ID: 922740329

View in Genome Browser
Species Human (GRCh38)
Location 1:228010770-228010792
Sequence GATGTGAGGGAGACCCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922740329 Original CRISPR GATGTGAGGGAGACCCTGGA GGG (reversed) Intronic
900314419 1:2050015-2050037 GATGTCAGGGGACCCCTGGACGG + Intergenic
900498018 1:2985197-2985219 GGGCTGAGGGAGACCCTGGAAGG + Intergenic
900678747 1:3904410-3904432 GAATTGCAGGAGACCCTGGAGGG + Intergenic
901210116 1:7519876-7519898 GAGGTGAGGAAGCCCCAGGAGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901561400 1:10074429-10074451 GATGTGGGGGAGAAGCTGGCAGG - Intronic
902032975 1:13436327-13436349 GAGGTGGGGCAGACCCTGGTGGG - Intergenic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903222861 1:21878557-21878579 GAGGTGAGGGAGAGCCTTGGGGG - Exonic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904434605 1:30486045-30486067 GATGTGAAGGGGACCCTCCAGGG + Intergenic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904891074 1:33780047-33780069 GGTTGGAGGGAGACCCTGAAGGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
908159475 1:61392634-61392656 GATGTGTGGGACACCCTGCTGGG + Intronic
908296515 1:62718514-62718536 GTAGTGAGTGAGACCCAGGAAGG + Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908554932 1:65248389-65248411 GGAGAGTGGGAGACCCTGGAAGG + Intronic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910161512 1:84277172-84277194 GATGTGGGGTTGACCTTGGAAGG - Intergenic
911666975 1:100564545-100564567 GATGTCAAGTAAACCCTGGAGGG + Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912933203 1:113982303-113982325 GTTGGGAGGGAGAAACTGGATGG - Intergenic
912940895 1:114043719-114043741 GGCGTGGGGGAGAGCCTGGAAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915248030 1:154569712-154569734 GGTGTGAGAGGGACCCTGGGTGG + Intronic
917046998 1:170872112-170872134 GATGAGAAGGAGTCTCTGGATGG + Intergenic
917376264 1:174351052-174351074 CATGAGAGGGAGACCGTGGGGGG + Intronic
919887101 1:201942509-201942531 CCTTGGAGGGAGACCCTGGAGGG + Intronic
920185235 1:204155298-204155320 GATGTGAGGGAGGCCCAGTGTGG - Intronic
920441608 1:205984633-205984655 GAGGTGGGGAAGACCATGGAAGG - Intronic
921338086 1:214108032-214108054 GAGGTGGGGGAGGCCCTGGCAGG - Intergenic
921349658 1:214222607-214222629 GATGTGATGGAGACACTGACAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922740329 1:228010770-228010792 GATGTGAGGGAGACCCTGGAGGG - Intronic
923773040 1:236954163-236954185 GATGGGAGGGAGGCCCTGGGTGG + Intergenic
924095928 1:240550483-240550505 AATGTGAGTGTGACCCAGGATGG + Intronic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063412367 10:5846372-5846394 AATGTGAGTCAGACCCCGGAGGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1064583297 10:16815454-16815476 GATGTTCAGGAGACCCTGAAAGG - Intronic
1064823199 10:19362988-19363010 GAAGTGAGGGAGACTGTGGGAGG + Intronic
1064988772 10:21237574-21237596 GATATGAGGGAGATGCTGTATGG - Intergenic
1065332652 10:24618736-24618758 GTTGTGAGGCAGACCATGGAGGG + Intronic
1066489057 10:35876379-35876401 GATGTGAGCGGGACCTTGGCGGG + Intergenic
1067321293 10:45223564-45223586 GATGTTCAGGAGACCCTGAAAGG - Intergenic
