ID: 922740390

View in Genome Browser
Species Human (GRCh38)
Location 1:228011059-228011081
Sequence AGTCCTGGTGGGCCTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 5, 3: 9, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922740382_922740390 2 Left 922740382 1:228011034-228011056 CCAGGCACTTCGCCCCTGTGTCC 0: 1
1: 0
2: 0
3: 11
4: 173
Right 922740390 1:228011059-228011081 AGTCCTGGTGGGCCTCATTGTGG 0: 1
1: 0
2: 5
3: 9
4: 157
922740381_922740390 5 Left 922740381 1:228011031-228011053 CCGCCAGGCACTTCGCCCCTGTG 0: 1
1: 0
2: 1
3: 9
4: 129
Right 922740390 1:228011059-228011081 AGTCCTGGTGGGCCTCATTGTGG 0: 1
1: 0
2: 5
3: 9
4: 157
922740378_922740390 25 Left 922740378 1:228011011-228011033 CCAGTGTCTGCACTGCACCACCG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 922740390 1:228011059-228011081 AGTCCTGGTGGGCCTCATTGTGG 0: 1
1: 0
2: 5
3: 9
4: 157
922740384_922740390 -10 Left 922740384 1:228011046-228011068 CCCCTGTGTCCTCAGTCCTGGTG 0: 1
1: 0
2: 6
3: 33
4: 343
Right 922740390 1:228011059-228011081 AGTCCTGGTGGGCCTCATTGTGG 0: 1
1: 0
2: 5
3: 9
4: 157
922740380_922740390 8 Left 922740380 1:228011028-228011050 CCACCGCCAGGCACTTCGCCCCT No data
Right 922740390 1:228011059-228011081 AGTCCTGGTGGGCCTCATTGTGG 0: 1
1: 0
2: 5
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922740390 Original CRISPR AGTCCTGGTGGGCCTCATTG TGG Intronic
904171624 1:28595309-28595331 AGTCTCTGTGGGCTTCATTGAGG + Exonic
904259334 1:29279530-29279552 AGACATGGTAGGTCTCATTGCGG - Exonic
904565365 1:31425351-31425373 GATCCTGGTGGGCCTCACCGTGG + Exonic
904615583 1:31747774-31747796 ATTCCTCGTGAGCCCCATTGTGG - Intronic
904887523 1:33752251-33752273 GGGCCTGGTGGGACTCATGGGGG + Intronic
906046694 1:42836475-42836497 AGGCCTGGTGGGTCACATTCAGG + Intronic
907767048 1:57422828-57422850 GGTGCTGGTGGGCCTGATGGGGG - Intronic
913983558 1:143545150-143545172 GGGCCTGGTCGGCCTCCTTGGGG - Intergenic
914579958 1:149010567-149010589 GGGCCTGGTTGGCCTCCTTGGGG - Exonic
916383959 1:164246076-164246098 AGTGTTGGTGGGCCTCAATTGGG + Intergenic
917027912 1:170662505-170662527 AGTCCTGGTATGCCTAATGGCGG + Intergenic
919477192 1:198043448-198043470 AGTCCTGGTAGGCATGACTGCGG + Intergenic
921622351 1:217339826-217339848 AATCATGGAGGGCCTCTTTGAGG - Intergenic
922215084 1:223513606-223513628 AGTCCTGGTGAGCCCCGTGGGGG - Intergenic
922740390 1:228011059-228011081 AGTCCTGGTGGGCCTCATTGTGG + Intronic
924457265 1:244228732-244228754 AGTCCCGGTGACCCTCACTGCGG - Intergenic
924858728 1:247899636-247899658 AGTCCTGGTGGGACTCCAGGTGG + Intergenic
1064976065 10:21117173-21117195 TCTCCTGGTGGGTCTCATGGTGG - Intronic
1067155172 10:43775484-43775506 AGGCCTGGCGGGTCTCATTGGGG + Intergenic
