ID: 922747556

View in Genome Browser
Species Human (GRCh38)
Location 1:228053313-228053335
Sequence TGATTTTTACAGATGGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1870
Summary {0: 1, 1: 2, 2: 18, 3: 242, 4: 1607}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922747556_922747560 0 Left 922747556 1:228053313-228053335 CCTCACACCATCTGTAAAAATCA 0: 1
1: 2
2: 18
3: 242
4: 1607
Right 922747560 1:228053336-228053358 ATTACAAATCCCAGTGGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 132
922747556_922747559 -5 Left 922747556 1:228053313-228053335 CCTCACACCATCTGTAAAAATCA 0: 1
1: 2
2: 18
3: 242
4: 1607
Right 922747559 1:228053331-228053353 AATCAATTACAAATCCCAGTGGG 0: 1
1: 0
2: 0
3: 18
4: 190
922747556_922747558 -6 Left 922747556 1:228053313-228053335 CCTCACACCATCTGTAAAAATCA 0: 1
1: 2
2: 18
3: 242
4: 1607
Right 922747558 1:228053330-228053352 AAATCAATTACAAATCCCAGTGG 0: 1
1: 0
2: 4
3: 23
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922747556 Original CRISPR TGATTTTTACAGATGGTGTG AGG (reversed) Intronic
901264098 1:7896282-7896304 TGATTTTTATGTTTGGTGTGAGG - Intergenic
902567811 1:17324787-17324809 TGATTTTTGTGTATGGTGTGAGG + Intronic
902687765 1:18089936-18089958 GGATTTTGCCAGAGGGTGTGGGG + Intergenic
902726973 1:18343610-18343632 TTATTTTTATATATGGTGTGAGG + Intronic
903398814 1:23023379-23023401 TAATTTTTGTATATGGTGTGAGG + Intronic
903588343 1:24435234-24435256 TAATTTTTATGCATGGTGTGAGG - Intronic
903597795 1:24509152-24509174 TTATTTTTTGAGATGGGGTGGGG - Intronic
903672370 1:25044197-25044219 TCATTTTTATAGATGGTGTGAGG - Intergenic
903880368 1:26504274-26504296 TGATAATTACTGAAGGTGTGTGG - Intergenic
903991851 1:27277346-27277368 TAATTTTTATGTATGGTGTGAGG + Intronic
904077148 1:27852106-27852128 TCATTTTTACAGACCCTGTGGGG - Intergenic
904292207 1:29494824-29494846 TTAGTTTTGTAGATGGTGTGAGG + Intergenic
904436194 1:30498369-30498391 TGATTTTTGTATAAGGTGTGAGG - Intergenic
904537828 1:31212276-31212298 TAATTTTTGTATATGGTGTGAGG - Intronic
905001440 1:34673114-34673136 TTATTTTTATATATGGTTTGAGG + Intergenic
905065067 1:35173372-35173394 TAATTTTTGTATATGGTGTGAGG + Intergenic
905327249 1:37163081-37163103 TGATTTTTGTATATGATGTGAGG + Intergenic
905718809 1:40177758-40177780 TAATTTTTATATACGGTGTGAGG + Intronic
905848176 1:41252047-41252069 TGATTTTCATATATGGTGTGAGG + Intergenic
906173603 1:43749178-43749200 TGATTTTTGTATATGGTGTGAGG - Intronic
906369190 1:45237768-45237790 TAATTTTTGTATATGGTGTGAGG - Intronic
906620873 1:47277449-47277471 TGGGCTTTAAAGATGGTGTGGGG + Intronic
906735676 1:48124591-48124613 TGATTTTCACATATGGTGAAAGG + Intergenic
906817680 1:48895786-48895808 TTAATTTTACAGTTGGGGTGTGG + Intronic
906851480 1:49254987-49255009 TGATTTTTGTAGATGGTGTAAGG - Intronic
906881088 1:49591912-49591934 TGATTTTTGTATATGGTGTAAGG - Intronic
907067881 1:51503925-51503947 TGATTTTTATATATGGTGTGAGG - Intronic
907141512 1:52189806-52189828 TAATTTTTGTATATGGTGTGAGG + Intronic
907493011 1:54821394-54821416 TGATTTTTATATATAGTGAGGGG + Intronic
907624519 1:56015801-56015823 TGATTTTTGTATATGGTGTAAGG - Intergenic
907821911 1:57978390-57978412 TGATTTTTATATAAGGTGTAAGG - Intronic
908306955 1:62828818-62828840 TGATTTTTATATATGGTGTAAGG + Intronic
908310016 1:62871550-62871572 TGATTTTTGTATATGGTGTGAGG + Intergenic
908344141 1:63214167-63214189 TAATTTTTGTATATGGTGTGAGG - Intergenic
908369034 1:63461634-63461656 TAATTTTTACATATGCTGTGAGG + Intronic
908369939 1:63471606-63471628 TGATTTTTGTGCATGGTGTGAGG + Intronic
908479328 1:64522122-64522144 TAATTTTTACATATGTTGTAAGG + Intronic
908507678 1:64821742-64821764 TGATTTTTGTATATGGTGTAAGG - Intronic
