ID: 922739623

View in Genome Browser
Species Human (GRCh38)
Location 1:228007789-228007811
Sequence CCGGGCACGGGGGTTTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922739611_922739623 -8 Left 922739611 1:228007774-228007796 CCTCCCCGCCGCAGTCCGGGCAC 0: 1
1: 0
2: 1
3: 14
4: 222
Right 922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
922739608_922739623 -1 Left 922739608 1:228007767-228007789 CCGCGCGCCTCCCCGCCGCAGTC 0: 1
1: 0
2: 3
3: 27
4: 494
Right 922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
922739607_922739623 0 Left 922739607 1:228007766-228007788 CCCGCGCGCCTCCCCGCCGCAGT 0: 1
1: 0
2: 1
3: 21
4: 179
Right 922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
922739605_922739623 7 Left 922739605 1:228007759-228007781 CCTGGGCCCCGCGCGCCTCCCCG 0: 1
1: 0
2: 7
3: 99
4: 780
Right 922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
922739606_922739623 1 Left 922739606 1:228007765-228007787 CCCCGCGCGCCTCCCCGCCGCAG 0: 1
1: 0
2: 3
3: 33
4: 422
Right 922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
922739604_922739623 8 Left 922739604 1:228007758-228007780 CCCTGGGCCCCGCGCGCCTCCCC 0: 1
1: 0
2: 2
3: 49
4: 549
Right 922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 101
922739603_922739623 12 Left 922739603 1:228007754-228007776 CCGGCCCTGGGCCCCGCGCGCCT 0: 1
1: 1
2: 6
3: 59
4: 568
Right 922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG 0: 1
1: 0
2: 1
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922739623 Original CRISPR CCGGGCACGGGGGTTTCCAG GGG Intronic
900301690 1:1981153-1981175 TCTGGAACGGGGGCTTCCAGCGG - Intronic
900532635 1:3162225-3162247 CCGGGCACGGGGTTTTCCTGGGG - Intronic
900610285 1:3541802-3541824 CCGGGCACAGGGGCTCCCTGGGG + Intronic
904688276 1:32275694-32275716 CCGGGCGCGGGGGTGCCCCGGGG + Intronic
906137944 1:43513450-43513472 CCTGGCACTGGCGCTTCCAGGGG - Intergenic
913994892 1:143643604-143643626 CCTGGCAGGGGCGCTTCCAGTGG - Intergenic
922739623 1:228007789-228007811 CCGGGCACGGGGGTTTCCAGGGG + Intronic
923040185 1:230314294-230314316 CAGGGCAGGGGGGTCTTCAGGGG - Intergenic
924617778 1:245628194-245628216 CCGGGCACGGTGGCTCACAGTGG + Intronic
1068869466 10:61927963-61927985 CTGGGCACTGTGGTTTCCGGTGG + Intronic
1071488764 10:86121963-86121985 TGGGGCCCGGGGGTATCCAGTGG - Intronic
1076189532 10:128473212-128473234 CTGGGCACAGGGCTTTCCAGAGG + Intergenic
1076279371 10:129232691-129232713 CAGAGCACTGGGCTTTCCAGAGG + Intergenic
1076616390 10:131757955-131757977 CCAGGCTGGGGGGTTCCCAGGGG - Intergenic
1077246957 11:1544346-1544368 CCAGGCACGGGGGCTCCGAGGGG + Intergenic
1077797528 11:5507996-5508018 CAGGGCACGGGGGTTTGCCATGG + Exonic
1082854390 11:57793514-57793536 CCTGGAATGGGAGTTTCCAGTGG + Intronic
1086438799 11:86807721-86807743 CAGGCCAAGTGGGTTTCCAGGGG - Exonic
1087202380 11:95358967-95358989 CCGGGTATGGAGGTTCCCAGAGG - Intergenic
1091758611 12:3072561-3072583 CCGGGAGCGGGGGGTTGCAGTGG - Intergenic
1092194561 12:6541476-6541498 CTGGGCATGGGGCCTTCCAGGGG - Intronic
1092271879 12:7030272-7030294 CCAGCCACAGAGGTTTCCAGTGG - Intronic
