ID: 922745909

View in Genome Browser
Species Human (GRCh38)
Location 1:228043684-228043706
Sequence CTGTAAACAGAGGTGACTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922745896_922745909 28 Left 922745896 1:228043633-228043655 CCAGAGCCTGGACGTAAGTCCTG 0: 1
1: 0
2: 0
3: 8
4: 79
Right 922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 216
922745905_922745909 -8 Left 922745905 1:228043669-228043691 CCTGAGTCAGCTCCTCTGTAAAC 0: 1
1: 0
2: 3
3: 26
4: 302
Right 922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 216
922745902_922745909 9 Left 922745902 1:228043652-228043674 CCTGGCCTCAGGGGAGCCCTGAG 0: 1
1: 0
2: 8
3: 47
4: 528
Right 922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 216
922745903_922745909 4 Left 922745903 1:228043657-228043679 CCTCAGGGGAGCCCTGAGTCAGC 0: 1
1: 0
2: 2
3: 28
4: 273
Right 922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 216
922745904_922745909 -7 Left 922745904 1:228043668-228043690 CCCTGAGTCAGCTCCTCTGTAAA 0: 1
1: 0
2: 1
3: 13
4: 224
Right 922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 216
922745898_922745909 22 Left 922745898 1:228043639-228043661 CCTGGACGTAAGTCCTGGCCTCA 0: 1
1: 0
2: 2
3: 12
4: 189
Right 922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG 0: 1
1: 0
2: 1
3: 10
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922745909 Original CRISPR CTGTAAACAGAGGTGACTCT GGG Intronic
901213816 1:7542216-7542238 ATGTAAACAGAGGTTATTTTTGG - Intronic
903102246 1:21040825-21040847 CTGTAAAAACAGCTGAGTCTTGG + Intronic
904441870 1:30537090-30537112 CTGTAACAACAGGTGAGTCTTGG + Intergenic
905052692 1:35065556-35065578 CTTTAAATACAGTTGACTCTTGG - Intronic
905244467 1:36602997-36603019 CTGCCATCAGAGGTGACTCGAGG + Intergenic
907191432 1:52652170-52652192 CCTTGAACAGAGGAGACTCTGGG + Intronic
909607197 1:77519436-77519458 CTGTGAAAAGAGGAGACTTTAGG - Intronic
915178793 1:154040526-154040548 CTACAAACAGAGGTTACTTTAGG - Intronic
915841424 1:159216334-159216356 CTGGAAAGAAAGGTGACTGTGGG + Intergenic
917591097 1:176477884-176477906 CTTGAGACAGAGGTGAGTCTGGG - Intronic
918897990 1:190372549-190372571 CTGTAACAAGAGGTGACTGCAGG + Intronic
920220809 1:204399109-204399131 CTGATAAGAGAGGTGACTTTGGG + Intergenic
920581739 1:207115317-207115339 CTGGAAGCAGAGGTGAACCTTGG + Intronic
921712494 1:218387065-218387087 TTCTAAAAAGAGGTGACACTAGG + Intronic
922214759 1:223511255-223511277 CTGTGAACAGAGGAAGCTCTGGG - Intergenic
922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG + Intronic
923307678 1:232703045-232703067 CTATATTCAGTGGTGACTCTGGG - Intergenic
923433774 1:233949517-233949539 CTGGAAACAGAACTGACTTTTGG - Intronic
923605807 1:235441418-235441440 CTGTTACCAAAGGTGACACTCGG + Intronic
924041271 1:239985992-239986014 CAGAAAACAGAGGAGACCCTGGG - Intergenic
1067056163 10:43052723-43052745 ATGTGAACAGTGGTGAATCTGGG - Intergenic
