ID: 922731168

View in Genome Browser
Species Human (GRCh38)
Location 1:227949383-227949405
Sequence CCAGGCTTTCCCAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 333}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922731168_922731179 24 Left 922731168 1:227949383-227949405 CCTGCTTCCCTGGGAAAGCCTGG 0: 1
1: 0
2: 1
3: 42
4: 333
Right 922731179 1:227949430-227949452 TACCCTTTCTGAGTGTCTGATGG 0: 1
1: 0
2: 1
3: 15
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922731168 Original CRISPR CCAGGCTTTCCCAGGGAAGC AGG (reversed) Intergenic
900115982 1:1028107-1028129 ACGGGGCTTCCCAGGGAAGCCGG + Intronic
900124570 1:1063791-1063813 CCAGGGTGACTCAGGGAAGCCGG + Intergenic
900179322 1:1304388-1304410 CCAGCCTCTCCCAGGACAGCCGG + Intronic
900513284 1:3070140-3070162 CCCGGCTGTGCCAGGCAAGCGGG - Intronic
901872476 1:12146050-12146072 CCTGGCTGACCCAGGGGAGCAGG + Intergenic
902338633 1:15768270-15768292 CCAGGCTTCCCCATGGATGCTGG - Intronic
902685902 1:18077511-18077533 CCTGCCTTTCCCACTGAAGCAGG - Intergenic
903127458 1:21257652-21257674 CCAGCCATTCCCAGGGCAGGAGG - Intronic
903368927 1:22822542-22822564 CCAGACATTCCCAAGGAAGAAGG - Intronic
904195244 1:28780695-28780717 CCAGGCTTTCCCCTGGATGTTGG + Intergenic
904210505 1:28884048-28884070 CCAGGCCTTCTCAGAGGAGCGGG + Intergenic
904674974 1:32193469-32193491 CCAGGTTGTCCCAGGGAATGGGG + Intronic
906730595 1:48077682-48077704 CCAGGCATGCCCAGGGAATTGGG - Intergenic
906757320 1:48330680-48330702 TCAGGCTTTTTCAGGGCAGCAGG - Intronic
907329936 1:53664128-53664150 CCAGGCTTTCCCCTGGAAGTGGG - Intronic
909653073 1:77997549-77997571 GAAGGCTTGCCCTGGGAAGCTGG - Intronic
909680569 1:78287022-78287044 CCTAGCTTTACCAGGGAACCAGG + Intergenic
912948648 1:114105498-114105520 CCAGGCCCTTCCTGGGAAGCTGG - Intronic
912981600 1:114379007-114379029 ACACGCTTTCCCAGGGACTCTGG + Intergenic
913565753 1:120070316-120070338 GAAGGCTTTCCCAGAGGAGCTGG + Intergenic
913632376 1:120723238-120723260 GAAGGCTTTCCCAGAGGAGCTGG - Intergenic
914286345 1:146229690-146229712 GAAGGCTTTCCCAGAGGAGCTGG + Intergenic
914490292 1:148147149-148147171 CCAGGGGTTCCCAGGGAGCCTGG - Intronic
914547377 1:148680432-148680454 GAAGGCTTTCCCAGAGGAGCTGG + Intergenic
914619138 1:149389928-149389950 GAAGGCTTTCCCAGAGGAGCTGG - Intergenic
914901559 1:151713932-151713954 CCAGGTATGCCCAGGGAGGCAGG - Intronic
915624943 1:157108770-157108792 AAAGGCTTTTCCAGGGAAGCTGG + Intergenic
918477071 1:184936336-184936358 GCAAGCTTTCCAAGGGAAGTGGG + Intronic
920930645 1:210384610-210384632 GCAGGCTTCTCCATGGAAGCAGG - Intronic
921390248 1:214608064-214608086 CCAGGGGTTCCCAGGGAGCCTGG + Intronic
922603040 1:226871145-226871167 GCATGCTTTCCCCGGGAAGGAGG + Intronic
922731168 1:227949383-227949405 CCAGGCTTTCCCAGGGAAGCAGG - Intergenic
923046317 1:230358198-230358220 CCACGCTTTCCCTGGGAATGGGG + Intronic
924414959 1:243849778-243849800 CCCAGCTTTCCCCGGAAAGCGGG + Intronic
924593782 1:245427836-245427858 CCAGGACTTCCCATGGAAGCAGG + Intronic
1063623620 10:7669428-7669450 CCAGGCTGTGCCAGGGAGGTGGG + Intergenic
1065634582 10:27717649-27717671 CCAGGCTTTCCCTGGGAATAGGG - Intronic
1065779089 10:29150277-29150299 ACAGGCCTTCCCAGCCAAGCAGG + Intergenic
1068555895 10:58458551-58458573 ACAGGCTGTGCCAGAGAAGCAGG + Intergenic
1069740358 10:70683311-70683333 CCAGTATTTCCCAGGAAACCGGG - Intronic