1068066011 10:52131873-52131895 AATGTGAGGGAGACACTGGGAGG + Intronic
1068927632 10:62556641-62556663 GATCTGGGGGAGGCCTTGGATGG - Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069313548 10:67069323-67069345 CATGTAAGGGAGACTTTGGAAGG - Intronic
1069416941 10:68208885-68208907 GATGTCAGAGAGAGCCGGGAAGG + Intronic
1070827267 10:79398559-79398581 GATGGGAGGGAAACCTGGGAGGG + Intronic
1071672168 10:87618899-87618921 GAGGTGAGGGAGAGGCGGGAGGG - Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073192583 10:101662311-101662333 GAGGTGAGGGAGCGTCTGGAAGG - Intronic
1074657972 10:115616828-115616850 GATGTGTGAGAAAGCCTGGATGG + Intronic
1075736251 10:124666365-124666387 GAAGTGAGTGTGAGCCTGGAAGG - Intronic
1075994005 10:126861835-126861857 AATTTGAGGGAGACCCTAGGAGG - Intergenic
1076109892 10:127852144-127852166 GCTGTGACGGGGGCCCTGGAGGG + Intergenic
1076934917 10:133561383-133561405 GAAATGAGGGATTCCCTGGATGG - Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078406458 11:11074322-11074344 GAAGTAGGGGAGAACCTGGAGGG + Intergenic
1078706323 11:13747405-13747427 GATGTGGCTGAGACCCAGGAGGG - Intergenic
1080856625 11:36117184-36117206 GTTGTGAGGTAGAATCTGGAAGG + Intronic
1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG + Intergenic
1083343692 11:61975054-61975076 GGTGTGAGGGGAACCCTGGAGGG - Intergenic
1083546674 11:63554019-63554041 GATGTGAGGCCGACCCCCGAGGG + Intronic
1083904018 11:65658540-65658562 GTTGAGGGGGAGACCATGGAGGG - Intronic
1084333033 11:68440722-68440744 GATGTGAGGGATACCCAGAAGGG - Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085491481 11:76922920-76922942 GATTTGAGCTAGACCCTGAAAGG - Intronic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088320312 11:108548627-108548649 GATGTAAGGGTGACCCAGGAAGG + Intronic
1089519723 11:119055887-119055909 GATTAGAGGGAGTCCCAGGAAGG - Intronic
1090203752 11:124873740-124873762 GCTGAGAGGGAGCCCCCGGAGGG - Exonic
1090332276 11:125941567-125941589 GAAATGAAGGAGGCCCTGGATGG - Intergenic
1090791338 11:130092683-130092705 CATGAGAGGGAGACCGTGGGGGG + Intronic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1092030363 12:5278622-5278644 GATGTGAGGGAGAGAGTGGGCGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094181153 12:27593869-27593891 GATGGGAGGGAGAAAGTGGATGG + Intronic
1096039581 12:48501481-48501503 CATGAGAGGGAGACCGTGGAAGG + Intergenic
1096179856 12:49544687-49544709 GGTGTCAGAGAAACCCTGGAGGG - Intronic
1097038879 12:56142479-56142501 CAGGTGAGGGACACCCAGGAGGG + Intronic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1101793282 12:107950184-107950206 GATGACAGGGAGCCCCTGGAAGG - Intergenic
1104929918 12:132333267-132333289 TCTCTGAGGGAGGCCCTGGAAGG - Intergenic
1105469232 13:20677167-20677189 GAGGAGAGGGAGACTCTGGAGGG - Intronic
1105870997 13:24506149-24506171 GATGTCAGTGAGACCAAGGAAGG - Intronic
1106230018 13:27814474-27814496 GAAGGGAGGGAGATCCCGGAAGG - Intergenic
1106396720 13:29387583-29387605 GAAGTGAGGGAGACCCGCGAGGG + Intronic
1106771739 13:32967995-32968017 CATGTAAGGCAGACCCTGGAAGG + Intergenic
1108776561 13:53772132-53772154 GTTGTGGGAGAGACCCTGGTAGG - Intergenic
1110190851 13:72727523-72727545 GCGGTGCGGGAGACCATGGACGG - Exonic