1071456726 10:85856945-85856967 CTAGCAACAGAGGTGACTGTAGG + Intronic
1073658484 10:105445400-105445422 TGGTAAACAGAAGTGACTATAGG + Intergenic
1076111849 10:127865729-127865751 TTGTTAACACAGGTGCCTCTGGG - Intergenic
1077772399 11:5234266-5234288 GTGTAGACAGAGAAGACTCTTGG - Intronic
1078643140 11:13114465-13114487 CAGAAGACTGAGGTGACTCTGGG - Intergenic
1078798843 11:14622766-14622788 CTGCAAACAGAGCTGCCACTTGG + Intronic
1079353302 11:19711689-19711711 TTATAAACAGAGATGACTTTGGG + Intronic
1080277418 11:30518303-30518325 AGATAAACAGAGGTGGCTCTAGG - Intronic
1082837978 11:57665679-57665701 TTGTAAATAGTGGTGTCTCTTGG - Intergenic
1083736216 11:64682812-64682834 CTGTGACCAGAGGTGTCTCTTGG - Intronic
1084144584 11:67257652-67257674 CTTTAAACATAAGTGACTTTAGG - Exonic
1084595767 11:70116185-70116207 CTCGACACAGAGGGGACTCTAGG - Intronic
1084910608 11:72385158-72385180 CTATAAACAGTAGTTACTCTTGG - Intronic
1086279074 11:85164621-85164643 CTTTCAACAGAATTGACTCTGGG - Intronic
1094457262 12:30650439-30650461 ATGTAAATACAGTTGACTCTTGG - Intronic
1097095406 12:56543651-56543673 CAAAAAAAAGAGGTGACTCTAGG - Intronic
1097332845 12:58351127-58351149 GTGAAAGCAGAGGTGATTCTTGG + Intergenic
1098636786 12:72793715-72793737 AAGAAAACAGAGATGACTCTAGG - Intergenic
1098795667 12:74885996-74886018 CAGTAAAAGGAGGTGACTATAGG + Intergenic
1099166869 12:79317628-79317650 CTGTTGTCAGAGGTGACTGTCGG + Intronic
1103586939 12:121963101-121963123 CTGTACAGAGAGCAGACTCTGGG + Intronic
1103599339 12:122044166-122044188 CAGTAAAGAGAGGTGACACCTGG + Intronic
1103626095 12:122221204-122221226 CTTTAAATAGAGGTGAGACTTGG + Intronic
1104370917 12:128223218-128223240 CTGTAGAAAAAGGTGATTCTGGG - Intergenic
1107993471 13:45838731-45838753 CTGTTTAATGAGGTGACTCTGGG + Intronic
1111735325 13:92131652-92131674 ATGTAAACAGAGGTCAGTATAGG + Intronic
1112391107 13:98985154-98985176 CTGGAAACAGAGGTTTCTTTAGG - Intronic
1113094451 13:106649190-106649212 CTGTACACAAACGTGGCTCTTGG - Intergenic
1113247220 13:108411092-108411114 CTGTAAATACAGATGACCCTTGG + Intergenic
1115429878 14:33304175-33304197 CTGTTAACAGATTTAACTCTTGG + Intronic
1119632808 14:76248741-76248763 CTGGAAGCAGAGAGGACTCTGGG + Intronic
1119990865 14:79195718-79195740 ATGAAAACAGAAGTGATTCTAGG + Intronic
1122800696 14:104228147-104228169 CTGGAGACTAAGGTGACTCTAGG + Intergenic
1123919251 15:25059015-25059037 ATGGAAACAGAGGTCACTCATGG + Intergenic
1125297332 15:38217527-38217549 CTGTAAACTCAAGTGGCTCTGGG - Intergenic
1126751258 15:51878905-51878927 CAAGAAACAGAGGTGGCTCTTGG - Intronic
1127147360 15:56038067-56038089 CTGTAACAAGAGCTGAGTCTTGG + Intergenic
1127843249 15:62847943-62847965 CAGCAAACATAGGTGCCTCTAGG - Intergenic
1127873697 15:63094170-63094192 ATGTAAACAGAGATGATTGTAGG - Intergenic
1128148560 15:65346757-65346779 CTGTTAAAAGAGCTGAGTCTCGG - Intronic
1128612531 15:69085356-69085378 GTGTAAACAGAGGTCACACAGGG + Intergenic