1071463044 10:85916533-85916555 GCAGGCATTCCTAGGGAAGGGGG - Intronic
1073435062 10:103511244-103511266 CCAGTCTGTCCCAGGGACACAGG + Intronic
1073450916 10:103608281-103608303 CCACGCCTTCCCAGGGAACGAGG + Intronic
1073456331 10:103638835-103638857 CCAGGGATGGCCAGGGAAGCAGG + Intronic
1074541354 10:114367702-114367724 CCAAGCTTTCCCGGGCAAGGAGG + Intronic
1075170308 10:120107123-120107145 CCAGTACTTCCCAGGGAAGTGGG + Intergenic
1075787600 10:125060781-125060803 GCAGGCTTCCCCAGAGAGGCCGG + Intronic
1075948082 10:126454973-126454995 CCAGGCATGCCAAGGGAAGGTGG - Intronic
1076117070 10:127907820-127907842 CCGCGCCTTCCCAGGGAGGCAGG + Intronic
1076582885 10:131525200-131525222 ACAGACTTTCCCAGGAAAGGTGG + Intergenic
1076600559 10:131654538-131654560 CCAGCCTCTCAGAGGGAAGCAGG - Intergenic
1076771643 10:132669337-132669359 CCAGGCCTTCCCTGTGAGGCGGG + Intronic
1077218976 11:1407040-1407062 CTAGGGTTTCCCAGGGAAGGGGG + Intronic
1077474220 11:2778816-2778838 CCAGGCGTTGCCAGGGAAACCGG - Intronic
1078473596 11:11611572-11611594 CCAGGCTTGCCCAGGGAATTGGG + Intronic
1081869487 11:46376868-46376890 CCAGACTTTACCAGGTGAGCTGG - Intronic
1083263636 11:61536208-61536230 CCCGCCTTTCCCAGGAAGGCAGG + Intronic
1083418398 11:62539828-62539850 CCAGGCTGTGCCAGGACAGCAGG - Intronic
1083441185 11:62677702-62677724 CCATGCTTTCCCTCTGAAGCTGG + Intronic
1084656650 11:70523575-70523597 CCCGGCTTTCCCACCTAAGCAGG + Intronic
1089046532 11:115505385-115505407 CCAGCCCTTCCTAAGGAAGCTGG + Intergenic
1090401118 11:126448972-126448994 GCAGGCTTCCCCAGGCGAGCAGG - Intronic
1090877236 11:130801664-130801686 CCAGCCTTTCAAAGGGAAGCTGG - Intergenic
1091851003 12:3696891-3696913 CCAGGCTGTCCAGGGGATGCAGG + Exonic
1091878985 12:3960961-3960983 TCAGGCTTTTCAGGGGAAGCGGG + Intergenic
1091969356 12:4772790-4772812 CACGACCTTCCCAGGGAAGCTGG - Intronic
1092008188 12:5087271-5087293 CCAGACATTGACAGGGAAGCCGG - Intergenic
1093761358 12:22915032-22915054 CCAGGCTTTTCTGGAGAAGCTGG + Intergenic
1094010031 12:25798137-25798159 ACAGGCTGTCACTGGGAAGCCGG + Intergenic
1095956919 12:47812181-47812203 CCAGCCTCTCCCAGTGAGGCAGG - Intronic
1095985286 12:47995262-47995284 CCAGGCTTTCCAGGGGGACCAGG + Exonic
1096586830 12:52628322-52628344 CCTGGCTTTCTCAGGGAATGGGG + Intergenic
1096910569 12:54979813-54979835 CTCTGTTTTCCCAGGGAAGCAGG + Intronic
1101310199 12:103571486-103571508 CCACCCCTTCCCAGGCAAGCGGG + Intergenic
1101490379 12:105204444-105204466 ACATGCTTTCCCAGGGTATCTGG - Intronic
1101728307 12:107405946-107405968 ACAGGCTTTCCAAGGTAATCTGG - Intronic
1101823294 12:108200851-108200873 CTAGGCTTCCCCAGGGCAGAAGG - Intronic
1102055130 12:109890864-109890886 CCAGGCTTTGCCAGGCAATGTGG + Intergenic
1102270593 12:111531487-111531509 ACAGGCTTCCCCAGGGAAGTGGG + Intronic
1103715128 12:122940713-122940735 CCAGGCTGTGGCAGGGCAGCTGG - Intronic
1103946645 12:124531056-124531078 CCCGCCTCTCCCAGGGAAGCAGG + Intronic
1106081021 13:26500529-26500551 TCAGGCCTTGCCAGGGAAGGAGG + Intergenic
1110133162 13:72032377-72032399 CCAGATTTTCCAAGGGAATCTGG - Intergenic
1112157374 13:96832630-96832652 CCAGTCATCCCCAGGGTAGCAGG - Exonic
1112389440 13:98969682-98969704 CAAGGGTTTCCCAAAGAAGCTGG + Intronic
1112457526 13:99575789-99575811 CCAGGATTGCCCAGGAAAACAGG - Intergenic
1112596264 13:100810046-100810068 CCACCTTCTCCCAGGGAAGCTGG - Intergenic
1113554720 13:111223538-111223560 CTACACTTCCCCAGGGAAGCAGG - Intronic