1110462469 13:75760234-75760256 GATATGAGGGCAACCTTGGAGGG + Intronic
1110538616 13:76681967-76681989 GTTGTGAGGAAGAGACTGGAAGG - Intergenic
1113964792 13:114146756-114146778 TCTGCGAGGGAGCCCCTGGAGGG + Intergenic
1114080494 14:19198866-19198888 GATGTGAGGGCCAAGCTGGAGGG - Intergenic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116529415 14:45949592-45949614 GAAGTGAGGGAGAGACTGGAAGG - Intergenic
1116840949 14:49820641-49820663 CATGAGAGGGAGACCGTGGAAGG - Intronic
1117999520 14:61510173-61510195 GATGGGGGTGAGAACCTGGAAGG + Intronic
1118016339 14:61664913-61664935 GATATGAGGGAGCCCAGGGAGGG - Intergenic
1119327415 14:73769100-73769122 GATGCGAGGGAGACCCTGGGAGG - Intronic
1121091733 14:91187661-91187683 GTGATGAGGGAGACTCTGGAGGG - Intronic
1121274116 14:92656338-92656360 GAGGTGATGGAGCCCCTGAAGGG + Intronic
1121722422 14:96119103-96119125 CCAGTGAGGGAGCCCCTGGAAGG - Intergenic
1121951576 14:98175394-98175416 GGTGAGAGGCAGACTCTGGAAGG + Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1122664542 14:103319382-103319404 CAGGTTAGGGAGAGCCTGGAAGG - Intergenic
1122917078 14:104864370-104864392 GAGGTGAGGGAGAATGTGGAAGG - Intergenic
1124806263 15:32886588-32886610 AAAGTGAGGCAGCCCCTGGAAGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1126058395 15:44754461-44754483 GGAGTGAAGGGGACCCTGGATGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1128091800 15:64924134-64924156 CATGTGAGTGAGACCCTCCAGGG - Intronic
1129165784 15:73776501-73776523 GAAGTGACAGAGACCCTGTAGGG - Intergenic
1129372518 15:75106381-75106403 GCTGTAGGGGAGACCCCGGAAGG + Intronic
1129749359 15:78049782-78049804 GATGTGAGGGAGATGCTGAGTGG - Intronic
1130048331 15:80463244-80463266 CATGTGTGGGACACACTGGATGG + Intronic
1130308615 15:82733093-82733115 AATGTCAGGGAGACCCTATATGG + Intergenic
1130536664 15:84790323-84790345 GCTGTGACAGAGACCCTGGTGGG + Intronic
1130988609 15:88861070-88861092 GATCTGAGGTGGACCCCGGAAGG + Intronic
1131322432 15:91407426-91407448 GCTCTCAGGGAGAACCTGGAAGG + Intergenic
1131394919 15:92078539-92078561 GATGTGAGGCAGACAGTAGACGG - Intronic
1131399996 15:92116813-92116835 GATGGGAGGAAGAACTTGGAAGG + Intronic
1131831733 15:96359131-96359153 TCTGTGAGGGAAACCCAGGAAGG + Intergenic
1132496358 16:265273-265295 GGTGTGAGCGGGACCCTGGTGGG - Exonic
1132997068 16:2828974-2828996 GCTGTGAGGGCCTCCCTGGAGGG - Intergenic
1133446184 16:5862975-5862997 GATGTGTGGGAGTCCCAGGAGGG + Intergenic
1134241768 16:12512021-12512043 GCCGTGAGGAGGACCCTGGAGGG + Intronic
1135101261 16:19608111-19608133 GATCTGTGTGAGTCCCTGGATGG - Intronic
1135815394 16:25627927-25627949 GTTCTGATGGAGACCATGGAAGG - Intergenic
1136377936 16:29876544-29876566 GATGAGAGGGAGACCCAGAGGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137639247 16:50013867-50013889 GAAGGGAGGGAGACTCTCGAGGG + Intergenic
1138103641 16:54274808-54274830 GCTGTGGGGGAGACCAAGGAGGG - Intergenic
1138699493 16:58847020-58847042 CATGAGAGGGAGACCGTGGAGGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1141410250 16:83828245-83828267 CATGTGAGGCAGACTCGGGATGG + Intergenic
