ID: 922739473

View in Genome Browser
Species Human (GRCh38)
Location 1:228007189-228007211
Sequence AGGCTCACTCACCACCAGAT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922739473_922739482 23 Left 922739473 1:228007189-228007211 CCGATCTGGTGGTGAGTGAGCCT 0: 1
1: 0
2: 2
3: 15
4: 81
Right 922739482 1:228007235-228007257 TGCGCCGCGCCCGCAGCAGACGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922739473 Original CRISPR AGGCTCACTCACCACCAGAT CGG (reversed) Exonic
901026479 1:6281090-6281112 ATGCGCACTCACCACCAGCTGGG + Exonic
902627837 1:17687224-17687246 ACGCTCACTCACGAGCAGACAGG - Intronic
907594117 1:55703959-55703981 AAGCTCACTCAGCACCAGCTGGG - Intergenic
908511567 1:64853832-64853854 AGTCTCACTCACCACTCTATGGG - Intronic
912956421 1:114156795-114156817 AGGCACACTGAGCCCCAGATAGG - Intergenic
915228597 1:154429311-154429333 AGGCTCCCACCCCAGCAGATGGG + Exonic
915912219 1:159922420-159922442 AGGCACACACACCATCAGCTTGG + Intronic
920857272 1:209673482-209673504 AGGCTGACTCACCTTCAGAATGG + Intergenic
922553185 1:226512421-226512443 AGGCTGCCTAATCACCAGATAGG - Intergenic
922739473 1:228007189-228007211 AGGCTCACTCACCACCAGATCGG - Exonic
1064902013 10:20305121-20305143 AGACTCACTGACAACCAAATAGG + Intergenic
1067954846 10:50779915-50779937 TGGCTCACTCACCACCCATTTGG - Intronic
1069906579 10:71735794-71735816 AGCCTCACTCACCCCCAGGCTGG - Intronic
1072503192 10:96039473-96039495 GGGGTAACTCACCACCAGTTTGG + Intergenic
1072764055 10:98081837-98081859 GGGATGACTCTCCACCAGATGGG + Intergenic
1073572173 10:104589795-104589817 AGGCTCACTGATCACCAGAAGGG - Intergenic
1077110975 11:862141-862163 AGGCTCACTCCCCACCTGACAGG - Intronic
1077291166 11:1794836-1794858 GAGCTCACTCACCACCAGAGGGG - Intergenic
1078578770 11:12523151-12523173 TGGCAAACTCACCACCAGATAGG + Intronic
1082797111 11:57386281-57386303 AAGCTCCCTCACCTCCAGCTGGG + Intergenic
1084495739 11:69502045-69502067 AGGCACACTCGGCACCAGAATGG + Intergenic
1084734155 11:71093774-71093796 AGACTCACACACCAACAGAAGGG + Intronic
1084970720 11:72770618-72770640 AGGTTAACTCAGCATCAGATGGG - Intronic
1086469985 11:87097687-87097709 ATGCTCACTCAACACCAGAGAGG - Intronic
1088833023 11:113554289-113554311 AGCCTCACTCACCGCCAGCTGGG - Intergenic
1088909333 11:114179040-114179062 GGCCTCACTCACTACAAGATGGG - Intronic
1092369080 12:7901614-7901636 AGTCTCACTCTCCACCAGGCTGG - Intergenic
1100774051 12:97955228-97955250 AGGCTGTCTCACCAGCAAATAGG + Intergenic
1108633154 13:52306391-52306413 AGGCAAACCCACCATCAGATTGG - Intergenic
1108653537 13:52506169-52506191 AGGCAAACCCACCATCAGATTGG + Intergenic
1112340176 13:98546538-98546560 GGCCTCACTCACCACCAGATGGG + Intronic
1113782240 13:112983335-112983357 GGGCACACTCCCCAGCAGATGGG - Intronic
1115159318 14:30375475-30375497 AGCCTCAGTCACCAGCAGAGGGG + Intergenic
1116962886 14:50985210-50985232 AGGCTCTGTCACAACCAGCTTGG + Intronic
1117159299 14:52973240-52973262 GGGCTAACTCACCACCATAAAGG - Intergenic
1120347390 14:83308284-83308306 AAGCTCACTCACCTCCTGCTGGG + Intergenic
1121615505 14:95311170-95311192 AGGTTCCTCCACCACCAGATTGG + Intronic
1132267186 15:100484490-100484512 AGGACCACTCAGCTCCAGATAGG + Intronic
1136609401 16:31357091-31357113 AGGGCCACTCACCAGCAGCTGGG - Exonic
1137021627 16:35433394-35433416 AGGCTCCATCAACACCAGATAGG + Intergenic
1143038136 17:4012234-4012256 AGGATCACTCAGCCCCACATGGG - Intronic
1143622311 17:8087672-8087694 CTGCTCACTCACCACCAGCTGGG - Exonic
1144494467 17:15737609-15737631 TGGCCCACTCACCACCACACAGG - Intronic
1144905799 17:18639067-18639089 TGGCCCACTCACCACCACACAGG + Intronic
1151371307 17:73647870-73647892 ATGCTCACTGAACCCCAGATAGG + Intergenic
1155500282 18:26480848-26480870 AGACTCACTTCCCACCAAATGGG - Intronic
