 0: 1
1: 0
2: 0
3: 2
4: 46
922730740_922730747 -1 Left 922730740 1:227947758-227947780 CCCACCAGTGCGCGCCGGCCGCC 0: 1
1: 0
2: 0
3: 13
4: 72
Right 922730747 1:227947780-227947802 CGAAGGCACCTACCCGAAGTAGG 0: 1
1: 0
2: 0
3: 0
4: 23
922730740_922730751 10 Left 922730740 1:227947758-227947780 CCCACCAGTGCGCGCCGGCCGCC 0: 1
1: 0
2: 0
3: 13
4: 72
Right 922730751 1:227947791-227947813 ACCCGAAGTAGGCGGCCGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 17
922730740_922730754 20 Left 922730740 1:227947758-227947780 CCCACCAGTGCGCGCCGGCCGCC 0: 1
1: 0
2: 0
3: 13
4: 72
Right 922730754 1:227947801-227947823 GGCGGCCGAAGGGCGCAGCGCGG 0: 1
1: 0
2: 0
3: 18
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922730740 Original CRISPR GGCGGCCGGCGCGCACTGGT GGG (reversed) Intronic
900470926 1:2854588-2854610 GCCGGCCAGCGTGCACAGGTAGG + Intergenic
901022157 1:6260981-6261003 GGCGGCCGGCGCGCTCCGCTAGG + Intergenic
901055982 1:6448814-6448836 GGCAGCCGGCGCGCGCGGGCTGG - Exonic
901075843 1:6554313-6554335 GGCGTCCGGCGTGGACTGGAGGG - Exonic
902890354 1:19438821-19438843 CGGGGCCGGCGGGCACTGGGTGG + Intronic
903467560 1:23562547-23562569 GGTGTCCGGCGCTCATTGGTGGG - Intergenic
903659040 1:24965772-24965794 GGTGGCCTGCCCGCACTGGGGGG + Intergenic
903759250 1:25686374-25686396 GGCGGCCAGTGCGCACTGCCAGG + Intronic
903855694 1:26336590-26336612 CGCGGCCGGCACGCACCTGTAGG + Exonic
905892152 1:41524257-41524279 GGAGGTCGGCGCGCTCTGGCAGG + Intronic
918114153 1:181482802-181482824 GGCGGGCGGCGAGCACCGGCGGG - Intronic
922730740 1:227947758-227947780 GGCGGCCGGCGCGCACTGGTGGG - Intronic
1065099908 10:22321900-22321922 GGCGGCGGGCGCGCGCTCGCGGG - Intronic
1065550013 10:26860712-26860734 GGCGGCCGGCGGGCGCTGGCCGG - Intronic
1067116231 10:43437269-43437291 GGCGGCCGGCGGGCAGGGGCCGG + Intronic
1077214801 11:1390814-1390836 GGTGGCCGGCGCGCGGAGGTGGG - Intronic
1080749570 11:35139607-35139629 GGCTGCCGGCGCGCAGTTTTGGG + Intronic
1083965854 11:66043335-66043357 GGCGGCCGGCTCGCGCAGGATGG + Exonic
1085205794 11:74731288-74731310 GGCGGCCGGCGCCCCCTGCTCGG + Intronic
1095986332 12:48001990-48002012 GGCGGCGGGCGGGCACAGGGGGG + Intronic
1096791418 12:54047444-54047466 GGCGGCCGGCGCGCACCTCGCGG - Intronic
1102543355 12:113638053-113638075 GGCGGCCGGCGGGGAGTGGGGGG - Intergenic
1103562728 12:121800656-121800678 GGCGGCCGCCGCGCGCCGGGCGG - Intronic
1107604048 13:42040856-42040878 GGCGGCCGGCGGGCGCGGGCTGG + Intronic
1122894812 14:104751685-104751707 GCCGGCGGGCCGGCACTGGTGGG + Intergenic
1127488161 15:59438138-59438160 GGCGGCAGGCGCGCGCTGATTGG + Intronic
1132398119 15:101489211-101489233 GGCGGCCGGGGCGCCCTGCGGGG - Intronic
1132605756 16:793068-793090 GGCGGCCGGCAGGCACCGGGTGG + Intronic
1132828902 16:1918159-1918181 GGCGGCCGGCGGGCAGCGGCCGG + Exonic
1135470197 16:22723129-22723151 GTCGGCCGGCGGGCACTCCTGGG + Intergenic
1142749284 17:1977827-1977849 GGCGGCCCGCGGCCGCTGGTTGG - Intronic
1143016386 17:3893110-3893132 CCCGGCCGGCGCTCATTGGTCGG + Intronic
1143756967 17:9074272-9074294 CGCGGCCAGCCCGCTCTGGTTGG + Intronic
1145041370 17:19580152-19580174 AGCGGCCGCCGCGCAGGGGTGGG + Intergenic
1146256012 17:31391855-31391877 GGCGGGCGGCGCGGGCTGGTCGG + Exonic
1146750571 17:35374332-35374354 GGCGGCCGGTGCGCTGTGCTTGG + Intergenic
1149470864 17:56914110-56914132 GGCGGGCGGCGAGGACTGGGCGG + Intergenic