1142031477 16:87840658-87840680 AATGTGCGGGAGGGCCTGGAAGG - Intronic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143152880 17:4818120-4818142 GAGGTGGGGGAGAGCATGGAAGG + Intronic
1143882518 17:10040527-10040549 AATGTGAGGGAGAAACTAGAGGG + Intronic
1144403448 17:14929289-14929311 GGTGAGAAGGAGACCCTGAAGGG + Intergenic
1146181907 17:30703820-30703842 GAGCTGAGTGAGCCCCTGGAAGG - Intergenic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1151422287 17:74006351-74006373 GAGGTGAAGGAGGCCCTGCAGGG + Intergenic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152771904 17:82175207-82175229 CATGAGGGGTAGACCCTGGAAGG + Intronic
1152772735 17:82180130-82180152 GTTGTGAGAGGGTCCCTGGAGGG + Intronic
1153007805 18:512993-513015 CTTGAGAGGGAGACCGTGGAAGG + Intergenic
1153492875 18:5667707-5667729 GAGAAGAGGGAGACCCTAGAGGG + Intergenic
1154502452 18:15003570-15003592 GATGTGACTGAGGCCCAGGAGGG - Intergenic
1156468507 18:37362795-37362817 GATGTGAGGGAGGCCCTGGAAGG - Intronic
1156476617 18:37409631-37409653 AGAGTGAGGGAGACCCTGGCGGG + Intronic
1156727712 18:40149059-40149081 GATGTTAGGGAGCCCCTGCATGG + Intergenic
1156730136 18:40183872-40183894 GGTGTGAGGGTGCCCCTTGACGG + Intergenic
1157755571 18:50214280-50214302 GATTTGTGGAAAACCCTGGAGGG - Intergenic
1158116130 18:53997747-53997769 GTTGTGGGAGAGACCCTGGGGGG - Intergenic
1158664762 18:59422483-59422505 GACTTGAGGCAGACACTGGAAGG + Intergenic
1158820965 18:61158328-61158350 GCTGTGACTGAGACCCAGGAAGG - Intergenic
1158821063 18:61159288-61159310 GCTGTGACTGAGACCCAGGAAGG - Intergenic
1160790131 19:919275-919297 GAAGTGAGGGAGCCCTTGGGGGG - Intronic
1161115234 19:2493052-2493074 GATGGGAGTGAGGCCCTGGGGGG + Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162976931 19:14211971-14211993 GAGCTGAGTGAGCCCCTGGAAGG + Intergenic
1164736863 19:30548141-30548163 GATTCCAGGGAGACCCTTGAAGG - Exonic
1164898298 19:31896687-31896709 CATGTGAAGGAGAACCAGGAAGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166194068 19:41194622-41194644 GCTGTGCGGGAGGCCCTGGGAGG + Exonic
1166346858 19:42171826-42171848 TCTGTGAGGGAGACCCTGAATGG + Intronic
1166387668 19:42391199-42391221 GAGATGAGCGAGACCCTGAAAGG - Intergenic
1167281011 19:48568580-48568602 CAAGTGAGGGAGAGCCTGGCGGG + Intronic
1167793337 19:51693711-51693733 GGTGTCAGAGAGGCCCTGGAAGG - Intergenic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168651987 19:58097639-58097661 GATGTGAGGGTGTCCGTGGTGGG - Intronic
925024290 2:595482-595504 CACGTGATGAAGACCCTGGACGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
926258384 2:11231986-11232008 TATGTGACGGAGACCCTGTGTGG - Intronic
926404463 2:12536844-12536866 GAAATGTGGGAGTCCCTGGAAGG - Intergenic
927213410 2:20652268-20652290 GTTCTGAGGGAGACCCTTGAAGG + Intergenic
927473883 2:23397281-23397303 GATGTGAGGGAGAGCCTGTGGGG - Intronic
927651434 2:24915882-24915904 GAGTTGAGGAAGACCCTGGTGGG + Intronic
927671689 2:25073824-25073846 GAATTGAGGCAGAGCCTGGAAGG - Intronic
927910440 2:26894261-26894283 GATGTGGGGGAGCCACTGCAGGG - Intronic
927990218 2:27442321-27442343 GGTGGGAGGGGGACCCGGGACGG + Intergenic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930691545 2:54370810-54370832 GAGGTGAGACAGTCCCTGGAGGG + Intronic