1068671471 10:59727777-59727799 AGTCCTGGTGGGACTCTGGGTGG + Intronic
1069760322 10:70806199-70806221 AGTCCTTGTGGGTCTGCTTGAGG - Intergenic
1073719895 10:106156353-106156375 AGTCATGTTGGGCCACAATGAGG - Intergenic
1073901251 10:108223704-108223726 TTTTCTGGTGGGCCTCATAGTGG + Intergenic
1074051273 10:109883143-109883165 AGGCCTTGTGGGCCACATTCAGG - Intronic
1075418804 10:122285740-122285762 ACTCTTGGGGGGCCTCATTCTGG - Intronic
1080919108 11:36690904-36690926 AGTTCTGGTGGCCCTGATGGTGG + Intergenic
1080931235 11:36813556-36813578 AGTCAGAGTGGGCCTTATTGAGG - Intergenic
1083197510 11:61097511-61097533 AGTCCTGGTGGGACTCCGGGTGG - Intergenic
1083238340 11:61366972-61366994 AGCCCTGGTAGGCCTGTTTGGGG - Intronic
1083313152 11:61796186-61796208 AGAGCTGGTGAGCCTCCTTGTGG - Exonic
1083672242 11:64305924-64305946 AGTCCTGGTGGGCCGGCCTGGGG + Intronic
1084333226 11:68441989-68442011 AGTCCTGCTTGGCGTCATGGGGG - Intronic
1085240071 11:75045807-75045829 AGTCCTGGTGGGACTCTGGGTGG - Intergenic
1086420692 11:86634297-86634319 AGTCCTGGTGGGGATGACTGTGG - Intronic
1086973126 11:93104843-93104865 AGTCCTGGTGGGACTCCGGGTGG + Intergenic
1087684856 11:101250973-101250995 AGTCCTGGTGGGACTCCAGGTGG - Intergenic
1087962918 11:104374315-104374337 AGACCTTATGGGCCTCATTTAGG + Intergenic
1089460147 11:118648239-118648261 AGTCCTGGTGGGTCTGTTTTGGG - Intronic
1092021796 12:5209028-5209050 AGACCCGTTGTGCCTCATTGTGG + Intergenic
1093296733 12:17400758-17400780 CATCCTGTTGGCCCTCATTGAGG + Intergenic
1101319509 12:103661126-103661148 AGGCCAGGAGGTCCTCATTGAGG + Intronic
1104393824 12:128414835-128414857 GGTCCTGGTTGGCTTCCTTGAGG - Exonic
1104750662 12:131236114-131236136 AGTCCTGGTGGTCCTCAGTGAGG - Intergenic
1104782061 12:131428346-131428368 AGTCCTGGTGGTCCTCAGTGAGG + Intergenic
1110123558 13:71913138-71913160 ATTCCTGGAATGCCTCATTGAGG + Intergenic
1111016491 13:82388217-82388239 AGTCCCGGTGGGCCCCTTAGAGG - Intergenic
1113594610 13:111522042-111522064 AGTGTTCGTGGGCCTCAGTGTGG + Intergenic
1115519990 14:34223714-34223736 TGTATTGGTGGCCCTCATTGTGG - Intronic
1117243587 14:53861034-53861056 AGTCCTGGTTGGTCTCATTTGGG + Intergenic
1118010996 14:61610548-61610570 TGGCCTGGTGGGCCACATTTAGG - Intronic
1118787075 14:69054862-69054884 AGTGTTGGTGGGCTTGATTGGGG + Exonic
1120935801 14:89893638-89893660 AGTCTCTGTGGGCTTCATTGAGG + Intronic
1121960205 14:98252768-98252790 CGTGCTGTTGAGCCTCATTGGGG + Intergenic
1122879608 14:104684325-104684347 AGAGCTGGTGGGCCTCCTTCGGG - Intergenic
1123990397 15:25679396-25679418 AGTCCTGATCGGCCTGAGTGGGG + Exonic
1124439786 15:29677659-29677681 AGTCCTGGAGGGCTTCGTGGAGG + Intergenic
1125541563 15:40472537-40472559 AGACCTGCTGCTCCTCATTGGGG + Exonic
