ID: 922740823

View in Genome Browser
Species Human (GRCh38)
Location 1:228013442-228013464
Sequence ACGCACTTGCCAGTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922740823_922740831 11 Left 922740823 1:228013442-228013464 CCCAGGGAAACTGGCAAGTGCGT 0: 1
1: 0
2: 1
3: 9
4: 90
Right 922740831 1:228013476-228013498 CAGGAGCCGCTGTGCCTGCTGGG 0: 1
1: 0
2: 4
3: 40
4: 550
922740823_922740828 -8 Left 922740823 1:228013442-228013464 CCCAGGGAAACTGGCAAGTGCGT 0: 1
1: 0
2: 1
3: 9
4: 90
Right 922740828 1:228013457-228013479 AAGTGCGTGGCCGCGGGCACAGG 0: 1
1: 0
2: 0
3: 4
4: 83
922740823_922740830 10 Left 922740823 1:228013442-228013464 CCCAGGGAAACTGGCAAGTGCGT 0: 1
1: 0
2: 1
3: 9
4: 90
Right 922740830 1:228013475-228013497 ACAGGAGCCGCTGTGCCTGCTGG 0: 1
1: 0
2: 2
3: 26
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922740823 Original CRISPR ACGCACTTGCCAGTTTCCCT GGG (reversed) Intronic
901153106 1:7117497-7117519 TAGCACTTACCAGTTTCCATGGG + Intronic
901181200 1:7342885-7342907 AGGCATTTTCCACTTTCCCTGGG + Intronic
902458366 1:16552821-16552843 AAGCACTTGCCAGCTTCAGTGGG - Intergenic
902475899 1:16687045-16687067 AAGCACTTGCCAGCTTCAATGGG - Intergenic
902493795 1:16855095-16855117 AAGCACTTGCCAGCTTCAGTGGG + Intronic
903151549 1:21413580-21413602 AAGCACTTGCCAGCTTCAATGGG - Intergenic
906095571 1:43221738-43221760 ACGTACTTGCCAGGTGCTCTGGG + Intronic
907771846 1:57473298-57473320 ACCCACCTTCCAGTTGCCCTGGG + Intronic
910326694 1:86016953-86016975 ATGCACTTTTCTGTTTCCCTAGG + Intronic
913612156 1:120518931-120518953 AAGCACTTGCCAGCTTCAATGGG - Intergenic
914579033 1:149003307-149003329 AAGCACTTGCCAGCTTCAATGGG + Intronic
914676608 1:149911153-149911175 ACTCGCTTGCCTGTTTCCCATGG - Intronic
916177861 1:162057569-162057591 AAGAACTTGACACTTTCCCTAGG + Intergenic
919641705 1:200051611-200051633 ACCCACTTCACAGTTTGCCTTGG + Intronic
922740823 1:228013442-228013464 ACGCACTTGCCAGTTTCCCTGGG - Intronic
923916080 1:238506366-238506388 ATGCATTTGCCAGTTTCCCTTGG - Intergenic
1063437693 10:6048017-6048039 ACGCACTTGTCAGGCTGCCTGGG - Intronic
1064653295 10:17531364-17531386 ACACACTTACCTGTTTCCCTTGG - Intergenic
1065563216 10:26984181-26984203 TAGCAATTGCCAGTATCCCTAGG + Intergenic
1066412142 10:35182284-35182306 AAACAATTGCCAGTTTCCTTTGG + Intronic
1067301629 10:45015910-45015932 ACCCCCTTTCCTGTTTCCCTAGG - Intergenic
1072314404 10:94188000-94188022 ACCCACTTGCCCCCTTCCCTAGG + Intronic
1072732077 10:97852975-97852997 AGGCACTTCCCAGTTGTCCTTGG - Intronic
1075048730 10:119166100-119166122 CCGCATTTGACATTTTCCCTGGG - Intergenic
1077454524 11:2670544-2670566 AGGGACTTGCCAGTATCACTGGG + Intronic