1129031631 15:72622656-72622678 CAGTAAACCGAGGACACTCTAGG + Intergenic
1129537993 15:76329860-76329882 CTGGAGCCAGAGGTGACTATGGG - Intergenic
1130803613 15:87293650-87293672 CTGTAACCATAGCTGAGTCTTGG - Intergenic
1131991859 15:98100618-98100640 TTGTAATCAGATTTGACTCTAGG - Intergenic
1132099052 15:99009795-99009817 TTGTAATCAGATTTGACTCTAGG + Intergenic
1133078285 16:3296263-3296285 TTGAAAACTGGGGTGACTCTCGG + Intronic
1133166136 16:3948994-3949016 ATGGAAACAGAGGTGACCCTTGG + Intergenic
1133562514 16:6963107-6963129 CTGCACCCAGAGGTGAATCTCGG - Intronic
1133861434 16:9599029-9599051 CAGTAACCAGCTGTGACTCTGGG - Intergenic
1133920189 16:10145962-10145984 CTCTAAAGAGAGGAGACTCAGGG - Intronic
1135112250 16:19699417-19699439 CTGTGGACAGTGCTGACTCTGGG - Intronic
1137372195 16:47917966-47917988 CTGGAAACAGAGATAACTCAAGG + Intergenic
1137636050 16:49987331-49987353 CTGTAAACAAAGTATACTCTCGG - Intergenic
1138517260 16:57543021-57543043 CTGTAAAATGGGGTGAGTCTGGG + Exonic
1141359323 16:83380724-83380746 CTGTAAGCAGAGGTAATTTTGGG - Intronic
1141614716 16:85203580-85203602 CTGTAGAGTGGGGTGACTCTAGG - Intergenic
1141894932 16:86953300-86953322 CTGCAAACAGAAGTCACTCCAGG - Intergenic
1142931635 17:3290058-3290080 CTCTAAACAGAGGTGCTCCTAGG - Intergenic
1143948167 17:10612387-10612409 CTGTAAACAGTGCTTACTTTAGG + Intergenic
1145302161 17:21648280-21648302 CGTTAAGCAGAGGTGGCTCTGGG + Intergenic
1145328502 17:21851063-21851085 CATTAAGCAGAGGTGGCTCTGGG + Intergenic
1145348152 17:22055036-22055058 CGTTAAGCAGAGGTGGCTCTGGG - Intergenic
1146444844 17:32925492-32925514 CTGTAAAAATAGCTGAGTCTTGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146660033 17:34659468-34659490 CTGTAAAATAAGGTGACTCAAGG + Intergenic
1146956934 17:36941383-36941405 CTGGAAGCAGAGCTGACTCCCGG - Intronic
1150061975 17:62076284-62076306 CTGTAAAGAGGGGAGACTTTTGG - Intergenic
1151677008 17:75603761-75603783 CTGGGAACAGAGCTGCCTCTGGG - Intergenic
1151775868 17:76201579-76201601 CTGTTAACAATGGTAACTCTTGG - Intronic
1203193092 17_KI270729v1_random:207241-207263 CATTAAGCAGAGGTGGCTCTGGG + Intergenic
1203202456 17_KI270730v1_random:6676-6698 CATTAAGCAGAGGTGGCTCTGGG + Intergenic
1153929378 18:9865324-9865346 CTGTGACCAGAGGTGACAGTGGG - Intergenic
1154240340 18:12647853-12647875 CTGGAAATATGGGTGACTCTAGG + Intronic
1154345851 18:13542996-13543018 CTGTAAAAAGATGGGACTATGGG - Intronic
1156897252 18:42259791-42259813 CTTTAAACAAAAATGACTCTTGG + Intergenic
1157964816 18:52195952-52195974 CTGTAAACTGATGATACTCTTGG - Intergenic
1158001609 18:52625989-52626011 CTGTAAACAGAGCTGGCTCTGGG + Intronic
1158576178 18:58640480-58640502 CTTTTAACAAAGGAGACTCTGGG - Intergenic
1158758867 18:60360234-60360256 CAGTAAACAGAGGTGAGTTGTGG - Intergenic
1160153352 18:76412348-76412370 CTGAAAACAGCCCTGACTCTGGG + Intronic