1113767292 13:112889289-112889311 CCAGGCTCTGACAGGGAGGCTGG + Intergenic
1114278617 14:21169847-21169869 CCAGGGGTTCCCAGGGAAGAGGG - Intergenic
1114619423 14:24086275-24086297 ACATGCCTCCCCAGGGAAGCTGG - Intronic
1114896916 14:27002222-27002244 CCAGGAGTTCCTAGGGAAGGAGG + Intergenic
1115190587 14:30743718-30743740 ACAGGCTGTCCCCAGGAAGCAGG + Intergenic
1116203738 14:41834022-41834044 CCTTGCTTTCCCTGGAAAGCAGG - Intronic
1116904791 14:50394199-50394221 TCAGGCTTTCCCAGGGGAGGAGG - Intronic
1118316918 14:64731215-64731237 CCAGGCTTCCGCTGGGAAGAGGG + Intronic
1118768811 14:68928256-68928278 CCTGGCTTTTCCAGGAAAGGGGG - Intronic
1118897057 14:69953874-69953896 CCAGGGTTGCCCATGGAAACTGG - Intronic
1119807758 14:77493411-77493433 ACAGGCCTGCCCAGAGAAGCAGG + Intronic
1119892233 14:78191600-78191622 CCAGGCTTTCCCAGTCTATCTGG - Intergenic
1120959821 14:90114522-90114544 CCGGGCTTTCCCAGGAACGAAGG - Intronic
1121484867 14:94306706-94306728 ACAGGCTCTCCCAGGGCAGGTGG + Intronic
1122010348 14:98741362-98741384 CCAGACATTCCAAGGCAAGCAGG + Intergenic
1122577666 14:102752199-102752221 TCAGGCTCTCGCAGGGAAGGGGG - Intergenic
1122632659 14:103114071-103114093 CCAGCCTTCCACAGGGAAGGGGG - Intergenic
1124024265 15:25950114-25950136 CCTGCCTGTCCCAGGAAAGCAGG - Intergenic
1124322317 15:28724277-28724299 CCTGCCTGTCCCAGGAAAGCAGG + Intronic
1124523408 15:30426082-30426104 CCTGCCTGTCCCAGGAAAGCAGG + Intergenic
1124535258 15:30540132-30540154 CCTGCCTGTCCCAGGAAAGCAGG - Intergenic
1124763396 15:32467464-32467486 CCTGCCTGTCCCAGGAAAGCAGG + Intergenic
1124775230 15:32581583-32581605 CCTGCCTGTCCCAGGAAAGCAGG - Intergenic
1125573182 15:40736712-40736734 CCAGGCTATCCTGGGGAAGTAGG - Intronic
1126061408 15:44786102-44786124 CCAAGCTTTCACAGGGGAACTGG + Intergenic
1128219440 15:65957799-65957821 CCTGGCTTGCCTAGGGTAGCAGG + Intronic
1128767855 15:70261982-70262004 GGAAGCTTTCCCAGGGAAGGTGG - Intergenic
1129119870 15:73389722-73389744 CCAGGCACTCCCAGGCAAGTAGG - Intergenic
1129138339 15:73574320-73574342 CAAGGCTCTCCCAGGAAAGAGGG + Intronic
1129333642 15:74840060-74840082 CCAGGCTGTCCCAGGGCCTCAGG - Intronic
1130154934 15:81342123-81342145 CCAGATCATCCCAGGGAAGCTGG + Intronic
1130514026 15:84612107-84612129 CCAGCCTTTCTCAGGGAGCCTGG + Intronic
1132289413 15:100688956-100688978 CCAGACTCTCCCAGGGCAGGTGG + Intergenic
1132553853 16:564301-564323 GGAGGCTGTCCCTGGGAAGCAGG + Exonic
1132574305 16:657578-657600 CCAGGCGCTGCCAGGGGAGCTGG - Intronic
1132639275 16:970438-970460 CCAGGAGTTCCCAGGAGAGCTGG - Intronic
1132783933 16:1643999-1644021 CCAGTCTTTTCCAGACAAGCTGG - Intronic
1133056321 16:3147254-3147276 CCAGGCTTTCCAGGAGGAGCTGG + Exonic
1133739424 16:8640370-8640392 CCAGTCTCTCCTAGGGGAGCTGG + Intronic
1134064512 16:11219125-11219147 CTAGACTTTGCCAGGGATGCTGG + Intergenic
1134669001 16:16040808-16040830 CCAGGCTGTCCTGGGGAAGGTGG + Intronic
1134857250 16:17530553-17530575 CCAGCCTTCACCATGGAAGCTGG + Intergenic
1134879213 16:17729667-17729689 CCAAGGTGGCCCAGGGAAGCAGG + Intergenic
1135189074 16:20340027-20340049 AAAGGCTTGCCCAGGGCAGCAGG - Intronic
1136063611 16:27743854-27743876 CCTGGCTTTCCCGGGGCAGGTGG - Intronic
1136550074 16:30978399-30978421 GCAGGCTTTCCCAGGGATGGCGG + Intronic
1137682685 16:50364405-50364427 CCAGGCTAGACCAGGGAAGCAGG - Intronic