932285740 2:70530286-70530308 GATGGTGGGCAGACCCTGGAAGG - Intronic
932504149 2:72212621-72212643 GTTGTGAGGAAAAACCTGGAAGG - Intronic
932849646 2:75171990-75172012 GATGTGAGAGGGACCATGGGTGG + Intronic
934729528 2:96647884-96647906 GATGTGAGTCAGGCCCAGGAAGG + Intergenic
935298661 2:101673681-101673703 GAAGGGAGGGAGACTCTGAAGGG - Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
937124988 2:119469093-119469115 GATGTGAGGAAGACCCTTGAAGG + Intronic
937182797 2:120011665-120011687 GAGGTGGGGGAGCCACTGGAAGG - Intergenic
938501627 2:131833742-131833764 GATGTGACTGAGGCCCAGGAGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
939519820 2:143215609-143215631 CATGTGAGGCAGACACAGGAGGG + Intronic
940294341 2:152106702-152106724 AATGTGATGTATACCCTGGATGG + Intergenic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942043164 2:172084395-172084417 GAGGTGAGGAAGATCCTGGGTGG + Intergenic
942319764 2:174726106-174726128 GCTAAGAGGGAGACCCTGGATGG + Intergenic
942897656 2:181076872-181076894 GATGTAGTGGAAACCCTGGAAGG + Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944634403 2:201660809-201660831 GAAGTGTGTGAGACCCAGGAAGG - Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946351426 2:219157098-219157120 TCTTTGAGGTAGACCCTGGATGG - Intronic
946635545 2:221721329-221721351 CATGTGAGTGAGATCCTGGCTGG - Intergenic
947171950 2:227320908-227320930 GCTGTGAGGGAGCCCATGGTGGG - Intergenic
947214316 2:227736274-227736296 GAGGGGTGGGAGACCCTGAAGGG + Intergenic
948918329 2:241049716-241049738 GATGTCAGGGTAACCCTGGCAGG + Intronic
948983588 2:241507563-241507585 GCTGTAGGGGAGACCCTGGCGGG - Intronic
949071131 2:242024941-242024963 GTTGTGGTGGAGACCCAGGAAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170278791 20:14623025-14623047 GATGTGAGCTAGCCCCTGGGAGG - Intronic
1170434629 20:16313574-16313596 GGTGAGAGGGAGTGCCTGGAAGG - Intronic
1172537652 20:35686687-35686709 GATGTGCAGGACACACTGGAAGG + Intronic
1172997949 20:39084406-39084428 AAGGTGAGGAAGACCGTGGAGGG - Intergenic
1174219003 20:48937308-48937330 GATGGGAGGAAGCCCATGGAGGG - Intronic
1174522038 20:51139101-51139123 GGTGATAGGGAGCCCCTGGAAGG - Intergenic
1174553165 20:51375839-51375861 GAGCTGAGGGTGAACCTGGAGGG + Intergenic
1175407100 20:58742379-58742401 GATGGGAGGGAAAGTCTGGAGGG - Intergenic
1175587957 20:60160766-60160788 TGTGTAAGAGAGACCCTGGATGG + Intergenic
1176035830 20:63036026-63036048 GGTGTGCGGGGGACCCTGGCAGG - Intergenic
1177838655 21:26213192-26213214 GAAGTGAGGGAGTCCCTTGAGGG + Intergenic
1178947344 21:36959357-36959379 GATGGGAGGGAGGCCGAGGAGGG + Intronic
1180089304 21:45525634-45525656 GAAGTGAGAGAGACCCTAGCGGG - Intronic
1180100812 21:45584182-45584204 CATGTGAGCGAGAACTTGGATGG + Intergenic
1180500285 22:15923818-15923840 GATGTGAGGGCCAAGCTGGAGGG + Intergenic
1180612981 22:17109446-17109468 GACGTGAGGGAGCACCTCGAAGG + Exonic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181668335 22:24413471-24413493 GATGGGGAGGTGACCCTGGAGGG - Intronic
1181860644 22:25815381-25815403 GTTGTCAGGGAGACCTTGGCTGG - Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1183428851 22:37753822-37753844 GATGTGAGGGAACCCTGGGAGGG + Intronic