908603661 1:65769174-65769196 TCATTTTTGTATATGGTGTGAGG - Intergenic
908664216 1:66472059-66472081 TGATTTTTGCATATGGTGTAAGG + Intergenic
908666693 1:66500033-66500055 TGATTTTTACGTATCATGTGAGG - Intergenic
908701186 1:66902709-66902731 TTATTTTTGCAGATGGTATAAGG + Intronic
908818961 1:68063202-68063224 TGATTTTTGCATATGGTATAAGG - Intergenic
908947290 1:69514465-69514487 TGGTTTTTAAAGATGGTGTTTGG - Intergenic
909202853 1:72713951-72713973 TGATTTTTGTATATGGTGTAAGG + Intergenic
909346714 1:74597736-74597758 TGATTTTTTTATATGGTGTAAGG - Intronic
909558197 1:76979598-76979620 TGATTTTTGCATATCGTGAGAGG - Intronic
909619412 1:77651028-77651050 TAATTTTTGTATATGGTGTGAGG - Intronic
909621915 1:77677907-77677929 TGATTTTGAAAGCTGGTTTGAGG - Intronic
909745339 1:79088980-79089002 TGATCTTTATAGTTGGTTTGAGG + Intergenic
909806654 1:79881114-79881136 TGATTTTTTTATATGGTGTAAGG - Intergenic
909826492 1:80133713-80133735 TGATTTTTGTAGAAGGTGTAAGG + Intergenic
909845996 1:80395517-80395539 TGATTTTTGTAGAAGGTGTAAGG + Intergenic
909993853 1:82254884-82254906 TGATTTTTATATAAGGTGTAAGG - Intergenic
910064454 1:83136529-83136551 TGATTTTTGTATATGGTGTCAGG + Intergenic
910148170 1:84107310-84107332 TGATTTTTGCATATGGTATAAGG - Intronic
910374702 1:86555369-86555391 TGATTTTTATACATGGTGTAAGG + Intronic
910453991 1:87375870-87375892 TGATTTTTGTACATGGTGTAAGG + Intergenic
910456534 1:87403523-87403545 TGAATTGTGCAGAGGGTGTGAGG + Intergenic
910546170 1:88421699-88421721 TAATTTTTGCATATGGTGTTGGG - Intergenic
910995364 1:93098964-93098986 TGACATTTACAGATGGTGAGAGG + Intronic
911082572 1:93948063-93948085 TGATTTTTGCATATGGTGAGAGG + Intergenic
911479015 1:98412891-98412913 TGATTTTTGTATATGGTGTAAGG + Intergenic
911551736 1:99290767-99290789 TGATTTTTGTATATGGTGTAAGG - Intronic
911559816 1:99390683-99390705 TGATTTTTATATAAGGTGTAAGG - Intergenic
911576245 1:99581922-99581944 TGATTTTTGTACATGGTGTAAGG - Intergenic
911667761 1:100573272-100573294 TGATTTTTGTACATGGGGTGAGG - Intergenic
911699679 1:100937902-100937924 TAATTTTTATATATGGTGTGAGG + Intronic
911971977 1:104450922-104450944 TGATTTTTGTATATGGTGTAAGG + Intergenic
912016618 1:105045487-105045509 TGATTTTGGCATATGGTGAGAGG - Intergenic
912038233 1:105349719-105349741 TGATTTTTTTATATGGTGTAAGG - Intergenic
912125233 1:106528936-106528958 TGATTTTTGTATATGGTGTAAGG - Intergenic
912144639 1:106778155-106778177 TGATTTTTGTATATGGTGAGAGG - Intergenic
912256356 1:108062547-108062569 TGATTTTTATGTATGGTGTAAGG - Intergenic
912318496 1:108688484-108688506 TAATTTTTGCTTATGGTGTGAGG - Intergenic
912326165 1:108765045-108765067 TGATTTTTGTATATGGTGTATGG + Intronic
912506033 1:110156951-110156973 TTATTTTGGCAGATGCTGTGAGG + Intronic
912594721 1:110862960-110862982 TGATTTTTGTATATGGTGTAAGG + Intergenic
912611395 1:111048824-111048846 TGATTTTTGTATATGGTGTAAGG + Intergenic
912647653 1:111410091-111410113 TGATTTTTGTATATGGTGTAAGG - Intergenic
912732536 1:112121592-112121614 TGATTTTTGTATATGGTGTAAGG - Intergenic
912804782 1:112746850-112746872 TAAATTTTACATATGGTGTGAGG + Intergenic
912884999 1:113461548-113461570 TGATTTTTATATATGGTGCAAGG - Intronic
912995628 1:114530100-114530122 TGATTTTTTCAGGGGGTGGGAGG - Intergenic
913024131 1:114818796-114818818 TACTTTTTTCATATGGTGTGAGG + Intergenic
913041412 1:115028643-115028665 TGATTTTTCTATATGGTGTAGGG - Intergenic
913154639 1:116083578-116083600 TAATTTTTGTAGATGGTGTAGGG + Intergenic
913260414 1:116992527-116992549 TAATTTCTGTAGATGGTGTGAGG - Intergenic
913415975 1:118607766-118607788 AAATTTTTAAATATGGTGTGAGG + Intergenic
913649833 1:120902511-120902533 TGATTTTTGTATATGGTGTAAGG - Intergenic
914329356 1:146651628-146651650 TTATTTTTGCATATGGTGTGAGG - Intergenic
