ID: 922740932

View in Genome Browser
Species Human (GRCh38)
Location 1:228013911-228013933
Sequence TGCTCCAGAGGCCCCACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922740926_922740932 16 Left 922740926 1:228013872-228013894 CCCTGATCTTAAGAAGACAAAGA 0: 1
1: 0
2: 6
3: 22
4: 324
Right 922740932 1:228013911-228013933 TGCTCCAGAGGCCCCACAGAGGG No data
922740927_922740932 15 Left 922740927 1:228013873-228013895 CCTGATCTTAAGAAGACAAAGAT 0: 1
1: 0
2: 3
3: 32
4: 269
Right 922740932 1:228013911-228013933 TGCTCCAGAGGCCCCACAGAGGG No data
922740924_922740932 28 Left 922740924 1:228013860-228013882 CCCATGGAGTGGCCCTGATCTTA 0: 1
1: 0
2: 0
3: 5
4: 124
Right 922740932 1:228013911-228013933 TGCTCCAGAGGCCCCACAGAGGG No data
922740925_922740932 27 Left 922740925 1:228013861-228013883 CCATGGAGTGGCCCTGATCTTAA 0: 1
1: 0
2: 0
3: 3
4: 93
Right 922740932 1:228013911-228013933 TGCTCCAGAGGCCCCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922740932 Original CRISPR TGCTCCAGAGGCCCCACAGA GGG Intronic