1137764473 16:50967428-50967450 GCGGGCTTTCCCAGAGCAGCCGG - Intergenic
1139030654 16:62876705-62876727 TCAGGCTCTTCAAGGGAAGCTGG + Intergenic
1139395829 16:66638127-66638149 CCACCCTCTCCCAGGAAAGCTGG + Intronic
1141644795 16:85361644-85361666 CGAGGCATTTCCAGGGAAGTGGG - Intergenic
1141843446 16:86590176-86590198 CCTGGATTTCTCAGGGAGGCAGG + Intergenic
1142523785 17:523393-523415 GAAGGCTTTCCCAAAGAAGCAGG - Intronic
1143120883 17:4606051-4606073 CCAGTATTTCCCAGGGCAGGAGG + Intronic
1144949383 17:18985759-18985781 CCTCGCTTCCCCAGGGAAGGTGG - Intronic
1145116022 17:20211362-20211384 CATGGCTTGCCCAGGGGAGCTGG - Intronic
1145190884 17:20841752-20841774 CCAGGGGTTCCCAGGGAGCCTGG - Intronic
1147166395 17:38595916-38595938 CCAGCCTTTGCCAGGGGAGGGGG - Intronic
1148177815 17:45583077-45583099 CCAGACTTGCCCTGGGAGGCTGG - Intergenic
1148198636 17:45733120-45733142 CCAGGCTCTCCCAGGGCTCCAGG - Intergenic
1148783529 17:50134499-50134521 CCAGGCTTGACCAGGAAACCTGG + Exonic
1151367985 17:73629555-73629577 CCAGCATTTCCTAGGGAAGACGG + Intronic
1152192943 17:78899541-78899563 CCAGGCTTTGGCAGGGCAGCTGG - Intronic
1153143172 18:1998287-1998309 CCAGGCTTTTCCCGGGAAAGAGG - Intergenic
1153496262 18:5703109-5703131 TCAAGCTTTCCCAGGGTTGCTGG + Intergenic
1153658743 18:7307863-7307885 CCACGCTGTCCCAGGGACACTGG + Intergenic
1154031726 18:10759015-10759037 CAAGGCCTTCCCATGGCAGCTGG - Intronic
1155672504 18:28388628-28388650 CCAGGCATTTCCAGGGCAACAGG - Intergenic
1156544143 18:37947000-37947022 CCAGGATTTGGCAGTGAAGCAGG + Intergenic
1156683353 18:39617195-39617217 CCAAGGTTTCACAGAGAAGCAGG + Intergenic
1159780264 18:72652829-72652851 CCCAGCTTTCCCAGGGAGACAGG + Intergenic
1159955991 18:74518963-74518985 CCAGACTTGACCAGGGAAGGCGG + Exonic
1160805463 19:990563-990585 CCAGGCTTGGCCAGGGAGCCGGG - Intronic
1160857263 19:1223214-1223236 CCAGGATGTCCCACGGGAGCAGG + Intronic
1160995320 19:1879671-1879693 CCAGGGGTTCCCAGGGAACCTGG + Intronic
1161280889 19:3445301-3445323 CCGGGCTTTTCCAGGGCAGGAGG - Intronic
1161374730 19:3933568-3933590 CCAGGTTTTCTCAATGAAGCCGG + Exonic
1164589285 19:29497457-29497479 GCTGACTTTCCCAGGGGAGCAGG + Intergenic
1165068138 19:33240800-33240822 CCAGGCTTGCGCGGGGAAGCTGG - Intergenic
1165325340 19:35111381-35111403 CCAGACTTTTCCAGAGATGCTGG + Intergenic
1165406900 19:35636639-35636661 GCAGGCCTTGCCAAGGAAGCAGG + Intronic
1165735583 19:38173576-38173598 CCGGGCGTTCCCAGGCAGGCAGG + Intronic
1166369005 19:42291205-42291227 CCAGCCTTGCCCAGGGCACCTGG - Exonic
1166749829 19:45159467-45159489 CCTGGCTGGCCCAGGGAGGCCGG + Intronic
1167433469 19:49465891-49465913 CCAGGCTTTCCCTGGGTAAGGGG + Exonic
1167525132 19:49978951-49978973 CCAGTGTCTCCCTGGGAAGCTGG + Intronic
926062608 2:9813669-9813691 CCAGGGGTTCCCAGGGAGCCTGG - Intergenic
927075240 2:19570975-19570997 GAAGAGTTTCCCAGGGAAGCAGG + Intergenic
927884622 2:26710744-26710766 CCAGGCCCTCCCAGAGAAGCTGG - Intronic
928170885 2:29002432-29002454 CCAGTCCTTCCCAGGGCAGAAGG + Intronic
928197951 2:29228552-29228574 CCAGGCCATCCAAGGGAGGCTGG + Intronic
930221812 2:48753639-48753661 TCAGCCTTTTCCAGGGAAGGGGG + Intronic
930386833 2:50707584-50707606 CCAGGCTTCATCAGGGCAGCAGG - Intronic
930952193 2:57156301-57156323 CTGGGCTTGCCCAGGGCAGCGGG + Intergenic
931280491 2:60787031-60787053 CCAGTCATTCCCAGGGAATAAGG + Exonic
931390744 2:61841472-61841494 CCAAGCTTTCAGAGGGATGCAGG - Intronic