1160164597 18:76499071-76499093 GTGTAAACACGGGAGACTCTGGG - Intergenic
1162283873 19:9723228-9723250 CTGGGAACAGAGAAGACTCTTGG + Intergenic
1162532665 19:11244916-11244938 GTGTAAATAGAGGCCACTCTGGG + Intronic
1163020570 19:14479009-14479031 CTGTTAGCTGAGGGGACTCTGGG - Intronic
1163889748 19:20000253-20000275 CTGGATACAGAGTTGTCTCTAGG - Intronic
1165282120 19:34806555-34806577 TTGCAAACAGAGGGGACTGTGGG - Intergenic
1167781202 19:51600539-51600561 CTGTAGACACAAGTGTCTCTGGG - Intergenic
1167856179 19:52242260-52242282 CTGCATACAGAGGTGTGTCTTGG + Intergenic
1167858562 19:52264128-52264150 CTGCATACAGAGGTGTGTCTTGG - Intergenic
926545803 2:14238313-14238335 CTTTTAACAAAGGTAACTCTGGG + Intergenic
927822028 2:26275467-26275489 CTTTAAATAGAGGTGGCTATTGG - Intronic
928503439 2:31923008-31923030 CTTAAAACAGAAGTAACTCTGGG - Intronic
928978572 2:37115381-37115403 CTGACACCAGAGGTGGCTCTGGG + Intronic
930690428 2:54357502-54357524 CTGGTAACAGTGGTGACTGTAGG - Intronic
932441125 2:71736307-71736329 CTGTGAACTGAGGTCACTCATGG + Intergenic
935965445 2:108468456-108468478 GTGTTAAAAGAGCTGACTCTTGG + Intronic
938094093 2:128450471-128450493 CTGTAAAACGGGGTGACACTGGG - Intergenic
938846020 2:135210052-135210074 CTGCCAACAGAGGTAACTTTTGG - Intronic
939771050 2:146318837-146318859 ATATAACCAGAGGTGGCTCTTGG - Intergenic
940439224 2:153694273-153694295 CCGTATGCATAGGTGACTCTAGG + Intergenic
941698287 2:168576653-168576675 ATGTTAACAGTGGTGAATCTGGG - Intronic
942232004 2:173869039-173869061 ATGTAAACTGAAGTGACTGTGGG - Intergenic
944645729 2:201779764-201779786 ATGTAAATGGATGTGACTCTGGG + Intronic
945370947 2:209017037-209017059 CTGTTAGCAGAGGTGACATTAGG - Intergenic
946153354 2:217790828-217790850 CTGTAGACAGAGGAGAGTCGTGG - Intergenic
946184738 2:217973813-217973835 GTGTAGACAGAGGTGACTAAGGG + Intronic
946577647 2:221093705-221093727 CTGGAAACAGAGTTGTCTCTGGG - Intergenic
948428235 2:237902028-237902050 CTGTGAACACATGTGACTCAGGG - Intronic
1168797862 20:623480-623502 CTGTAAACAGAGATGCTTCAAGG + Intergenic
1168969737 20:1922808-1922830 CTCTTACCAGTGGTGACTCTTGG - Intronic
1170831227 20:19842535-19842557 CTGTAAACAGATGTGTGGCTGGG - Intergenic
1171518748 20:25759707-25759729 CGTTAAGCAGAGGTGGCTCTGGG + Intergenic
1171558105 20:26096503-26096525 CGTTAAGCAGAGGTGGCTCTGGG - Intergenic
1173282192 20:41638844-41638866 CTGGAGGCAGAGGGGACTCTAGG - Intergenic
1173664163 20:44753329-44753351 CTGAACACACAGGTGACTCCAGG + Intronic
1173877094 20:46380066-46380088 CTGTGAGCAGAGTTGCCTCTAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175417767 20:58812865-58812887 TTGTAATTAGAGGTGAATCTGGG - Intergenic
1176652894 21:9566112-9566134 CGTTAAGCAGAGGTGGCTCTGGG + Intergenic
1178849506 21:36201235-36201257 CTGTAAATGGAGGTAACTCCTGG - Intronic
1185120389 22:48962861-48962883 CTGTAATGAGAGGACACTCTGGG - Intergenic
1185249787 22:49794704-49794726 CTGCAAACAGAGGTGACGACTGG + Intronic