914968746 1:152287283-152287305 TGATTTTTGTATATGGTGTAAGG - Intergenic
914985534 1:152453778-152453800 TGATTTTTATATATGGTGTAAGG + Intergenic
914999443 1:152574986-152575008 TGATTTTTGTATATGGTGTAAGG - Intronic
915049553 1:153053706-153053728 TGATTTTTATATATGGTGTAAGG - Intergenic
915207273 1:154279530-154279552 TATTTTGTACAGATGGTGGGGGG - Intergenic
915618135 1:157057758-157057780 TAATTTTTATATATGGTGTAAGG + Intergenic
915809419 1:158890941-158890963 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
915815094 1:158957579-158957601 TGATTTTTGTAGAAGGTGTAAGG - Intronic
916091270 1:161309566-161309588 TGAATTTTACAGATGGAGTCTGG + Intronic
916369045 1:164068468-164068490 TGATTTTTGTATATGGTGAGAGG + Intergenic
916559572 1:165921877-165921899 TAATTTTTTAAGATGGTGTGAGG + Intergenic
916646210 1:166787821-166787843 TGATTTTTGTACATGGTGTAAGG + Intergenic
916834984 1:168534275-168534297 CTATTTTTATACATGGTGTGAGG + Intergenic
916904537 1:169267744-169267766 TGATTTTTGTATATGGTGTAAGG - Intronic
916914681 1:169393264-169393286 TAATTTTTATATATGGCGTGAGG - Intronic
917142968 1:171856033-171856055 TGATTTTTATATATGGTGTAAGG + Intronic
917172874 1:172197074-172197096 TGATTTTTGTATATGGTGTAAGG + Intronic
917195386 1:172459018-172459040 TTATTTTTGTACATGGTGTGAGG - Intronic
917254552 1:173100223-173100245 TGGTTGTGACAGAAGGTGTGGGG - Intergenic
917267610 1:173238225-173238247 TGATTTTTCGATATGGTGTAAGG - Intergenic
917372698 1:174312767-174312789 TGATTTTTGTATATGGTGAGAGG + Intronic
917524819 1:175778884-175778906 TGATTTTTGTATATGGTGTAAGG - Intergenic
917705283 1:177626679-177626701 TAATTTTTGTATATGGTGTGAGG - Intergenic
917873828 1:179267045-179267067 TTATTTTTGTATATGGTGTGAGG + Intergenic
918084414 1:181233137-181233159 TGATTTTTGTATATGGTGAGGGG - Intergenic
918541015 1:185633215-185633237 TGAGTAATACAGATGCTGTGAGG + Intergenic
918620506 1:186598951-186598973 TGATTTTTACATAAGGTGAGAGG + Intergenic
918894437 1:190321830-190321852 CCATTTTTCCAAATGGTGTGAGG - Intronic
918974374 1:191462953-191462975 TGATTTTTGTATATGGTGTAGGG - Intergenic
918982503 1:191581570-191581592 TGATTTTTGTATATGGTGTAAGG + Intergenic
919095644 1:193032351-193032373 TAATTTTTATATATGGTGTAAGG - Intronic
919111036 1:193218734-193218756 TGATTTTTGCATATGGTGAAAGG - Intronic
919162169 1:193844656-193844678 ATAATTTTACATATGGTGTGGGG - Intergenic
919235156 1:194831358-194831380 TGATTTTTATATATAGTGTGTGG - Intergenic
919461215 1:197879804-197879826 TGATTTTTACATAAGGTGTAAGG + Intergenic
919519244 1:198566884-198566906 TGATTTTTGTATATGGTGTAAGG + Intergenic
919560118 1:199107271-199107293 TGATTTTTGTACATGGTGTAAGG - Intergenic
919682152 1:200446230-200446252 TCATTTTTGTATATGGTGTGAGG + Intergenic
920602395 1:207341432-207341454 TGATTTTTGTACATGGTGAGGGG + Intronic
920637902 1:207722359-207722381 TGATTTTTGTATAAGGTGTGAGG + Intronic
920639221 1:207735305-207735327 TGATTTTTGTATAAGGTGTGAGG - Intronic
920890520 1:209980614-209980636 TGATTTTTGTATATGGTGTAAGG + Intronic
920903889 1:210140667-210140689 TGATTTTTTAATACGGTGTGAGG + Intronic
921540591 1:216409703-216409725 TGATTTTTATATATGGTATAAGG - Intronic
921653431 1:217705892-217705914 TGATTTTTATGTATGGTGTAAGG + Intronic
921800328 1:219395784-219395806 TGATTTTTACATATGGTGTAAGG + Intergenic
921870043 1:220130523-220130545 TGATTTTTGTATATGGTGAGAGG + Intronic
921928943 1:220737754-220737776 TGATTTTTGTATATGGTGAGAGG + Intergenic
921943217 1:220864612-220864634 TAATTTGTATATATGGTGTGAGG + Intergenic
922381305 1:225030543-225030565 TAATTTTTGCAAATGGTGTCAGG + Intronic
922381508 1:225033244-225033266 TGATGTTTATATATGGTGTAAGG + Intronic
922711628 1:227838279-227838301 TAATTTTTGCATATGGTGTGAGG + Intronic