1133227996 16:4351761-4351783 GGTCCAGGTGGGCCTCATTGAGG - Intronic
1137041382 16:35615939-35615961 AGTCCTGGTGGGACTCCAGGTGG + Intergenic
1137445257 16:48527529-48527551 AGTCCTGATGGGCCTCAACCAGG + Intergenic
1138512875 16:57518711-57518733 CGTCCTGGTGCGCCTCCTTCAGG + Exonic
1140734352 16:77884700-77884722 AGGCCGGGCGGGCCTCATTCGGG + Exonic
1142150583 16:88510894-88510916 AGTCCTGCTGGGCCTGGCTGAGG + Intronic
1143179387 17:4974648-4974670 AGTCCTGGTGGGCTTTATTTAGG - Intronic
1144331646 17:14229488-14229510 AGTCTGTTTGGGCCTCATTGTGG + Intergenic
1144933169 17:18876731-18876753 AGACAGGGTAGGCCTCATTGTGG + Intronic
1145254221 17:21313993-21314015 AGTCATGGAGGGCCTCCTGGGGG + Intronic
1145322381 17:21773969-21773991 AGTCATGGAGGGCCTCCTGGGGG - Intergenic
1146296397 17:31653833-31653855 AGTCTTGGTGGAGCTCACTGGGG - Intergenic
1146764497 17:35507030-35507052 AGTCCTGGTGGGACTCTGGGTGG - Intronic
1148680705 17:49472000-49472022 AGTCATGGAGGGCCTCTCTGAGG - Intronic
1149694469 17:58605762-58605784 AGTCAGGGAGGGCCTCCTTGAGG - Intronic
1150006291 17:61470917-61470939 AGTCAGGGAGGGCCTCACTGGGG + Intronic
1150414087 17:64973317-64973339 AGTCTTGGGGGGCCTCAGGGTGG + Intergenic
1151722989 17:75868780-75868802 GGTCCTTGTGGGCCTCACTTGGG - Intergenic
1161515421 19:4693608-4693630 TGTCCTGGTGGGTCTGATTCTGG - Intronic
1163942876 19:20511187-20511209 AGTCCTGGTGGGACTCTGGGTGG + Intergenic
1164216573 19:23155838-23155860 AGTCCTGGTGGGACTCCGGGTGG + Intergenic
1165705056 19:37969806-37969828 AGTCCAGAAGGGCCTCTTTGAGG - Intronic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1166067202 19:40366784-40366806 GGTCCTGCTGGTCCTCATTCTGG + Exonic
929599244 2:43194626-43194648 ACTCCTGGTGGGCCTTCTGGAGG + Intergenic
929768337 2:44869672-44869694 AGTCCGGGTAGGCTTCCTTGAGG - Intergenic
930519991 2:52453608-52453630 AGTCAAGGAAGGCCTCATTGAGG - Intergenic
931321728 2:61179026-61179048 GCTCCTGGTGGGCATCGTTGTGG + Exonic
931640253 2:64375434-64375456 AGTCAAGGTGGGACTCATGGCGG + Intergenic
932586523 2:73033487-73033509 AGTCAGGGTGGGTCTCACTGAGG + Intronic
933987483 2:87603974-87603996 AGTCCTGGCGTGACTCACTGGGG + Intergenic
934540060 2:95166265-95166287 AGTGCTGGAGGGCTTCATGGAGG + Intronic
935721152 2:105980413-105980435 AGTCCTGGTGGGACTCCGGGTGG + Intergenic
936306356 2:111346834-111346856 AGTCCTGGCGTGACTCACTGGGG - Intergenic
937073267 2:119082126-119082148 AGTCAGAGTGGGCCTCATGGAGG + Intergenic
942198432 2:173546324-173546346 GGTGGTGGTGGGCGTCATTGTGG + Intergenic
945044340 2:205768714-205768736 GCTCCTGGTGGGCCGCTTTGAGG + Intronic
948603033 2:239118139-239118161 AGCCCTGCTGTGCCTCACTGTGG + Intronic