1106420433 13:29581372-29581394 CCTAGCACGGGGGTTTGCACAGG - Intronic
1111091694 13:83454086-83454108 CCGGCCGCAGGCGTTTCCAGCGG + Intergenic
1114255302 14:20996565-20996587 CCTTGCTCGGGGGTCTCCAGAGG + Exonic
1114618652 14:24081877-24081899 CCAGGCCCGGGTGTGTCCAGTGG + Intronic
1114754869 14:25247734-25247756 GCGGGCACAGGAGTTTCCAGGGG - Intergenic
1116862206 14:50003633-50003655 CCGGGCTCGGGGGTGTTCACGGG - Intronic
1116955710 14:50921030-50921052 CCGGGCACGGGGGTGTCATATGG + Exonic
1121337609 14:93086792-93086814 ATGGGCACTGGGGTTTCCTGGGG + Intronic
1121440540 14:93946182-93946204 CTGGGGACGGGGCTTTCAAGGGG + Intronic
1121604524 14:95230772-95230794 CCTGGCACAGGGGCTGCCAGTGG + Intronic
1121729723 14:96178074-96178096 CAGGGGAGGGGGGTTTCCTGAGG + Intergenic
1122972176 14:105156849-105156871 CAGGGCAGGGGTGTTTCCTGAGG - Intronic
1125520601 15:40345985-40346007 CTGGGCCTGGGGGTATCCAGAGG - Intergenic
1132583410 16:695312-695334 CCGGGGGCGGGGGCTTCCGGCGG - Intronic
1138524260 16:57592837-57592859 CAGGGCAGGAGGGTTTCCTGTGG + Intergenic
1143457645 17:7078204-7078226 CTGGGCACAGGGGACTCCAGGGG + Intronic
1152064734 17:78104665-78104687 CCAGGCACGGGGCGTTCCAGTGG - Exonic
1152273761 17:79341812-79341834 CCTGGCTTGGGGGTTTGCAGGGG - Intronic
1152447708 17:80355505-80355527 CCGGGAATGGGGGCTTACAGGGG + Intronic
1152447770 17:80355692-80355714 CCGGGAATGGGGGCTTACAGAGG + Intronic
1152539878 17:80969517-80969539 CCGGGCACTGGGGCTTCCGCAGG - Intergenic
1152717067 17:81905339-81905361 CTGGGCACAGGGGTTGCCATTGG - Intronic
1155276042 18:24188347-24188369 CCAGCCACCGGGCTTTCCAGGGG + Intronic
1159674071 18:71260004-71260026 CAGGGTAAGGGGGTTTTCAGGGG + Intergenic
1160111893 18:76040497-76040519 CAGGGCATGGGGAATTCCAGAGG - Intergenic
1160590417 18:79941411-79941433 CAGGGCACGGACGTCTCCAGGGG + Intronic
1160828422 19:1091420-1091442 CCCGGCACGGGGTCCTCCAGGGG - Intronic
1160919702 19:1513704-1513726 CCGGGCCCCGGGGCTGCCAGCGG + Intergenic
1160933189 19:1580389-1580411 CTGGGCATGCGGGTTTCCTGTGG - Intronic
1161108467 19:2455936-2455958 CCCGGCTTGGGGGTCTCCAGGGG - Intronic
1163738958 19:18999029-18999051 CAGGGCACAGGGGTCCCCAGAGG + Intronic
1165779994 19:38426776-38426798 CCAGGCACGGGGGCTCACAGGGG + Intergenic
1166768437 19:45266017-45266039 CTGGGCATGGGGGTGTCCTGGGG + Intronic
1167017483 19:46850567-46850589 CTGCGCGCGGGGGTTACCAGGGG - Intronic
928524510 2:32126080-32126102 CCGGGCACGGTGGCTTACAGTGG - Intronic
928998585 2:37324332-37324354 CCGGGCGCGGTGGTCTCCAGCGG + Intronic
935595410 2:104873792-104873814 CTGGGCAAGGAGGTTTCCGGAGG - Intergenic
936316321 2:111427529-111427551 CTGGGCAAGGGTGTGTCCAGAGG + Intergenic
937357258 2:121205844-121205866 CCGGGCCTGGGGGTGGCCAGGGG - Intergenic
946361392 2:219221099-219221121 CCCTGCATGGGGGCTTCCAGAGG - Exonic
947160269 2:227207591-227207613 AAGGGCAGGGGGGTTTGCAGGGG + Intronic
948560278 2:238847480-238847502 TTGGGCACGGGCGTCTCCAGGGG + Intergenic
1168941075 20:1711869-1711891 CCAGGCACCAGGCTTTCCAGTGG + Intergenic
1172184087 20:33020606-33020628 CCCAGGACGGGGGTTTCTAGAGG - Intronic