932165216 2:69499143-69499165 CCAGGCCTGCCCTGGGAAGTGGG + Intronic
933687935 2:85158029-85158051 GCAGGCATTTCCAGGGAAGGAGG + Intronic
935648701 2:105363705-105363727 TCAGCCCTTCCCAGGGATGCTGG + Intronic
936472173 2:112808941-112808963 AGAGCCTTTCCCAGGGAATCAGG - Intergenic
937133999 2:119536583-119536605 ACTGGCTTTCTCAGGAAAGCAGG + Intergenic
937142119 2:119610978-119611000 CCAGGCGTCATCAGGGAAGCAGG + Intronic
937150131 2:119680784-119680806 GCAGGCTGACCCAGGGAAACTGG + Intronic
937362500 2:121238814-121238836 CAAGGAGTCCCCAGGGAAGCGGG - Intronic
937890668 2:126936206-126936228 CCAGACTTTCCAGAGGAAGCAGG + Intergenic
940249022 2:151653185-151653207 CCAGGATTTCATAGGGAAGTAGG - Intronic
941289488 2:163657969-163657991 CCAGGGTTTTCCAGAGAGGCAGG + Intronic
941729122 2:168896413-168896435 CCACTCTTTCCCATGGATGCAGG - Intronic
942063390 2:172248310-172248332 CCACCCTTTCCCTGGGCAGCTGG + Intergenic
943358341 2:186887264-186887286 CCAGGGTGTCTCAGGCAAGCTGG + Intergenic
944620012 2:201504777-201504799 CCAGGTTTTCCCTGGGATGCTGG + Intronic
945922707 2:215772057-215772079 CCAGCATTTCCCAGGGGGGCAGG + Intergenic
946102637 2:217339585-217339607 CCTGGCTTTGCCCTGGAAGCGGG + Intronic
946329779 2:219002556-219002578 CCAGGCCTGGCCAGCGAAGCAGG - Intergenic
946772649 2:223104814-223104836 CCAGGCTAACCCAGGGATTCTGG - Intronic
946936263 2:224724047-224724069 CAAGGCTTTCCAAAAGAAGCTGG + Intergenic
948467645 2:238159861-238159883 CAGGGCTGCCCCAGGGAAGCCGG + Intronic
948482083 2:238256577-238256599 CCAGGCCTGCCCAGGGAAGAGGG + Intronic
948651155 2:239444777-239444799 CCACGCTTTGACAGCGAAGCTGG + Intergenic
948750990 2:240132984-240133006 GCAGGCTTTCCCAGGGTGCCTGG - Intronic
948903166 2:240966238-240966260 CCAGGCTCTCCCTGGGCAACAGG + Intronic
948954166 2:241273734-241273756 CCAGCCTTACCCAGGGAATGGGG + Intronic
949061967 2:241966110-241966132 ACAGGCATTCCCTGGGAGGCTGG - Intergenic
1169264595 20:4160232-4160254 CCAGGCTTTGGCAGTGAAGCTGG + Intronic
1171473435 20:25390209-25390231 CGACCCTTTCCCGGGGAAGCCGG - Intronic
1172180915 20:33002901-33002923 CCAGGATTGCCCAGCGAGGCCGG - Exonic
1172614818 20:36276012-36276034 CCGGGATTTCCCTGGGAACCGGG + Intergenic
1173002373 20:39113707-39113729 CCAGGCTGTCACAGGGATCCAGG - Intergenic
1173250899 20:41363765-41363787 GCAGCGTTTCCCAGTGAAGCCGG + Exonic
1173306826 20:41858482-41858504 CTGGGGTGTCCCAGGGAAGCAGG + Intergenic
1174918079 20:54674198-54674220 CCAAAGTTTCCCAGGGGAGCAGG + Intergenic
1175677591 20:60960135-60960157 TGTGGTTTTCCCAGGGAAGCTGG - Intergenic
1175910849 20:62404856-62404878 CCATCCTGTCCCAGGGATGCCGG + Intronic
1176199760 20:63854994-63855016 CCAGGCCGTCCCTGGGGAGCTGG - Intergenic
1179571169 21:42279679-42279701 CCAGCCTTTTCCGGGGTAGCTGG + Intronic
1181112057 22:20607952-20607974 CCAGGGTCTCCCAGGGAAGATGG + Intergenic
1181121395 22:20670211-20670233 CCAGGGGTTCCCAGGGAGCCTGG + Intergenic
1181185355 22:21099467-21099489 CCTGGATCTCCCTGGGAAGCTGG - Intergenic
1182619575 22:31611510-31611532 CCAGTGTCTCCCAGGGAAGACGG + Intronic
1183074031 22:35415462-35415484 GCAGGCTTTCCCTGGGAGTCAGG + Intronic
1183177975 22:36238181-36238203 CCAGGCTGTGCCAGGGAGGGCGG - Intronic
1183367998 22:37417375-37417397 CCAGGCCTTCCCCTGGAAGCTGG + Intronic
1183418707 22:37697612-37697634 CCTGGCTGTCCCAGGGGAGGAGG + Exonic
1183421391 22:37713595-37713617 ACAGGCTGGCCCAGGGCAGCTGG + Intronic