949559642 3:5189093-5189115 ATGTCAACAGTGGTGACCCTTGG - Intronic
950399265 3:12758446-12758468 CTCTGAGCAGAGGTGGCTCTAGG + Intronic
950419149 3:12886735-12886757 CAGTTAGCAGAGGTGACACTGGG + Intergenic
950502451 3:13373003-13373025 CTTTAGATAGAGGTGGCTCTGGG + Intronic
951030043 3:17871232-17871254 CTGTAAACAGAGGGTACACATGG - Intronic
951919524 3:27839058-27839080 GTTTAAACAGAGGAGACTCCAGG + Intergenic
952216068 3:31279022-31279044 CTGTGAACAAAGTAGACTCTAGG - Intergenic
952997789 3:38902080-38902102 CTGTCCACAGAGATGACTCTGGG + Intronic
953269098 3:41423204-41423226 ATGTAAACAGGGGTTACACTGGG + Intronic
954414554 3:50386792-50386814 CTGTTTACAGAGGGGACTGTTGG + Intronic
955121146 3:56059530-56059552 CTGAAAACTGAGGTGTCTTTGGG + Intronic
955480070 3:59380983-59381005 CTGTAAACAGAGTTTACAGTAGG - Intergenic
955614695 3:60794119-60794141 CTGTAAACAAAGGTTACCTTTGG - Intronic
955638266 3:61053900-61053922 CAATAAGCAGAGGTGACTGTGGG + Intronic
955914349 3:63891723-63891745 ATGTAAATATAGGTGACTATTGG + Intronic
957564245 3:81864561-81864583 CAGAAAACAGACCTGACTCTGGG - Intergenic
957604506 3:82379754-82379776 CTGTAAGAAGAGCTGAGTCTTGG - Intergenic
958911651 3:100000750-100000772 CTGTAAACAGTGGCTACTCCTGG - Intronic
961615634 3:128177613-128177635 CTCTAAACAGAGGTGCGTTTTGG - Intronic
961626545 3:128268069-128268091 CTGGAAACAGAAGTGAGGCTAGG + Intronic
964438643 3:156679748-156679770 CTGTGAACAAAGATGACTCAAGG - Intronic
965328434 3:167337623-167337645 CTGTTAACAGTAGTTACTCTGGG - Intronic
967325367 3:188233368-188233390 CTGTAAATGGAAGTGTCTCTGGG + Intronic
968495507 4:913231-913253 CTGTAAATAGGGGTCACTGTGGG - Intronic
969071473 4:4542521-4542543 CTTTAAAAAGAGGTGACTGAAGG - Intergenic
969620076 4:8274395-8274417 CTGCACACAGATGTGACTGTGGG + Intronic
970692124 4:18631797-18631819 ATCTAAAAAGATGTGACTCTTGG - Intergenic
975414058 4:74087687-74087709 CTGCAAACAGTGGTATCTCTTGG + Intergenic
978885165 4:113760590-113760612 CTGTAAATAGAGATGCCTCCTGG - Intronic
979117504 4:116845264-116845286 CTGTAGACAGTTGTGATTCTAGG + Intergenic
979535001 4:121809504-121809526 CAGTAACCACAGGTGACTATTGG + Intronic
979844740 4:125493488-125493510 CTGAAAACAGAGGTTTGTCTTGG - Intergenic
981339808 4:143608349-143608371 CTCAGAACTGAGGTGACTCTGGG - Intronic
986373225 5:7101974-7101996 CTTTAGAGAGAGGTGACTTTGGG + Intergenic
990690435 5:58357859-58357881 TTGTGAACAGACATGACTCTTGG + Intergenic
998409169 5:141895495-141895517 GTAGAAACAGAGGTGACTGTAGG + Intergenic
1002066314 5:176653687-176653709 CTGGATCCAGAGCTGACTCTTGG - Intronic
1002336991 5:178486610-178486632 GTGAAAGCAGAGGTGACTCTTGG + Intronic
1002347112 5:178555797-178555819 CTGTGAACAGTAGTGACTCGGGG - Intronic
1003159972 6:3626224-3626246 CTGGAAGCAGAGGGGTCTCTAGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005293949 6:24405701-24405723 ATGTTAACAAAGGTGACTCTAGG + Intronic
