ID: 922738170

View in Genome Browser
Species Human (GRCh38)
Location 1:228000907-228000929
Sequence GGGGCTTGGGGCACCTCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922738170_922738180 11 Left 922738170 1:228000907-228000929 CCCAAAGAGGTGCCCCAAGCCCC No data
Right 922738180 1:228000941-228000963 TCTCTAGGAAGTCTGGCCACTGG No data
922738170_922738179 4 Left 922738170 1:228000907-228000929 CCCAAAGAGGTGCCCCAAGCCCC No data
Right 922738179 1:228000934-228000956 AATGCACTCTCTAGGAAGTCTGG No data
922738170_922738176 -4 Left 922738170 1:228000907-228000929 CCCAAAGAGGTGCCCCAAGCCCC No data
Right 922738176 1:228000926-228000948 CCCCTGCAAATGCACTCTCTAGG No data
922738170_922738181 12 Left 922738170 1:228000907-228000929 CCCAAAGAGGTGCCCCAAGCCCC No data
Right 922738181 1:228000942-228000964 CTCTAGGAAGTCTGGCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922738170 Original CRISPR GGGGCTTGGGGCACCTCTTT GGG (reversed) Intergenic