1183743035 22:39678822-39678844 CCTGACTGTCCCGGGGAAGCAGG + Intronic
1184341754 22:43890013-43890035 CCAAGCTCTCCAAGGGAAGCAGG + Intronic
1184632419 22:45793637-45793659 CCAGCCTTTGCCAAGGATGCAGG + Intronic
1185040391 22:48501034-48501056 CCAGGCCTTCCCAGGGCTTCTGG + Intronic
1185222605 22:49636503-49636525 CCATGCTTTCCCGAGGAAGGAGG - Intronic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
949954451 3:9256110-9256132 CCATCCTTTCCTAAGGAAGCGGG - Intronic
950472656 3:13196162-13196184 CCAGGCTTCCCCACGTAAACTGG - Intergenic
950478394 3:13228398-13228420 CCACTCTTTCCCAGGTTAGCTGG + Intergenic
950657378 3:14444984-14445006 CCAGGCCTGCCCAGGGCAGGAGG - Intronic
953184381 3:40624694-40624716 CCAGGCATTCCTAGGAAAACCGG + Intergenic
953350985 3:42215991-42216013 CCAGCACTTCCCAGGGATGCGGG + Intronic
954395892 3:50293107-50293129 TCAGGGATTCCAAGGGAAGCGGG + Exonic
954640189 3:52093212-52093234 CCAGGCCTCCCCAGAGGAGCTGG - Intronic
954699863 3:52445539-52445561 CCACCCTTACCCAGGGGAGCTGG - Intergenic
955397306 3:58566420-58566442 CCTGGCTCTCCCTGGGAGGCTGG - Exonic
956356044 3:68393425-68393447 CCAGACTTTCAAAGAGAAGCTGG + Intronic
961040004 3:123671563-123671585 CCATGCTGTCCCATGGAACCTGG - Intronic
961447725 3:126988675-126988697 GCAGGCTTGCCCAGGGCAGGCGG + Exonic
961674113 3:128554812-128554834 CCCGGCGTCCCCAGTGAAGCAGG + Intergenic
961786308 3:129349255-129349277 CCACTCTTTCCCAGGTTAGCTGG - Intergenic
962253878 3:133857363-133857385 CCAGGGTCTCCCAGCGAAGTGGG + Intronic
962407278 3:135110955-135110977 CCTGATCTTCCCAGGGAAGCAGG + Intronic
962865464 3:139444907-139444929 CCTGGCTTGCCCAGGCCAGCGGG + Intergenic
962909098 3:139831593-139831615 CCAGGCTTTCACAGAGAAAGTGG + Intergenic
964510281 3:157442612-157442634 CCATGGTTTCCCTGGGAAGGTGG + Exonic
966403906 3:179575364-179575386 TCAGGATGTCCCAGGGAAGATGG - Intronic
968047133 3:195630823-195630845 GTCGGATTTCCCAGGGAAGCTGG + Intergenic
968128518 3:196177781-196177803 CCACGCCTTCCCAGGGAACGTGG + Intergenic
968265954 3:197363593-197363615 CCAGGGCTCCCCAGAGAAGCAGG + Intergenic
968307514 3:197659221-197659243 GTCGGATTTCCCAGGGAAGCTGG - Intergenic
968496945 4:923750-923772 CCAGGCTGCCTCAGGGAACCTGG - Intronic
968613430 4:1567200-1567222 CCAGACCCTCCCAGGGCAGCTGG + Intergenic
968923164 4:3532944-3532966 CCAGGTTGTCCCGGGGACGCAGG + Intergenic
968970361 4:3790482-3790504 ACAGGCTTTCCCAGGTCAGGTGG - Intergenic
969441250 4:7218008-7218030 CCGGGCTTCCCCAGGTATGCTGG + Intronic
970790736 4:19854754-19854776 CCAAGGTTTCACAGGGAAGTGGG + Intergenic
972567963 4:40285841-40285863 CCATTCTTTCCAAGGGCAGCCGG - Intergenic
973264527 4:48198182-48198204 CCATGCTTTCCCAGGGATCCTGG + Intronic
974608614 4:64185347-64185369 GCATGCTTTCCCATGGCAGCAGG + Intergenic
975516652 4:75255155-75255177 AAAGTCTTTCCCAGTGAAGCGGG + Intergenic
976530606 4:86148292-86148314 CCAGGGATTCCCAGGGAAAATGG + Intronic
977002247 4:91518900-91518922 TTAGGCTTTCCCAGGGAAGATGG + Intronic
979449433 4:120852958-120852980 TCAGGGTTTCCCAGAGAAACAGG - Intronic
980404717 4:132342149-132342171 CCAGGTTTCCCCATGCAAGCGGG + Intergenic
981412535 4:144449836-144449858 TCAGGCTTTCCCTGGGATTCAGG - Intergenic
983900518 4:173128599-173128621 TAAGGCTTCCCCAGGGAAGCTGG - Intergenic
984197456 4:176676250-176676272 CCAGGCTCTACCAGGGAAAGTGG + Intergenic
985672007 5:1211443-1211465 CCAGACTTGCACAGGGAAGAGGG + Intronic