1151612007 17:75182572-75182594 CGCGCCCGGCGCGCACTCGGAGG + Intergenic
1152773801 17:82187573-82187595 GGGGGTCGGGGGGCACTGGTGGG + Intronic
1153219126 18:2847038-2847060 GGCGGCCGCGGAGCACTGGTTGG + Exonic
1160967993 19:1754956-1754978 GGCTGCCGGGGCGCACGGGCGGG - Intronic
1162486085 19:10961259-10961281 GGCTGCCGGCGCGCCCTGTGCGG + Intronic
1162561292 19:11419343-11419365 GGCGGGCGGCGGGCAGTGGCCGG + Intergenic
1163027093 19:14518614-14518636 CGCGGCGCGCGCGCACAGGTCGG + Intronic
1167098812 19:47391412-47391434 GGGGGCCGGCGATCACTGTTAGG + Intergenic
1168293899 19:55369711-55369733 GGCGGCCGGGGAGCGCTGATTGG - Intronic
925959835 2:9004003-9004025 CGCGGCCGGCGCTCTCTGATTGG - Intergenic
932611407 2:73202839-73202861 GGCCGCCGGCGCGCAGGGGTCGG - Exonic
1170502583 20:16989785-16989807 GGCAGCCGGGGCCCACTGGTGGG - Intergenic
1176005691 20:62861307-62861329 GGCGGCCGACGCGCCCTGCCTGG - Exonic
1178350970 21:31873132-31873154 GGCTGCCGGCGCCCTCTGGAAGG - Intergenic
1180927528 22:19566637-19566659 CCCGGCCGCCGCGCACTGGGGGG + Intergenic
1180960697 22:19761076-19761098 GGCGGCCGGCGCAAACGGGTAGG - Exonic
1183440257 22:37818913-37818935 GGCGGCCGGCGACTACCGGTAGG - Intergenic
1184265400 22:43343460-43343482 GGAGGCCGGCGCCCATTGGCCGG - Intergenic
1184680914 22:46071712-46071734 CGCGGCCGGCGCGCTCGGGCGGG + Intronic
951613882 3:24521610-24521632 GACGGCCGGCGCCCACGGCTTGG - Intergenic
960628337 3:119702999-119703021 GGCCGCCGGCGCGCAGGGATAGG - Intergenic
963133222 3:141876957-141876979 GGCGCCGGGCGCGGTCTGGTGGG + Intronic
964265371 3:154889426-154889448 GGCGGCGGGCCGGCACTGCTGGG + Intergenic
967858222 3:194134186-194134208 GGCGGGCGGCGCGCACTGCCTGG - Intergenic
968528927 4:1079915-1079937 GCTGGCCGGCCCGCCCTGGTTGG + Intronic
976398663 4:84583537-84583559 GGCGGACGCCGCGCCCTGGCTGG + Intronic
978615287 4:110587795-110587817 GGCGGGCTGGGAGCACTGGTGGG - Intergenic
981615552 4:146640018-146640040 GGCGGCCGACGTGCACGGGATGG - Exonic
985084457 4:186298509-186298531 GGGGCCCGGCGCTCTCTGGTGGG - Intergenic
985611715 5:892952-892974 GGCGGCGGCCGCGCCCTGGTTGG + Exonic
990428587 5:55712492-55712514 GGCAGCCGGCGCGCCCAGGTGGG + Exonic
999188921 5:149731935-149731957 GGTGGCGGGCGCGCTCGGGTGGG + Intronic
1002541298 5:179907941-179907963 GGCGGGCGGCGCCCCCTGGCGGG + Intergenic
1002775904 6:327343-327365 GGAGGCCGGCCCGCACTGGACGG + Intronic
1008932550 6:56955220-56955242 CGCGGACGGCGCGGACTGGCGGG - Intronic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1022363453 7:29685347-29685369 GGCGCCCGGCGCGCTCTTCTCGG + Intergenic
1022427839 7:30285178-30285200 GGCGCCCGGCGCGCTCTTCTTGG - Exonic
1022427901 7:30285365-30285387 GGCGGCCGGGCCGCTCTGTTTGG - Exonic
1022697923 7:32728391-32728413 GGCGCCCGGCGCGCTCTTCTCGG - Intergenic
1030176667 7:106661082-106661104 GGCGGCCGGCGCCCACCCCTGGG + Intergenic
1032437131 7:131909502-131909524 GCCGGCCGGCCGGCACTGCTGGG - Intergenic
1034218015 7:149422571-149422593 GGCCGCCGGCGCGCCCTGCCGGG + Intergenic
1041369285 8:57142600-57142622 TGCGGCCGGCGCTCTCTGATTGG + Intergenic
1041712894 8:60909886-60909908 GGCTGCGGGCGGGCACTGGCGGG - Intergenic
1042956761 8:74259449-74259471 AGCGGCCAGCGCGGCCTGGTCGG + Exonic
1052982092 9:34457492-34457514 AGCTGCCTGTGCGCACTGGTTGG - Intronic
1053269366 9:36739715-36739737 GGCGGCCGCCGCGCGCTGTCAGG - Intergenic
1196775207 X:119332048-119332070 GCCGGTCGGCTGGCACTGGTGGG - Intergenic