1183931620 22:41238808-41238830 GAGGTGAGGCACGCCCTGGAAGG + Exonic
1183979850 22:41533025-41533047 GAGCTGAAGGAGAGCCTGGAGGG - Intronic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184424961 22:44403944-44403966 GATCTCAAGGAGACCCTGGGAGG + Intergenic
1184445043 22:44542122-44542144 GATGTGGGGGAGACACCGGCTGG + Intergenic
950498656 3:13349804-13349826 GAGGTGACGGAGAGCCTGGGAGG + Intronic
950523599 3:13510375-13510397 GATGTGAGGGGGACCCAGACTGG - Intergenic
950670607 3:14523122-14523144 GCTGTGTGGGAGCCTCTGGATGG - Intronic
951491820 3:23279399-23279421 TATGTAAGACAGACCCTGGAAGG - Intronic
952387802 3:32855460-32855482 GAAGTGGGGGAGCCTCTGGAGGG + Intronic
952857734 3:37785937-37785959 GAGGTGTGGGAGAGGCTGGAGGG + Intronic
953797332 3:45995584-45995606 GGTCTGAGGGAGACCTGGGATGG + Intronic
953996073 3:47521060-47521082 TCTGTCAGGGAGACACTGGAAGG + Intergenic
953998816 3:47540513-47540535 GATTTGAGGGTTACTCTGGAAGG + Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954618476 3:51982710-51982732 GATGTAATTGTGACCCTGGATGG - Intronic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962079306 3:132120228-132120250 GAGGTGAGGAAGACGCTGCAGGG + Intronic
962390873 3:134971567-134971589 GATGAGAGGCAGGCCCTGGCTGG + Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964376391 3:156052255-156052277 GCTGTGTGGGAGCCCATGGAGGG - Intronic
964714929 3:159711992-159712014 GTTGTTAGTGTGACCCTGGATGG - Intronic
966387050 3:179409939-179409961 GTTGTGAGGGAGCCGGTGGAAGG + Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967674707 3:192283035-192283057 TATGTGAGGGAAAACCGGGAGGG + Intronic
968122013 3:196132397-196132419 TAAGTGAGGGAGACCCTGAGGGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
969686051 4:8674866-8674888 GATGCGAGGAGGAACCTGGATGG + Intergenic
969847319 4:9929644-9929666 GGTGTGAGGGGGACACTAGAAGG + Intronic
969878878 4:10156543-10156565 GATGTTAGGAAAACCCTGGTTGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972665442 4:41160650-41160672 GGTGAGAGGGAGACCAGGGAAGG - Intronic
975164909 4:71167508-71167530 GATGTTAGGGAGACCCTCTTTGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975849928 4:78561634-78561656 GATGTGAGGGAGACCAGAGGAGG - Intronic
976194527 4:82520240-82520262 TATGTGGGGGAGAACCTGGGAGG - Intronic
976390718 4:84501338-84501360 GATGTGAGGAGGTCGCTGGAGGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979362381 4:119780134-119780156 GCTGTCAGGGAGACCCTGCTGGG + Intergenic
981304698 4:143234427-143234449 TTTGTGAGAAAGACCCTGGAAGG - Intergenic
981505522 4:145495117-145495139 AATTGGAGGGAGACGCTGGAGGG + Intronic
981729849 4:147885702-147885724 GATCTGAGGGAGAACCAGAATGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982245681 4:153347968-153347990 GATGTCTGGGAGCCACTGGAGGG + Intronic
983685818 4:170407592-170407614 CATGTAAGAGAGACCCTGGAAGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985647227 5:1090698-1090720 GATTTGAGGCTGAGCCTGGAGGG - Intronic
986828086 5:11543330-11543352 CATGTAAGGGAGACCCTGCAAGG + Intronic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992628883 5:78661476-78661498 GAAGGGAGGGAGACCCTGAAGGG + Intronic
994795780 5:104298022-104298044 GATGTGAGGAAGAACCTCAAAGG + Intergenic