985717520 5:1470981-1471003 CCAGGGTTTCCCATGGGTGCTGG + Intronic
986740571 5:10701732-10701754 CCAGACCGTCCCAGGGAATCAGG - Intronic
988689524 5:33558561-33558583 CCAGGCTTTCCTTAGGAGGCCGG + Intronic
990500063 5:56387344-56387366 CCAGGCTTTGACATGGAAGGGGG - Intergenic
992773576 5:80070754-80070776 ACAGGCCCTCCCAGCGAAGCAGG - Intronic
992937049 5:81718605-81718627 CAGAGCTTTCCCAGTGAAGCTGG - Intronic
993608908 5:90031157-90031179 CCAGGATTTCCCGGGCAAGATGG + Intergenic
994541259 5:101101388-101101410 CCAGGCTGTTCCAGGGAAAGGGG - Intergenic
994627055 5:102232947-102232969 CCAGGCTTTGCCAGCAGAGCAGG - Intergenic
995180080 5:109222866-109222888 CCAGGCATTCCTAGGGAACCTGG - Intergenic
996508076 5:124289713-124289735 CTGGACTTTCCCAGGAAAGCAGG - Intergenic
998227544 5:140338665-140338687 CCTGGCTTCCCCAGAGAAGGAGG + Intronic
998874865 5:146588977-146588999 CCAGCCTTTCTCAGGGACTCAGG + Intronic
999429919 5:151517290-151517312 CCAGTGTTTCCCAGGGATGGGGG - Intronic
1000035483 5:157444527-157444549 TCAGGATTCCCCAGGGAAGGTGG + Intronic
1000813124 5:165887380-165887402 CTAGGGTTTCCCAGAGAAGGAGG + Intergenic
1001528456 5:172445723-172445745 TCAGGCTTTCCCAGGGCTGAGGG - Intronic
1001585516 5:172831539-172831561 GCAGGCCTTCCCACGGAGGCAGG - Intergenic
1001905422 5:175468360-175468382 CCATGCTCTGTCAGGGAAGCAGG + Intergenic
1002305881 5:178282574-178282596 CCAGGCTTTGGCATGCAAGCAGG + Intronic
1003366673 6:5481725-5481747 CCAGCCTTTCCCTGGGAATTTGG + Intronic
1005562366 6:27053921-27053943 CAGGGAATTCCCAGGGAAGCAGG - Intergenic
1006445306 6:34076651-34076673 CCAGCCTCACCCAGGGCAGCAGG + Intronic
1007748742 6:44059012-44059034 CCAGCCCTCCCCAGGGAGGCGGG - Intergenic
1008064527 6:47033193-47033215 CCAAGCCTTCCCACGGAAGCTGG - Intronic
1009354729 6:62728126-62728148 CCAGCCTATCCCAGCTAAGCAGG + Intergenic
1009425274 6:63506935-63506957 CCCTGCAATCCCAGGGAAGCAGG + Intergenic
1010536182 6:77034074-77034096 CCAGACTTCCTCAGGGAAGTGGG + Intergenic
1011195141 6:84773426-84773448 CCAGGTCTTTCCAGGGAAGGGGG - Intergenic
1012291047 6:97456193-97456215 CCAGACTTTTCAAGAGAAGCTGG - Intergenic
1013069506 6:106715937-106715959 CCAGGGTTTCCCAGTGCAGTGGG - Intergenic
1014216289 6:118755570-118755592 CCAGGCTGACACAGGGAAACAGG + Intergenic
1015429514 6:133113970-133113992 CCAACTTTTCCCTGGGAAGCTGG - Intergenic
1016629007 6:146205911-146205933 GCAGGCTCTCCCAGGGAGGCGGG + Intronic
1016742546 6:147543035-147543057 CCAGGCCTGCCCAGGGGAGCTGG - Intronic
1018793546 6:167168918-167168940 CCAGGGTTTCCCAGGGATGGCGG + Intronic
1018823169 6:167389460-167389482 CCAGGGTTTCCCAGGGATGGCGG - Intergenic
1019135925 6:169907695-169907717 CCAGGCTGGGCCAGGGCAGCAGG + Intergenic
1019560407 7:1653275-1653297 CAAGGCTTGCTCAGGGATGCTGG + Intergenic
1019648007 7:2141325-2141347 CCAGGCTTTCCCCTGGAGCCAGG + Intronic
1020051747 7:5086405-5086427 TCAGGCTCTCCCAGGGATGTCGG + Intergenic
1021740499 7:23680967-23680989 CCAGGCTCCGCCAGGGAGGCCGG + Intronic
1022514554 7:30967010-30967032 CCAGGCTTTCACAGGAGAGGAGG - Intronic
1024673870 7:51620849-51620871 CCAGCCCTTTCCAAGGAAGCTGG - Intergenic
1024760542 7:52591510-52591532 CCTGGCTTTCCCAGGGAGACTGG + Intergenic
1029439217 7:100578013-100578035 CCAGCCCTTCCCTGGGATGCTGG + Intronic
1029645821 7:101855211-101855233 CCAGGGTTTCACTGGGAGGCAGG - Intronic
1033131610 7:138750185-138750207 CCACGCTTCCCCATGGAAACTGG + Intronic