1078739364 11:14052195-14052217 TTTCTCTTGCCAGTTTCCCTGGG - Intronic
1084081888 11:66832691-66832713 ATACTCTTGCCAGTTTCCCTCGG + Intronic
1091334942 11:134759350-134759372 ACACACCTGCCAGTTTCTCACGG - Intergenic
1098350489 12:69554069-69554091 ATGCTCCTGGCAGTTTCCCTTGG + Intronic
1106539001 13:30673732-30673754 GCACACGTGCAAGTTTCCCTTGG + Intergenic
1115100782 14:29695799-29695821 TAGCACTTTCCAGTTTGCCTTGG - Intronic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1117868351 14:60172567-60172589 ACGCCCTGGACAGTTGCCCTTGG + Intergenic
1128020441 15:64385715-64385737 ACTCACATGCCAGTCTCCTTTGG - Intronic
1128089889 15:64912127-64912149 ACGCACTGGCAAGGTCCCCTCGG - Intronic
1129151344 15:73689896-73689918 ACTCACTTGCCAGGCTCCCTAGG - Intronic
1129516156 15:76158995-76159017 AGGCACTGGGCACTTTCCCTTGG + Intronic
1146926013 17:36745964-36745986 ACGCTCTTGCCTGTCTGCCTGGG - Intergenic
1151490120 17:74427803-74427825 AGGGACTTCCCAGTTTGCCTGGG - Intronic
1151521895 17:74636209-74636231 ACGCACTTCCAAGTTGCCTTTGG - Intergenic
1156920741 18:42519511-42519533 CTGGACTTGCCAGTTTTCCTGGG + Intergenic
1159849133 18:73505420-73505442 TAGCACTTGCCAGTTTGCCTGGG - Intergenic
1166864425 19:45827399-45827421 ACTCCCTTGCAAGTTTCTCTGGG - Intronic
1202709912 1_KI270714v1_random:12899-12921 AAGCACTTGCCAGCTTCAATGGG - Intergenic
926808481 2:16735198-16735220 GCTCACTTGCCGGTTTCCATAGG - Intergenic
928270093 2:29848090-29848112 ACGCAGCTGCCAGGGTCCCTGGG + Intronic
933186936 2:79289402-79289424 ATTCACTTTCCAGTTTCCCATGG + Intronic
933883980 2:86700590-86700612 ACTCTTTTGCCAGTTTCCCTTGG - Intronic
936754365 2:115687983-115688005 ACTCACTTGGCAGTTTGCTTTGG + Intronic
945867031 2:215187979-215188001 ACTCCCTTTCCAGTTTCTCTTGG - Intergenic
948117791 2:235506373-235506395 AGGCACTTGCCACTGTGCCTAGG - Intronic
948947641 2:241229165-241229187 TCCCTCCTGCCAGTTTCCCTTGG - Exonic
1169550695 20:6698379-6698401 TCCCACTTGCCTTTTTCCCTAGG - Intergenic
1170359043 20:15524331-15524353 ACTAACTTGCTAGTGTCCCTTGG + Intronic
1180124262 21:45778466-45778488 TCGCCCATGCCAGTTTCCCAGGG - Intronic
1182037740 22:27212771-27212793 CCACACTTGGCAGCTTCCCTTGG + Intergenic
950872739 3:16243473-16243495 TGGCACTGGCCAGCTTCCCTTGG + Intergenic
962720129 3:138165928-138165950 TCTCACTTCCCAGTTTCACTGGG - Intronic
966564924 3:181367551-181367573 ATGCACTTACTAGTTTACCTAGG - Intergenic
967113821 3:186318857-186318879 ACCCCCATACCAGTTTCCCTTGG + Intronic
970849347 4:20582755-20582777 AAGCACTTGACAGTTTCTCTTGG + Intronic
972302248 4:37795797-37795819 ACGCTCTTCCCAGTTGCACTGGG + Intergenic
975728921 4:77319107-77319129 AAACATTTACCAGTTTCCCTAGG - Intronic