922747556 1:228053313-228053335 TGATTTTTACAGATGGTGTGAGG - Intronic
922823281 1:228499258-228499280 TAATTTTTAAAGATGTTATGTGG - Intergenic
923000878 1:230005448-230005470 AGAGTTTTTCACATGGTGTGGGG + Intergenic
923191551 1:231625679-231625701 TTATTTTTAGAGATGTGGTGGGG + Intronic
923270434 1:232350532-232350554 ACATTTTTACATATGGTGTATGG - Intergenic
923419023 1:233794227-233794249 TAATTTTTGTATATGGTGTGAGG - Intergenic
923657187 1:235927607-235927629 TGATTTTTATATAAGGTGAGAGG + Intergenic
924122499 1:240816049-240816071 TGATTTTTACAATTGGTTAGAGG + Intronic
924407806 1:243769974-243769996 TAATTTTTACACATGGTGTGAGG + Intronic
924463337 1:244279077-244279099 TGATTTTTGTACATGGTGTGAGG + Intergenic
924546795 1:245035544-245035566 TAATTTTCATATATGGTGTGTGG - Intronic
924919005 1:248606387-248606409 TGATTTTTGTAAATGGTGTGAGG + Intergenic
1062864311 10:837721-837743 TGATGTTTGTACATGGTGTGGGG - Intronic
1062935913 10:1389114-1389136 TCATTTTCACATATGATGTGAGG - Intronic
1063861983 10:10320215-10320237 TAATTTTTATATATGGTGTAAGG - Intergenic
1063906989 10:10791254-10791276 AGATTTTTATAGATTGAGTGTGG + Intergenic
1063981522 10:11455948-11455970 TAATTTTTATATATGGTATGAGG - Intronic
1064484948 10:15776833-15776855 TACTTTTTGCAAATGGTGTGAGG + Intergenic
1064613675 10:17130232-17130254 TAATTTTTGCATATGGTATGAGG - Intergenic
1064845685 10:19649892-19649914 TGATTTTTATATATGGTGTGAGG + Intronic
1064909029 10:20379840-20379862 AAATTGTTACAGATGGTGGGTGG - Intergenic
1065074894 10:22067498-22067520 TAATTTTTGCATATGGTGTAAGG + Intergenic
1065183838 10:23153426-23153448 TGATTTTTATATAAGGTGTAAGG - Intergenic
1065241074 10:23705419-23705441 AGATTTTTGTATATGGTGTGAGG + Intronic
1065429142 10:25636142-25636164 TGATTTTTGTATATGGTATGAGG - Intergenic
1065551704 10:26874128-26874150 TAATTTTTATATATGGTGTGAGG + Intergenic
1065981871 10:30905771-30905793 TAATTTTTATATATTGTGTGAGG + Intronic
1066162372 10:32747191-32747213 TGATTTTTACATGTGGTGAAAGG - Intronic
1066445458 10:35478613-35478635 TGATTTTTGCATAAGGTGTAAGG - Intronic
1066679338 10:37921657-37921679 TGATTTTTGTATATGGTGTAAGG - Intergenic
1066684517 10:37967823-37967845 TGATTTTTGCATATGATGTGAGG - Intronic
1067191580 10:44073648-44073670 TGATTTTTGTAAAAGGTGTGAGG + Intergenic
1067229938 10:44399106-44399128 TGATTTTTTAAAAGGGTGTGGGG - Intergenic
1067699711 10:48561330-48561352 ATATTTTTATATATGGTGTGAGG - Intronic
1067823950 10:49556078-49556100 TAATTTTTGTATATGGTGTGAGG - Intergenic
1067844135 10:49705601-49705623 TAATTTTTGTATATGGTGTGAGG - Intronic
1068057031 10:52024079-52024101 TGATTTTTGTATAAGGTGTGAGG + Intronic
1068218721 10:54015725-54015747 TGATTTTTGTACATGGTGTAAGG - Intronic
1068230133 10:54160396-54160418 TTAATTTTACATATGCTGTGAGG - Intronic
1068235115 10:54223430-54223452 TGGTTTCTATAGATAGTGTGAGG + Intronic
1068353996 10:55886711-55886733 TGATTTTTGCATATGGTGTAAGG - Intergenic
1068760090 10:60697728-60697750 TGATTTTTATATAAGGTGTAAGG - Intronic
1068771981 10:60831960-60831982 TGATTTTTGTATATGGTGTAAGG - Intergenic
1068810721 10:61252958-61252980 TGATTTTTGTATATGGTGTAAGG + Intergenic
1068889042 10:62129307-62129329 TAATTTTTGTATATGGTGTGAGG - Intergenic
1068891435 10:62152181-62152203 TGATTTTTGTATATGGTGTAAGG + Intergenic
1068906095 10:62324525-62324547 TGATTTTTGTACATGGTGTAAGG - Intergenic
1069187443 10:65442724-65442746 TAATTTTTATATATGGTGTAAGG - Intergenic
1069276705 10:66600425-66600447 TGATTTTTATGGGTGGTGTTTGG - Intronic
1069320843 10:67169604-67169626 TGATTTTTGTATATGGTGTAAGG - Intronic
1069341017 10:67408560-67408582 TGATTTTTATATATAGTGTAAGG - Intronic
1069344304 10:67449634-67449656 TGATTTTTGTATATGGTGTAAGG - Intronic