948788653 2:240365926-240365948 AGTGCCGCTGGGCCTCATGGAGG - Intergenic
1173553708 20:43950664-43950686 AGTCAAGGTGGGCCTCATTGAGG - Intronic
1174351904 20:49974479-49974501 AATCCTGTAGGGCCTCGTTGTGG + Intergenic
1175772222 20:61630995-61631017 AATCCTGGAGGGCCTCTCTGAGG + Intronic
1175807110 20:61835779-61835801 GGTCCAGGTGGGCCTCTCTGTGG + Intronic
1176908562 21:14534791-14534813 AAGCCTGTTGAGCCTCATTGTGG - Intronic
1178661947 21:34514275-34514297 GGACCTCGTGGACCTCATTGTGG + Intronic
1179279301 21:39920868-39920890 CATCCTGGTTGGCCTCACTGTGG + Intronic
1179670565 21:42944070-42944092 AGTCCTGGTGGGACTCCGGGTGG + Intergenic
1179838333 21:44052707-44052729 AGTCCTGGGAGGCCTCTTGGTGG + Intronic
1182064612 22:27421430-27421452 AGGCCAAATGGGCCTCATTGGGG - Intergenic
1183654001 22:39174805-39174827 AGGCCTGGTGGGCTCCATGGGGG + Intergenic
1183682624 22:39342266-39342288 AGTCATGATGGGCTTCATTTGGG + Intergenic
1184428892 22:44429446-44429468 TGTCGTGGTGGGTGTCATTGTGG + Intergenic
1185380702 22:50506414-50506436 TGCCCTGGGGGGCCTCCTTGCGG + Exonic
951734663 3:25851102-25851124 AGTCATGGAGGGCATCCTTGAGG + Intergenic
955534779 3:59911450-59911472 AGTACTGGTGGGCCTTTTAGGGG + Intronic
962897005 3:139724613-139724635 AGACCTGGTGGTGTTCATTGCGG + Intergenic
962950327 3:140212794-140212816 AGGCCTGGTGGGTCTTATGGTGG - Intronic
964087673 3:152836298-152836320 CGTGCTGGTGTGGCTCATTGTGG + Exonic
964924355 3:161937773-161937795 AGTCCTGGTGGGACTCCAGGTGG - Intergenic
967124210 3:186409764-186409786 AGTCCTGGGCTGCCTCTTTGAGG + Intergenic
967229430 3:187323718-187323740 CATCCAGGTAGGCCTCATTGAGG + Intergenic
971075130 4:23139333-23139355 ACTCCAGGTGTGCCTCGTTGAGG + Intergenic
971375004 4:26049554-26049576 TGTCCTGGAGAGCCTCATGGGGG + Intergenic
971513506 4:27457482-27457504 TGTCCTGGTAGGCCTTGTTGAGG + Intergenic
973304068 4:48624329-48624351 AGACGTGGTGGGACTCACTGTGG + Intronic
975406464 4:73996255-73996277 AGTCCTGGTGGGACACACTGGGG - Exonic
978093603 4:104747759-104747781 AGTTCTGGTGGGCCTAATCAGGG - Intergenic
979891229 4:126097706-126097728 AGACCTGGTGGGGCTCCTAGAGG + Intergenic
982204145 4:152984447-152984469 TGACCAGGTGGGCCTCATTCTGG - Intergenic
986309762 5:6543403-6543425 AGTCCTGGTGGGGCTCAGCAGGG + Intergenic
986514796 5:8550025-8550047 AGTCCCGGTGAGTCTCACTGAGG + Intergenic
989167794 5:38447895-38447917 AATCCTAGTGGGCCTTATTTAGG + Intronic
997669067 5:135655593-135655615 AGCCCTGGTGGTCTTCAGTGTGG + Intergenic
998448674 5:142217882-142217904 AGTCAGGGTAGGCCTCATGGAGG + Intergenic
998586471 5:143432413-143432435 AGTCCTGAGGGGCATCTTTGTGG + Intronic
998830042 5:146147655-146147677 AGTCCTGTTGGTCCTCTTTGTGG - Intronic
1000145318 5:158448041-158448063 AGTCCTGGTGGGCATCAGAAAGG + Intergenic