1034490742 7:151391925-151391947 CCAGGCCTTCCTAGTGAAGCAGG + Intronic
1035826032 8:2645072-2645094 GCCCTCTTTCCCAGGGAAGCTGG - Intergenic
1036606482 8:10309841-10309863 CCAGGTGGTCCCAGGGAATCGGG + Intronic
1037994197 8:23340877-23340899 CCAGGCATGGCCAGGCAAGCTGG - Intronic
1038347711 8:26747553-26747575 CAGGGCTTGCCCAGGGAAGGTGG + Intergenic
1038396081 8:27246605-27246627 TAAGGCTTTCTCAGGCAAGCAGG - Intronic
1038688214 8:29737951-29737973 CCTGGCCTTCTCAGAGAAGCCGG + Intergenic
1039226819 8:35397271-35397293 CTAGGCTTTCATAAGGAAGCAGG + Intronic
1040292652 8:46133325-46133347 CCAGGGGTTCCCAGGCAGGCTGG - Intergenic
1040578438 8:48674930-48674952 CCAGGCTCTGCCTGGGAACCAGG + Intergenic
1041661427 8:60405193-60405215 CCAAGCTTTCCCAGGCAAACGGG - Intergenic
1042213608 8:66406382-66406404 CCAGGCTTGGGCAGAGAAGCTGG - Intergenic
1044846766 8:96389491-96389513 CCAGGCTTTCCCAGGAGCTCTGG - Intergenic
1045064398 8:98433038-98433060 CCAGGCTTTCTCAGGAAATCTGG - Intronic
1045760137 8:105595678-105595700 CCATGCTTTCCCAAGAAATCTGG + Intronic
1047060105 8:121215736-121215758 CCAGGCTCTCCCAGCGAAGGGGG - Intergenic
1048470250 8:134698587-134698609 CCAGAATGTCCCAGGGAAGAGGG - Intronic
1049766596 8:144358087-144358109 CCAGGATTTCCAAGGGAATGCGG + Exonic
1050144621 9:2553535-2553557 CCAGGGTTTCAGAGGGAGGCAGG + Intergenic
1051541998 9:18230310-18230332 CCAGGCTTCCCCATGTAGGCCGG - Intergenic
1051717926 9:20004343-20004365 TCAGGCTTTTCCAGGGAAGCTGG + Intergenic
1053321325 9:37101415-37101437 CCAGGCCATCCCAAGGAGGCAGG - Intergenic
1054925750 9:70587339-70587361 CCAGGCTGTACCAGGGCAGGAGG - Intronic
1055129055 9:72753807-72753829 TCAGGCTTGCCCAGGGACACAGG - Intronic
1056655432 9:88504839-88504861 CCGGGCTTTCACAGTGAGGCTGG + Intergenic
1056682805 9:88733882-88733904 CGCGGCTGTCCCAGGGGAGCAGG + Intergenic
1056762867 9:89427411-89427433 CCCGGCTGTCTCAGGGAGGCAGG - Intronic
1057507457 9:95647601-95647623 ACGGGTTTTCCCTGGGAAGCTGG + Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1059429272 9:114240422-114240444 CCAGGCTTACCCTGGGGAGAAGG - Exonic
1059433296 9:114262506-114262528 CCAGGCTCTGCCAGGGGAGGGGG - Intronic
1059434420 9:114267528-114267550 CCGGGCCTTCCTGGGGAAGCCGG + Exonic
1060782483 9:126422975-126422997 CCAGGCTCTCCAAGGGGAGAGGG + Intronic
1061137031 9:128740869-128740891 CCAGGAATTCCCAGAGAAGCAGG - Exonic
1061389204 9:130307809-130307831 CCAGGGTCACCCAGGGAAGCCGG - Intronic
1061677964 9:132229082-132229104 CCGGGGACTCCCAGGGAAGCAGG - Intronic
1062123266 9:134845734-134845756 GCAGCATTGCCCAGGGAAGCTGG + Intergenic
1062319810 9:135985427-135985449 CCAGGCTCTCCCAGATAAGGCGG - Intergenic
1186957265 X:14697224-14697246 CAAGACTTTCCCAGGTAAACTGG - Intronic
1189122440 X:38408992-38409014 CCAGGCTTTCCAAGGTTACCAGG + Exonic
1189703290 X:43733860-43733882 CCTGCCTTTCTCAGGGAGGCTGG - Intronic
1191258747 X:58291346-58291368 CCAGGCTTTCACAGGGATTTTGG + Intergenic
1191258899 X:58292001-58292023 CCAGGCTTTCAGAGGGATGCTGG + Intergenic
1193185461 X:78507287-78507309 CCAGGGTTTCCCAGGGGACAGGG - Intergenic
1195004845 X:100675646-100675668 CCAGGGCTTCCTAGGGAAGTAGG + Exonic
1199082924 X:143595973-143595995 CCAAGCTTTCCCAAGGACCCAGG + Intergenic
1199694547 X:150334652-150334674 ACAGGCACTCCCAGGGCAGCTGG - Intergenic
1200208208 X:154332841-154332863 CCCGGCCTTCCCCGGGCAGCCGG + Intergenic