1069774371 10:70918234-70918256 TGTTTTGTAGAGCTGGTGTGAGG - Intergenic
1070052222 10:72900297-72900319 TTCTTTTTAGAGATGGTGCGGGG - Intronic
1070078937 10:73166979-73167001 TGATTTTTGTATATGGTGGGAGG + Intronic
1070211296 10:74325277-74325299 TGTTTTTTTCAGATAGTTTGTGG + Intronic
1070482272 10:76894303-76894325 TAATTTTTGCATATAGTGTGAGG - Intronic
1070639392 10:78156393-78156415 TAATTTTTATATATCGTGTGAGG + Intergenic
1070666137 10:78345491-78345513 TAATTTTCGCATATGGTGTGAGG + Intergenic
1070952173 10:80440248-80440270 TATTTTTTAAAGATGGGGTGTGG - Intergenic
1071052461 10:81467888-81467910 TGATTTTTGTATATGGTGTAAGG + Intergenic
1071075188 10:81741733-81741755 TAATTTTTGTACATGGTGTGAGG + Intergenic
1071105967 10:82095326-82095348 TTATTTGTAAAGATGGTGTTGGG + Intronic
1071122209 10:82291804-82291826 TGATTTTTATATAAGGTGTGAGG - Intronic
1071213969 10:83377269-83377291 TGATTTTTGTATATGGTGTAAGG - Intergenic
1071367913 10:84919352-84919374 TGATTTTTGCATATAGTGTAAGG - Intergenic
1071581191 10:86772041-86772063 TAATTTTTAAAGAAGGTATGTGG - Intronic
1071736621 10:88308102-88308124 TAATTTTTGCATATGGTGTAAGG - Intronic
1071991788 10:91106902-91106924 TGATTTTTGTATATGGTGTAAGG + Intergenic
1072021009 10:91401425-91401447 TGATTTTTATAGATGATATGAGG - Intergenic
1072054045 10:91735797-91735819 TGATTTTTGTATATGGTGTAAGG + Intergenic
1072254639 10:93609627-93609649 TGATTTTAACAAATGGTTTGTGG - Intergenic
1072545679 10:96435626-96435648 TAATTTTTGTATATGGTGTGAGG + Intronic
1072600880 10:96927627-96927649 TAATTTTTCTATATGGTGTGAGG + Intronic
1072870996 10:99119920-99119942 TGATTTTTGTATATGGTGTAAGG - Intronic
1073158816 10:101371794-101371816 TAATTTTTGCATATGGTGTGAGG + Intronic
1073279344 10:102340795-102340817 TAATTTTTGCATAAGGTGTGAGG - Intronic
1073295352 10:102435348-102435370 TGAATTTTGCAGCTGGTGTTTGG + Intergenic
1073581484 10:104670371-104670393 TAATTTTTATATACGGTGTGAGG + Intronic
1073658151 10:105440434-105440456 TGATTTTTGTATATGATGTGAGG + Intergenic
1074180188 10:111054937-111054959 TTATTTTTGCGTATGGTGTGAGG + Intergenic
1074194676 10:111172471-111172493 TGATTTTTGCATATAGTGTAAGG + Intergenic
1074552408 10:114457005-114457027 TGATTTTTAAAAATGCTTTGTGG - Intronic
1074579162 10:114700765-114700787 TAATTTTTGTATATGGTGTGAGG - Intergenic
1074691886 10:116013567-116013589 TGCATTTTACAAATGGTTTGGGG + Intergenic
1074957090 10:118402371-118402393 TAATTTTTGTATATGGTGTGAGG + Intergenic
1075187976 10:120280285-120280307 TGATTTTTGCAGGTGATGTAAGG - Intergenic
1075431890 10:122391432-122391454 TAATTTTTATAAATGGTGTGAGG + Intronic
1075604226 10:123792799-123792821 TGAGTATTGCAGAAGGTGTGGGG - Intronic
1075720466 10:124583311-124583333 TCACTTTTGCATATGGTGTGAGG + Intronic
1076578415 10:131489310-131489332 TAGTTTTTGCATATGGTGTGAGG - Intergenic
1076644425 10:131942688-131942710 TCATTTTTAGAGATGGGGTCTGG - Intronic
1076694174 10:132239167-132239189 GGTATTTTATAGATGGTGTGAGG + Intronic
1076831757 10:132998905-132998927 TAATTTTCACATAAGGTGTGAGG + Intergenic
1077396102 11:2322800-2322822 TGATTTTTATATATGGTGTAAGG - Intergenic
1077461090 11:2710643-2710665 TTAGTTTAACATATGGTGTGAGG + Intronic
1077750608 11:4964277-4964299 TGATTTTTATATATGGTGTAAGG + Intronic
1077783319 11:5355675-5355697 TAACTTTTACAGATGATTTGTGG - Intronic
1077852787 11:6090748-6090770 TGATTTTTGTATATTGTGTGAGG + Intergenic
1078019766 11:7646711-7646733 TTATTTTTAGAGATGGGGTCTGG - Intronic
1078150361 11:8753878-8753900 TTATTTTTAAATATGGTATGAGG - Intronic
1078295286 11:10062164-10062186 TGATTTTTGTATATGGTGTGAGG - Intronic
1078488608 11:11747852-11747874 TAATTTTTATATAAGGTGTGAGG - Intergenic
1078589284 11:12624978-12625000 TAATTTTTATATATGGTTTGAGG - Intergenic