1155940328 18:31796037-31796059 AGGCCCACTCACCAACTGAATGG - Intergenic
1167310511 19:48735133-48735155 TTGCTCACCCACCAACAGATGGG + Intronic
1168597273 19:57688076-57688098 AGCCTCATTCAACACCAGAGAGG + Exonic
927419295 2:22913170-22913192 AGGCCAACTAACTACCAGATTGG - Intergenic
930425088 2:51202903-51202925 AAGCCCAGTCACCACCACATAGG - Intergenic
936151275 2:110023582-110023604 TGGCTCATCCACCACCAGAAAGG - Intergenic
936193400 2:110347787-110347809 TGGCTCATCCACCACCAGAAAGG + Intergenic
939706407 2:145458717-145458739 AGGCTCACCCACCAACTGGTTGG - Intergenic
941244593 2:163080652-163080674 AGACCCACTCACCACCAGGAGGG + Intergenic
943158175 2:184212008-184212030 AGACTCATTCACTACCAGAACGG - Intergenic
943688315 2:190842749-190842771 TGGCTCACTCACCACCTGGCAGG + Intergenic
944695037 2:202193140-202193162 AGACTCAGCCACCACCAGCTTGG - Intronic
948754625 2:240151656-240151678 AGGCTCACGCCCCACCCCATCGG - Intergenic
1173280193 20:41620206-41620228 ATACTCACTCACCAGCAGCTTGG - Intergenic
1175449171 20:59047779-59047801 TGGCACCCTCACCACCAGTTGGG - Intergenic
1179030815 21:37718123-37718145 AGACACACTCAACTCCAGATGGG - Intronic
1181571928 22:23772633-23772655 AGGGTCACCCAGCACCAGATAGG + Intronic
954192614 3:48974770-48974792 AGGCTCACACACCACCAGGTTGG - Intronic
955805538 3:62730227-62730249 GGGCTAAATCACCACCAGTTGGG - Intronic
961723138 3:128909089-128909111 AGGCCCACTCACCGCAAGACTGG - Exonic
962490343 3:135887516-135887538 AGGATTACTCACAAACAGATGGG + Intergenic
967950013 3:194833403-194833425 AGGCTCACCCAGCAACTGATTGG + Intergenic
969290050 4:6233097-6233119 AAGCCCACTTACCACCAGGTGGG + Intergenic
970663347 4:18310534-18310556 AGACTCAGTCACCAGGAGATAGG - Intergenic
977120790 4:93098386-93098408 AGGCAGACTCACCATCAGAGAGG + Intronic
977230411 4:94445591-94445613 AGTCTCACTTGCCACCAGACTGG - Intergenic
989667668 5:43874764-43874786 CGGCACTCTCACCACCAGAATGG - Intergenic
995858158 5:116615220-116615242 AGGTTCCCTCACCACCTGCTTGG + Intergenic
997243059 5:132322345-132322367 AGTCACACTCACCACCACAGCGG - Exonic
999292962 5:150439389-150439411 AGGCTCACTGGGCACCAGAGGGG + Intergenic
1003278732 6:4674279-4674301 AGGCTCAGTCCCCACCACATAGG + Intergenic
1003572841 6:7267282-7267304 AGGCTCACCCATCTTCAGATCGG + Intergenic
1008406087 6:51120209-51120231 AGGCTGACTCACCACAAGCTTGG - Intergenic
1016100308 6:140091454-140091476 AGTCTCACTCATCACCAGGCTGG + Intergenic
1020136715 7:5592061-5592083 CTGCCCACTCACCACCAGGTGGG + Intergenic
1023992502 7:45137129-45137151 AGGCTCTCTCATCAGCAGACAGG + Intergenic
1026976818 7:74503717-74503739 AGTCTCACTGTCCCCCAGATTGG - Intronic
1030255137 7:107501781-107501803 GGGTTCAGCCACCACCAGATGGG - Intronic
1030914847 7:115299647-115299669 TGCATCACTCACCACCAGACTGG - Intergenic
1036821766 8:11945675-11945697 AGTCTCCCTCACCAGCAGGTAGG - Intergenic
1037627079 8:20617717-20617739 AGGCTTTTTCATCACCAGATGGG - Intergenic
1040568805 8:48590462-48590484 AGGCTCAGACAACACCAGCTTGG - Intergenic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1049774228 8:144397195-144397217 AGGCGCACTCACCAGCAGGTAGG + Exonic
1051798053 9:20898229-20898251 AGGCTCAGACAACACCAGGTAGG - Intronic
1052995083 9:34547661-34547683 AGACCCACTCACCCTCAGATTGG + Intergenic
1056850838 9:90082368-90082390 AGGCTCACGCCCCAGCAGATGGG - Intergenic
1059527849 9:115008684-115008706 AGGCTCTCTCACTAGCAGCTTGG - Intergenic
1061260382 9:129477324-129477346 AGGCACACTGCCCACCAGCTAGG - Intergenic
1062646068 9:137548917-137548939 ACGCTCACTCTCAACCAGGTGGG + Intronic
1192398719 X:70812348-70812370 AGGCGCACCCACCACCAGGCCGG + Intronic
1196993162 X:121350061-121350083 AGGCTCACACAGTAGCAGATAGG - Intergenic
1197757366 X:130005208-130005230 ACAGCCACTCACCACCAGATAGG - Exonic