1174356212 20:49999571-49999593 CTGGGCACGGGGCTTTCCCAAGG + Intergenic
1175349659 20:58309386-58309408 CTGGGCTCGGGGGATGCCAGGGG - Intergenic
1181532097 22:23522680-23522702 CCGGGCGCGGGGGTCTCCCCCGG + Intergenic
1182416788 22:30226485-30226507 CTGGACACATGGGTTTCCAGGGG - Intergenic
1183976168 22:41513562-41513584 CCTGGCACAGTGGCTTCCAGTGG + Intronic
1183987037 22:41575623-41575645 CCGAGCCCAGGGGTTTGCAGAGG + Exonic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
954840371 3:53506288-53506310 CTGGGCACAGGGGTGTCCAGAGG - Intronic
955927527 3:64022929-64022951 CCGGGCGCGGGGTATTCCTGTGG - Intronic
956377453 3:68630873-68630895 CTGGGGACAGGGGTTCCCAGTGG - Intergenic
966712012 3:182980695-182980717 CCGGGCGCGGGGGTCCCCCGGGG + Intronic
967110467 3:186288805-186288827 CGAGGGACGGGGGGTTCCAGGGG + Exonic
976780497 4:88752967-88752989 CAGGGCACGGAGCTTTCCTGGGG + Intronic
986402339 5:7394476-7394498 CCGGGCACGGATCCTTCCAGAGG - Intergenic
988835974 5:35032703-35032725 CTGGGCAAGGGGGGTGCCAGTGG - Intronic
990992569 5:61700103-61700125 CCAGGCAGGTGAGTTTCCAGGGG + Intronic
998369887 5:141654138-141654160 CCAGGCACGGGGGTCCCTAGAGG - Exonic
998458969 5:142295419-142295441 CCAGGGATGGGGGTTTCAAGGGG - Intergenic
1002340718 5:178515198-178515220 CTGGGCAGGGTGGCTTCCAGAGG - Intronic
1002929045 6:1620794-1620816 CCGGGCACCGGGGTTGTGAGCGG + Intergenic
1008231749 6:48991076-48991098 CCGGCCACAGAGGTTTCCACAGG + Intergenic
1008382566 6:50850723-50850745 CAGGGCACTGGGGTTTGAAGGGG + Intergenic
1013642456 6:112099304-112099326 CCAGCCAAGGAGGTTTCCAGTGG + Exonic
1017842244 6:158231917-158231939 CCGGGGGCGGGGGTCTCCCGGGG + Intergenic
1019484994 7:1285264-1285286 CCGGGCACTGGGGTGTCTGGGGG + Intergenic
1020111603 7:5451040-5451062 CCGGGCACAGGAGTTTCCTGGGG - Intronic
1023067181 7:36389730-36389752 CCGGGCCGGGTGGTTCCCAGGGG - Intronic
1023942942 7:44781650-44781672 CCGGGCACGGGGTTCTCTAAAGG + Intergenic
1036807455 8:11845388-11845410 CCGGGCAGGGGGCTTGCCCGTGG - Intronic
1048257408 8:132915497-132915519 CAGGGCACGGGGCTTCCGAGGGG + Intronic
1053284479 9:36841475-36841497 CAGGGCAGGGGGCTTCCCAGAGG - Intronic
1055694635 9:78870647-78870669 CCAGGCTCAGGGGCTTCCAGGGG + Intergenic
1057064641 9:92037582-92037604 CTGGGCACGCGGGTTTACAGTGG - Intronic
1061158971 9:128882406-128882428 CCGGGCACTGGGGAGCCCAGAGG - Intronic
1061619855 9:131804910-131804932 GCAGGCAGGGGGGTTTCCTGGGG - Intergenic
1062165477 9:135105363-135105385 CCGGGCACCAGGGCTTTCAGAGG - Intronic
1062439687 9:136564174-136564196 CCAGGCCCTGGGATTTCCAGAGG + Intergenic
1062484477 9:136768230-136768252 CAGGGCAGGGGGCTTCCCAGTGG + Intergenic
1185471450 X:386453-386475 CCCGGCCCGGGGGTTCCCGGGGG + Exonic
1185506573 X:635576-635598 CGGGGCACGGGGGCTCCCCGAGG + Intronic
1186722670 X:12322433-12322455 CTGGGAAAGGGTGTTTCCAGAGG + Intronic
1188168091 X:26887311-26887333 CTGGGCAAGGTGGTTTGCAGAGG - Intergenic
1190380566 X:49836694-49836716 CTTGGCACAGGGGTTCCCAGAGG + Intergenic
1190385189 X:49878253-49878275 CTTGGCACAGGGGTTCCCAGAGG + Intergenic
1197333218 X:125180133-125180155 CCGGGGGGGGGGGTTTCCATGGG - Intergenic