998519062 5:142783345-142783367 GATGTGGGGGAGCTCCTGAAAGG + Intronic
999314149 5:150573494-150573516 GGGGTCAGGGAGACCCTGGGTGG + Intergenic
1001054419 5:168437143-168437165 GAGGTGAGGGAGCACCTGGGAGG - Intronic
1002851957 6:1004110-1004132 GGAGTGAGGAAGACCCAGGAGGG - Intergenic
1005475883 6:26207359-26207381 GAGGTGAGGCAGACAATGGAAGG + Intergenic
1006048662 6:31321999-31322021 GAGGTGCTGGAGACCCTGGTTGG - Intronic
1006888009 6:37398387-37398409 GGGGTGAGGGAGAGCCTGGAGGG + Intergenic
1007387469 6:41529419-41529441 GCTCTGAGGGAGTCCCCGGAGGG - Intergenic
1008013517 6:46491907-46491929 AATGTCGGGGAGCCCCTGGATGG + Intronic
1008397631 6:51027285-51027307 TATGTTTGGGAGACCCTGGGGGG + Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1013533782 6:111044522-111044544 GAACTGAGGGAGATCATGGAAGG - Intergenic
1013911198 6:115278429-115278451 GAAGTCAGGGAGGCCCTGGAAGG - Intergenic
1014113230 6:117644776-117644798 GAGGTGAGGCAGACCCTCTAAGG - Intergenic
1015366499 6:132402006-132402028 GACGTGAAGGTTACCCTGGACGG - Intergenic
1015886595 6:137924346-137924368 GATCTGAGGGGGGCCCTGAAGGG + Intergenic
1016759413 6:147720476-147720498 GAGCTGGGGGAGACCGTGGAAGG - Intronic
1017334798 6:153243497-153243519 GATGGAAGGTAGAGCCTGGAAGG - Intergenic
1018676809 6:166229448-166229470 GATGTCAGGGAGACCCTGAAGGG - Intergenic
1019158894 6:170056630-170056652 GATGAGGGGGAGACCCGGGGCGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019567695 7:1692704-1692726 GAGGGGAGGGAGCCCCAGGAGGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020066756 7:5194204-5194226 GATGTGAGGGGGAGCGGGGATGG + Intronic
1020126018 7:5532866-5532888 GGGGTGACGGAGACCCTGGGAGG - Intronic
1021247932 7:18287674-18287696 GATGTGAAGGAGACCAGGGCAGG - Intronic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022711077 7:32850874-32850896 GTTGTGAGAGGGACCCTGGTGGG - Intergenic
1022913573 7:34924055-34924077 GTTGTGAGAGGGACCCTGAAGGG + Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026589253 7:71681276-71681298 GATGTCAGGGAGCCACTGGAAGG + Intronic
1032513114 7:132487717-132487739 CATGAGAGGAAGACCCGGGAAGG + Intronic
1033245826 7:139715502-139715524 GATGTGAGTGAAAGCCTGGTTGG - Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1034496887 7:151428486-151428508 CATGGGAGGGAGGCCCAGGAAGG + Intergenic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035060768 7:156067538-156067560 GCTGGGAGGGCCACCCTGGATGG + Intergenic
1035067789 7:156121028-156121050 GCTGTTGGGAAGACCCTGGACGG + Intergenic
1035333305 7:158110514-158110536 AATGTGTGGGAGCCTCTGGAGGG - Intronic
1035528449 8:332887-332909 GATTTCAGGGTGTCCCTGGAGGG + Intergenic
1035528465 8:332932-332954 GATTTCAGGGTGTCCCTGGAGGG + Intergenic
1035700226 8:1632771-1632793 AACGTGATGGTGACCCTGGAGGG + Intronic
1035719717 8:1782963-1782985 AATGTGTGGGTGACACTGGACGG - Exonic
1035723818 8:1812640-1812662 GATGTGAGGGGGTCCTGGGATGG + Intergenic
1035768067 8:2124326-2124348 GTTCTGTGGGAGGCCCTGGATGG + Intronic
1036755775 8:11470274-11470296 GATTTGAGGGAGACGATGGAGGG + Intronic
1037316463 8:17604038-17604060 GAGGTGAGGCAGACCATGGAGGG + Intronic