1078647567 11:13155695-13155717 TGATTTTTGTATATGGTGTAAGG + Intergenic
1078713902 11:13821177-13821199 TGATTTTTGCATAAGGTGTGAGG + Intergenic
1078721416 11:13887639-13887661 TTATTTTTATATATGCTGTGAGG + Intergenic
1078743836 11:14092178-14092200 TGCTTTTTACTGTTGGTATGTGG + Intronic
1078799550 11:14629334-14629356 TGATTTTTATATAAGGTGTAAGG + Intronic
1078816537 11:14828144-14828166 TGATTTTTGTATATGGTGTAAGG - Intronic
1079120027 11:17675542-17675564 TGATTTTTGTGTATGGTGTGAGG - Intergenic
1079409021 11:20169486-20169508 TGATTTTTGTATATGGTGTGAGG + Intergenic
1079495138 11:21034176-21034198 TAATTTTTATATATGGTGTAAGG + Intronic
1079735044 11:23986559-23986581 TGATTTTTGTATATGGTGTAAGG + Intergenic
1079845097 11:25456126-25456148 TAATTTTTACAGCTAGTGTTTGG + Intergenic
1079865825 11:25732456-25732478 TAATTTTTGCAAAAGGTGTGAGG - Intergenic
1080221398 11:29909556-29909578 TAATTTTTATATGTGGTGTGAGG - Intergenic
1080354570 11:31427471-31427493 AGATTTTCACTGCTGGTGTGTGG + Intronic
1080500656 11:32867796-32867818 TGATTTTTGTATATGGTGTAAGG - Intergenic
1080561728 11:33470182-33470204 TGATTTTTGTATATGGTGTGAGG + Intergenic
1081036437 11:38152292-38152314 TGATTTTTGTATATGGTGAGAGG - Intergenic
1081043270 11:38238163-38238185 TGATTTTTGTATATGGTGTAAGG + Intergenic
1081101009 11:39001934-39001956 TGATTTTTGCATAAGGTGTAAGG - Intergenic
1081168311 11:39834422-39834444 TGATTTTTTTATATGGTGTAAGG - Intergenic
1081479172 11:43468465-43468487 TGATTTTTCTGGATGATGTGAGG - Intronic
1081495853 11:43609538-43609560 TAATTTGTAGAGATGGGGTGGGG + Intronic
1082158460 11:48854517-48854539 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1082579253 11:54846275-54846297 TGATTTTTGTAGAAGGTGTAAGG + Intergenic
1082686717 11:56246917-56246939 TGATCTTTGCAGATATTGTGGGG - Intergenic
1082688237 11:56266986-56267008 TGATTTTTGTATATGGTGTAAGG - Intergenic
1082907565 11:58327206-58327228 TGATTTTTGTATATGGTGTAAGG + Intergenic
1084908261 11:72365882-72365904 TGATTTTTGTATATGGTGAGAGG - Intronic
1084993356 11:72950493-72950515 TAATTTTTATATATGCTGTGAGG + Intronic
1085343889 11:75753454-75753476 TGATTTTTGTATATGGTGTAAGG - Intergenic
1085444965 11:76594784-76594806 TGATTTTTATATATGATGTAAGG - Intergenic
1085757233 11:79211983-79212005 TAATTTTTGTATATGGTGTGAGG + Intronic
1085971764 11:81600345-81600367 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
1086189733 11:84065043-84065065 TTATTTTTACAGATTGTTTAAGG - Intronic
1086348550 11:85922328-85922350 TTTTTTGTAGAGATGGTGTGGGG + Intergenic
1086496974 11:87414264-87414286 TAATTTTTATATATGGTGTAAGG - Intergenic
1086610775 11:88752931-88752953 TAATTTTTGCATATGGTGTAAGG - Intronic
1086812543 11:91328797-91328819 TGTATTTTACAGATGGGATGTGG - Intergenic
1086839894 11:91672063-91672085 TGATTTTTGTATATGGTGTAAGG - Intergenic
1086883300 11:92174388-92174410 TGATTTTTGTATAAGGTGTGAGG - Intergenic
1086919192 11:92566861-92566883 TGATTTTTGTATAAGGTGTGTGG - Intronic
1087337168 11:96859025-96859047 TGATTTTTGTATATGGTGTAAGG + Intergenic
1087848723 11:103003647-103003669 TGATTTTTGTATATGGTGTAAGG - Intergenic
1087988916 11:104722950-104722972 TGATTTTTGTATATGGTGTGAGG + Intergenic
1088362504 11:109005805-109005827 TGATTTTTGTATATGGTGTAAGG - Intergenic
1088424087 11:109682510-109682532 TGATTTTTATATATGGTGTAAGG - Intergenic
1088505999 11:110527785-110527807 TGATTTTTGTATATGGTGTAAGG + Intergenic
1088520630 11:110695172-110695194 TAATTTTTATATATGGTCTGAGG - Intronic
1088612113 11:111587930-111587952 TTATTTTTATATATGGTATGAGG + Intergenic
1088635206 11:111813119-111813141 TGATTTTTGCATGTGGAGTGAGG - Intronic
1088730246 11:112674252-112674274 TGATTTTTGTATATGGTGTAAGG - Intergenic