1000237139 5:159372536-159372558 AGTCCTGGTGGGACTCCGGGTGG - Intergenic
1001105511 5:168850862-168850884 AGGTCTGGTGTGCCTCTTTGTGG - Intronic
1001364376 5:171122160-171122182 AGTCCAGGAGGGCAGCATTGAGG - Intronic
1012562212 6:100597102-100597124 AGTCAGGGTGGGCCTCATTAAGG - Intronic
1014360887 6:120471979-120472001 GAGCCTGGTGGGCCTCAGTGAGG + Intergenic
1014546557 6:122742827-122742849 AGTCCTGGTGGGACTCTGGGTGG + Intergenic
1015875268 6:137816219-137816241 AGTGCTGGGTGTCCTCATTGTGG - Intergenic
1015960617 6:138645359-138645381 AGGCCGGGTAGGCCTCATTAAGG - Intronic
1018704106 6:166450448-166450470 AGCCATGGTGGTCCTCATGGTGG - Intronic
1019845847 7:3500034-3500056 AGTCCTGGTCAGGCTCACTGGGG + Intronic
1020275818 7:6623831-6623853 AGTCCAGGGGGGCCACAGTGGGG - Exonic
1024358942 7:48447553-48447575 ATGCCTAGTGGGCCTCATTCAGG - Intronic
1027280874 7:76608711-76608733 AGTCCTCGTGGGCAACATGGGGG - Intergenic
1028340421 7:89712627-89712649 ATTCTTGGTGGCCATCATTGAGG - Intergenic
1032799548 7:135307277-135307299 AGCCCTGGGGGGCCTCATGGCGG - Intergenic
1035260797 7:157660377-157660399 AGTCCTGTGGGGCCTCTTGGTGG - Intronic
1037833215 8:22201195-22201217 AGGCCTGGCAGGCCTCACTGGGG - Intronic
1042611686 8:70607851-70607873 AGTCCCGGTGGGCCTCATCGCGG - Intronic
1045167502 8:99623276-99623298 AGTCATGGTAGGCCTCATCAAGG - Intronic
1045249739 8:100473482-100473504 TGGCCTGGTGGGCTTCATGGAGG + Intergenic
1049154252 8:141057150-141057172 AGTCCTGGAGGGCCGCCGTGGGG - Intergenic
1049350001 8:142159350-142159372 AGTCCTGCTGGGGCTGAGTGGGG - Intergenic
1052056251 9:23910930-23910952 ATTTCTGGTGTGCCTCATTTTGG - Intergenic
1053715376 9:40883634-40883656 AGGCCTGGTGGGCTACCTTGGGG - Intergenic
1054077171 9:60547100-60547122 AGGCCTGGTGGGCTACCTTGGGG + Intergenic
1058915383 9:109559686-109559708 TGCCCTGGAGGGCCACATTGAGG - Intergenic
1061826002 9:133258539-133258561 AAGCCTGCTGGGCCTCCTTGTGG + Intronic
1062535341 9:137018737-137018759 TGTCCTGGTAGGCCTGGTTGAGG + Exonic
1185736907 X:2501648-2501670 AGTCCTGGTGGGGTTCTTGGTGG - Intronic
1186522126 X:10214967-10214989 AGTCCTGCTGGGCCTCAAGGTGG + Intronic
1189712244 X:43825462-43825484 AGTCAGGGAGGGCCTCACTGAGG - Intronic
1190275053 X:48893948-48893970 CATCCTGTTGGCCCTCATTGAGG - Exonic
1191639555 X:63415395-63415417 AGTCCTGGTGGGACTCTGGGTGG - Intergenic
1192038505 X:67591578-67591600 AGCCCTGTTGGGCCTTATTGGGG - Intronic
1193717670 X:84951146-84951168 AGTCCTGGTGGGACTCTGGGTGG - Intergenic
1194519447 X:94901072-94901094 TGTCCTTGTGGGTTTCATTGTGG + Intergenic
1199617866 X:149671947-149671969 AGTTCTGGTGGGTCACATCGTGG + Intergenic
1199624776 X:149731302-149731324 AGTTCTGGTGGGTCACATCGTGG - Intergenic