1038076670 8:24083464-24083486 GAGGTCCGGGAGACCCTGGAGGG + Intergenic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1041522419 8:58771005-58771027 GAGGTGAGGAAGCACCTGGAAGG + Intergenic
1041522474 8:58771209-58771231 GAGGTGAGGGAGCACCTGGGAGG + Intergenic
1042060810 8:64815350-64815372 AATGTGAGGGAGAACTTGGAGGG - Intergenic
1043037133 8:75212216-75212238 GTGGGGAGGGAGTCCCTGGATGG - Intergenic
1043781792 8:84345625-84345647 AATGAGAGGGAGATGCTGGAGGG - Intronic
1044730498 8:95225114-95225136 GATATGATGGGGACCCCGGAAGG + Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1047001232 8:120574802-120574824 AATGAGATGGAGACCCAGGAAGG + Intronic
1048272465 8:133040516-133040538 CATTTGCGGGAAACCCTGGAAGG - Intronic
1048326137 8:133440887-133440909 GAAGGGAGGGAAAGCCTGGAGGG - Intergenic
1049422491 8:142523154-142523176 GATGTCACTGAGACCCTGAAGGG + Intronic
1049444993 8:142625890-142625912 GATGTAACGGAGTTCCTGGATGG - Intergenic
1049585926 8:143432363-143432385 GTTGAGAGGGAGGCCCGGGAAGG + Intergenic
1049786297 8:144452442-144452464 GAGCTGATGGAGATCCTGGATGG - Exonic
1049786401 8:144452961-144452983 GCTGTGGGGGAGCCCCTTGAAGG - Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050917699 9:11158269-11158291 GAGGTGGGGGAGACCCCTGAGGG + Intergenic
1051567386 9:18516058-18516080 GAGGTGAGGGAGGAGCTGGAGGG - Intronic
1051956856 9:22705938-22705960 GTTGTGAGGGATACACTGGGGGG + Intergenic
1052741590 9:32398250-32398272 GATGAGATGGAGACCCTAAAAGG + Intronic
1053665980 9:40317925-40317947 GATGGGAGGGGGACCGGGGATGG + Intronic
1053915561 9:42942970-42942992 GATGGGAGGGGGACCGGGGATGG + Intergenic
1054518630 9:66058358-66058380 GATGGGAGGGGGACCGGGGATGG - Intergenic
1055552498 9:77444644-77444666 GCTGTGAAGAAGACACTGGAAGG - Intronic
1056381078 9:86057757-86057779 GATGTGACTGAGGCCCAGGAGGG - Intronic
1061903847 9:133686488-133686510 AATGTGAGAGACACCCTGGCAGG - Intronic
1062498046 9:136840807-136840829 GATGTGACTGAGGCCCAGGAGGG + Exonic
1062671412 9:137712054-137712076 GAGGTGGGGGCAACCCTGGAGGG - Intronic
1185829799 X:3289851-3289873 GATGGGAGGGAGATCTGGGATGG - Intergenic
1185834271 X:3330340-3330362 TAAGTTAGAGAGACCCTGGAGGG + Exonic
1187237042 X:17477249-17477271 TATGTGAGTGAAAACCTGGAAGG + Intronic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188495734 X:30781236-30781258 GATGTCAGGGAGAAGATGGAAGG - Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190714794 X:53094194-53094216 GATCTGAAGGATACGCTGGACGG - Intergenic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1190980497 X:55453038-55453060 GATCTGAGGCAGACCCTTGGGGG + Exonic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1192213709 X:69143447-69143469 GATGAAAGGGAGACACAGGAAGG + Intergenic
1195794130 X:108625017-108625039 GATGTGAGGGAGAGATAGGAAGG - Intronic
1195861689 X:109389942-109389964 AAGGTAAGGGAGACCTTGGATGG - Intronic
1196790251 X:119458141-119458163 GATGTGAGGAAGACTGAGGAGGG + Intergenic
1198657288 X:138928542-138928564 GATGTGAGGGCACCCCTGGGTGG - Intronic
1199151839 X:144496375-144496397 AATGTTAGGGAGACCCTAAAGGG + Intergenic
1200036392 X:153334308-153334330 GATGTGCGGGGGGCGCTGGAGGG + Intronic
1200052823 X:153443955-153443977 GCTGTGAGGGTGACCCTGGAAGG - Intergenic