1007636869 6:43304957-43304979 CTGTAAATAAAGGTGCCCCTTGG + Exonic
1008034479 6:46731987-46732009 CTTTATAAAGAGATGACTCTGGG - Intronic
1010436042 6:75832200-75832222 ATGTAAACAGAGGCAAATCTAGG + Intronic
1011455695 6:87546294-87546316 CTCTAACCACAGGAGACTCTGGG - Intronic
1012695852 6:102382993-102383015 CTGAAAGCAGAAGTGACTCTGGG - Intergenic
1012871962 6:104683277-104683299 CTGTAACCACTGGTAACTCTGGG + Intergenic
1015898138 6:138036483-138036505 CTGGAGACAGAGGGGACTCCAGG + Intergenic
1017063806 6:150509984-150510006 ACCTAAGCAGAGGTGACTCTTGG + Intergenic
1022389270 7:29929202-29929224 ATGTGAACCGAGCTGACTCTGGG - Intronic
1026682496 7:72477840-72477862 ATGGACACAAAGGTGACTCTTGG - Intergenic
1028416224 7:90583286-90583308 ATGGATACAGAGGTGTCTCTAGG - Intronic
1030527960 7:110675859-110675881 GTGTAAACCAAGGTGGCTCTAGG + Intronic
1032443130 7:131957662-131957684 CTGTAAAAGGAGGGGACTGTAGG + Intergenic
1032742681 7:134754541-134754563 CTGTTAACAGAGGTACCTCTGGG - Intronic
1034281723 7:149859318-149859340 AAGTACACAGAGGTGTCTCTGGG - Intronic
1036943567 8:13073418-13073440 CTGTAATCCCAGGTGACACTCGG + Intergenic
1040609543 8:48969131-48969153 CTGTAAACAGTGGATACTGTAGG - Intergenic
1043082370 8:75783187-75783209 CTTTAAACAGAGGTTACTATGGG + Intergenic
1043913590 8:85894003-85894025 GTGTAAACATTGGTGAGTCTAGG + Intergenic
1044220643 8:89665095-89665117 ATGAAAACAGAAGAGACTCTGGG - Intergenic
1044953865 8:97459656-97459678 CTGTACGCAGACGGGACTCTGGG + Intergenic
1045014869 8:97992247-97992269 ATGTTAACAAAGGTGAATCTGGG + Intronic
1045044169 8:98258622-98258644 CTGTAAAAATAGGTGAGTCTTGG + Intronic
1046098798 8:109591322-109591344 CTGTTAATAGCGGTGTCTCTTGG + Intronic
1046631728 8:116628577-116628599 CGATGAACAGAGGTGAGTCTAGG - Intergenic
1048366633 8:133744183-133744205 GTGGAAACAGAAGAGACTCTGGG - Intergenic
1048954538 8:139525050-139525072 CAGTACACAGCAGTGACTCTGGG + Intergenic
1050548724 9:6730884-6730906 CTGTAACAAGAGCTGAGTCTTGG - Intronic
1052349878 9:27447674-27447696 CCCTAAACAGAGGTATCTCTTGG + Intronic
1052491344 9:29173220-29173242 ATGTCAACTGAGTTGACTCTTGG - Intergenic
1054779722 9:69155344-69155366 CTGTAAACCGAGGAGCCCCTAGG - Intronic
1059343704 9:113613975-113613997 CTGTAATCAGAGGCCATTCTTGG - Intergenic
1059452827 9:114381398-114381420 CAGGAACCAGCGGTGACTCTGGG - Exonic
1060325498 9:122610650-122610672 TTGTAAATAGAGGAGACACTGGG - Intergenic
1061036964 9:128119269-128119291 CTGGACACAGTGGTGGCTCTGGG + Intergenic
1061087451 9:128407481-128407503 CTGTGAACAGAGGTGGGCCTGGG - Intergenic
1203630621 Un_KI270750v1:69653-69675 CGTTAAGCAGAGGTGGCTCTGGG + Intergenic
1187121678 X:16413828-16413850 ATGTAAATACAGTTGACTCTTGG - Intergenic
1190039979 X:47063341-47063363 CTTCAAACAAAGGTGGCTCTAGG + Intergenic
1192423219 X:71052588-71052610 CTGTTAACAGCAGTTACTCTGGG + Intergenic
1198061589 X:133050988-133051010 CTATAAAATAAGGTGACTCTAGG + Intronic