1088741069 11:112767171-112767193 TGATTTTAACATTTGGTGTTTGG - Intergenic
1088942235 11:114471296-114471318 TAATTTTTGTATATGGTGTGAGG + Intergenic
1088964246 11:114701932-114701954 TGATTTTTGTAGATGTGGTGGGG + Intronic
1089217177 11:116841433-116841455 TGATCTTTGCAGTTGGGGTGGGG + Intergenic
1089781285 11:120874886-120874908 TGGTTTTTGCAGTTGGTATGGGG + Intronic
1089884985 11:121811786-121811808 TGATTTTTATATGTGGTGTAAGG + Intergenic
1090068865 11:123526584-123526606 TGATTTTGAGGGAGGGTGTGCGG + Intronic
1090863463 11:130674566-130674588 TAATGTTTAGATATGGTGTGTGG + Intronic
1091284503 11:134400585-134400607 TCATTTTCACATATGGTGAGAGG - Intronic
1091455383 12:603567-603589 TAATTTTTGCACATGGTATGAGG + Intronic
1091525862 12:1300291-1300313 TGATTTTTGTATATGGTGTAAGG - Intronic
1091943631 12:4513718-4513740 TGATTTTTATATAAGGTGTAAGG - Intronic
1091954091 12:4622603-4622625 TGATTTTTGTATATGGTGTAAGG - Intronic
1092274713 12:7050688-7050710 TGATTTTCGTAAATGGTGTGAGG + Intronic
1093112868 12:15173142-15173164 TAAATTTTGCAGATAGTGTGAGG + Intronic
1093287867 12:17287753-17287775 TGATTTCTATAGATGGTGAAAGG - Intergenic
1093385128 12:18543556-18543578 TGATTTTTATATATGGTGTAAGG + Intronic
1093399951 12:18733632-18733654 TGATTTTTGCATATGGGGTAAGG + Intronic
1093415712 12:18918114-18918136 TGATTTTTGTATATGGTGTAAGG - Intergenic
1093491923 12:19714817-19714839 TGATTTTTGTATATGGTGTAAGG + Intronic
1093592874 12:20927021-20927043 TAATTTTTACACATTGTGAGAGG + Intergenic
1093883852 12:24437295-24437317 TAATTTTTATATAAGGTGTGAGG - Intergenic
1093968392 12:25351433-25351455 TGATTTTTATATATGGTGCAAGG - Intergenic
1094093266 12:26674520-26674542 TGATTTTTATATAAGGTGTAAGG - Intronic
1094238399 12:28194208-28194230 TAATTTTTGCATATAGTGTGAGG + Intronic
1094283378 12:28764869-28764891 TGATTTTTATATAAGGTGTAAGG - Intergenic
1094290263 12:28840342-28840364 TGGTTTTTATATATGGTGTAAGG - Intergenic
1094365824 12:29679997-29680019 TGATTATTAAAAATAGTGTGTGG - Intronic
1094543517 12:31382066-31382088 TGATTTTTCTGTATGGTGTGAGG + Intergenic
1094754588 12:33452899-33452921 TAATTTTTATATATGGTGTGAGG - Intergenic
1094759452 12:33513733-33513755 TGATTTTTGTATATGGTGTAGGG + Intergenic
1094784193 12:33826807-33826829 TAATTTTTATATATGATGTGAGG - Intergenic
1094790780 12:33912533-33912555 TGATTTTTGTACATGGTGTAAGG + Intergenic
1094803741 12:34067988-34068010 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1095271205 12:40221463-40221485 TTATTTTTGAATATGGTGTGAGG + Intronic
1095529555 12:43170504-43170526 TGAATTTTACAGATTTTATGTGG + Intergenic
1095610634 12:44123567-44123589 TGATTTTTGTATATGGTGTAAGG + Intronic
1095660322 12:44725092-44725114 TGATTTTTGTACATGGTGTAAGG - Intronic
1095687825 12:45055409-45055431 TGATTTTTATATAAGGTGAGAGG - Intergenic
1095843119 12:46716177-46716199 TGATTTTTGTATATGGTGTAAGG - Intergenic
1095879619 12:47119215-47119237 TAATTTTTATATTTGGTGTGAGG - Intronic
1096034397 12:48452309-48452331 TGATTTTTGCATATGGGGTGAGG - Intergenic
1096483997 12:51964630-51964652 TAATTTTTGCACATGGTGTTAGG + Intronic
1096946817 12:55415561-55415583 TGATTTTTGTATATGGTGTAAGG + Intergenic
1097133231 12:56829518-56829540 TGATTTTTGCATATGGCGTAAGG - Intergenic
1097172192 12:57122282-57122304 TAATTTTTGCATATGGTGTGAGG + Intronic
1097337385 12:58398121-58398143 TGATTTTTGTATATGGTGTAAGG + Intergenic
1097550269 12:61059362-61059384 TGATTTTTGTACATGGTGTAAGG - Intergenic
1097736278 12:63184810-63184832 TGATTTTTGCACATGGTGAAAGG + Intergenic
1097751810 12:63363442-63363464 TGATTTTTGCATATGGTGAAAGG + Intergenic
1097752609 12:63373609-63373631 TAATTTTTATATTTGGTGTGAGG - Intergenic
1098039777 12:66342171-66342193 TAATTTTTGTATATGGTGTGAGG + Exonic