976530607 4:86148301-86148323 ACATGCTTGCCATTTTCCCTGGG - Intronic
994139799 5:96329516-96329538 CCCCACTGCCCAGTTTCCCTGGG + Intergenic
995515246 5:112948139-112948161 ACACACATGCAAGTTTCTCTAGG - Intergenic
996492163 5:124110708-124110730 ACCCACTTTCCAGTTGCCTTAGG + Intergenic
997812731 5:136988016-136988038 AGTCACTTGTCAGTTTCTCTAGG - Intronic
999443692 5:151621962-151621984 ACGCACTTGTTTGTTTCCCTGGG + Intergenic
1000416052 5:160984853-160984875 ATGCACTGGGCAGTCTCCCTGGG + Intergenic
1003258201 6:4492174-4492196 ACGCACCAGCCAGTTTCCATGGG - Intergenic
1006628583 6:35414965-35414987 ACCCACTTGCCAGGGTCCCCTGG + Intronic
1009430811 6:63563753-63563775 ACTCACTTTCCACTTTCCTTGGG - Intronic
1014281971 6:119451415-119451437 AGGAACTTGGCAGTTTCACTGGG - Intergenic
1017959853 6:159212103-159212125 ACCCACTTGGCAGGTCCCCTGGG - Intronic
1018001974 6:159587476-159587498 GCGCACTTGCCAGTGTGGCTCGG + Intergenic
1018467107 6:164057999-164058021 ACTTACTTGCCCGTTTACCTTGG + Intergenic
1019144745 6:169969535-169969557 ACGCCCTGGCCAGGTGCCCTTGG - Intergenic
1023335043 7:39160052-39160074 TCGTACTTCCCAGTCTCCCTTGG - Intronic
1026428122 7:70316857-70316879 GCACACTTGCTCGTTTCCCTGGG + Intronic
1026449068 7:70511457-70511479 TCACACATCCCAGTTTCCCTGGG + Intronic
1036739010 8:11345337-11345359 AAGCCCTTGGCAGTGTCCCTGGG + Intergenic
1038819433 8:30938800-30938822 ACTCCCTTGCCAGTTTCTCCTGG - Intergenic
1039690305 8:39857437-39857459 AAGTAGTTTCCAGTTTCCCTTGG - Intergenic
1040296500 8:46151719-46151741 ACTCACTTGCCAGAAGCCCTGGG - Intergenic
1043246929 8:78015285-78015307 ACTCACATGCCAATTTCCCCTGG + Intergenic
1043788064 8:84427154-84427176 ACACACTTGCTAGTTTCCATTGG - Intronic
1048255732 8:132903780-132903802 ACTCACTTGCCAGGTGACCTTGG + Intronic
1052316560 9:27121990-27122012 ACCCACTTTCCAGGTTTCCTGGG - Intronic
1052823581 9:33159068-33159090 ACGCAAATACCAGCTTCCCTAGG + Intronic
1053270203 9:36744484-36744506 GAGCACTTGCCAGGTTCCCGCGG - Intergenic
1053588520 9:39485773-39485795 AAGGACTTGTCAGTTTCCTTAGG - Intergenic
1054577786 9:66879521-66879543 AAGGACTTGTCAGTTTCCTTAGG + Intronic
1185947926 X:4398590-4398612 AGGCACATCCCAGTTTCACTAGG + Intergenic
1187565803 X:20448449-20448471 CCTCACTTGACAGTTTCTCTTGG + Intergenic
1187857616 X:23652289-23652311 ACACATTTGCCAGACTCCCTTGG + Intergenic
1189064757 X:37795448-37795470 ACTCTCTTACCAGTTTCTCTTGG + Intronic
1189237038 X:39495076-39495098 ACTCCCTTACCAGTTTCCCCTGG - Intergenic
1194201389 X:90957389-90957411 ACTCACTTGCCATTTCCCCATGG - Intergenic
1198450261 X:136760191-136760213 AGGCACTTGCCAGTTTCTTAGGG - Intronic
1198806494 X:140500371-140500393 ATGGACTAGCCATTTTCCCTCGG + Intergenic