1098073895 12:66705880-66705902 TAATTTTTATATAAGGTGTGAGG - Intronic
1098085934 12:66843777-66843799 TAATTTTTATATATGGTGTAAGG - Intergenic
1098201127 12:68056935-68056957 TAATTTTTGCATATGGTGAGAGG + Intergenic
1098291771 12:68963290-68963312 TAACTTTAACAGATGGAGTGAGG - Intronic
1098674500 12:73271745-73271767 TGATTTTTTTATATGGTGTAAGG - Intergenic
1098938871 12:76511889-76511911 TCATTTTTATATATGGTGTAAGG + Intronic
1099515241 12:83589055-83589077 TGATTTTTATATAAGGTGTAAGG - Intergenic
1099662781 12:85586533-85586555 TGATTTTTGTATATGGTGTAAGG - Intergenic
1099696759 12:86032931-86032953 TGATTTTTGTATATGGTGTAAGG + Intronic
1099715560 12:86289073-86289095 TGATTTTTGTATATGGTGTAAGG + Intronic
1099731467 12:86509227-86509249 TGATTTTTGTATAAGGTGTGAGG + Intronic
1099964142 12:89427369-89427391 TTAATTTTGTAGATGGTGTGAGG - Intronic
1099991572 12:89727865-89727887 TGATTTTTGTACATGGTGTAAGG - Intergenic
1100024932 12:90116619-90116641 TGATTTTTGCATATGGTGAGAGG + Intergenic
1100081742 12:90860927-90860949 TGACTTTTACAGATCCTGGGGGG + Intergenic
1100410839 12:94317580-94317602 TGACTTTTGCATATGGTGTAAGG + Intronic
1100901227 12:99242867-99242889 TAATTTTTGTATATGGTGTGAGG - Intronic
1101187581 12:102295504-102295526 TAATTATTACCTATGGTGTGAGG + Intergenic
1101927893 12:108988390-108988412 TAATTTTTATATATGGTGTTAGG + Intronic
1102322622 12:111950656-111950678 TAATTTTTATATATGGTGTAAGG - Intronic
1102583254 12:113905426-113905448 TGATTTTTGTATATGGCGTGAGG - Intronic
1102949088 12:117016797-117016819 TAATTTTTGTATATGGTGTGAGG + Intronic
1103254165 12:119526237-119526259 TGATTTTTATTTATGGTGTAAGG - Intronic
1104155860 12:126131378-126131400 TGATTTTTGTATATGGTGTAAGG + Intergenic
1104677733 12:130725554-130725576 TGATTTTTGTATATGGTGTAAGG - Intergenic
1104838235 12:131806341-131806363 TCACTTTTGCACATGGTGTGAGG - Intergenic
1105317322 13:19277827-19277849 TGATTTTTGCATAAGGTGTAAGG - Intergenic
1105565574 13:21544136-21544158 TGATTTTTATATAAGGTGAGGGG - Intronic
1105835323 13:24205902-24205924 TGATTTTTGTATATGGTGTAAGG - Intronic
1106244159 13:27932994-27933016 TTATTTTTTGAGATGGAGTGTGG - Intergenic
1106767365 13:32926966-32926988 TAATTTTTATGCATGGTGTGAGG + Intergenic
1107116191 13:36748400-36748422 TGATTTTTACATATGGTATAAGG + Intergenic
1107207915 13:37817860-37817882 TGATTTTTCTATATGGTGTAAGG - Intronic
1107287959 13:38817539-38817561 TGATTTTTATATATAGTGAGAGG - Intronic
1107436725 13:40386958-40386980 TGATGTTTGCAGAATGTGTGGGG - Intergenic
1107711718 13:43157111-43157133 AGATATCTACAGATGGTGGGTGG - Intergenic
1107712649 13:43165615-43165637 TGATTTTTGTATATGGTGTAAGG + Intergenic
1107811636 13:44206354-44206376 TGCTTTGGACAGATGGTGGGTGG + Intergenic
1107827835 13:44346026-44346048 TATATTTTACATATGGTGTGAGG + Intergenic
1108230990 13:48340126-48340148 TAGTTTTTATAAATGGTGTGAGG - Intronic
1108231785 13:48351999-48352021 TGATTTTTGTATATGGTGTAAGG + Intronic
1108306141 13:49135506-49135528 TAATTTTTGTATATGGTGTGAGG + Intronic
1108624595 13:52214960-52214982 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1108854811 13:54779765-54779787 TGATTTTTGTATATGGTGTAAGG - Intergenic
1109013533 13:56979622-56979644 TTCTTTTAACAGATGGTGTCAGG + Intergenic
1109018237 13:57048866-57048888 TGATTTTTGTATATGGTGTAAGG + Intergenic
1109255030 13:60069643-60069665 TGATTTTTGTATATGGTGTAAGG + Intronic
1109382198 13:61577510-61577532 TGATTTTTATACATGGTGTGAGG - Intergenic
1109573335 13:64221329-64221351 TGATTTTTGTATATGGTGTAAGG + Intergenic
1109627638 13:64996652-64996674 TGTTTCTTGCAGATGGTCTGTGG - Intergenic
1110348154 13:74472996-74473018 TGATTTTTGTGTATGGTGTGAGG - Intergenic
1110484878 13:76027091-76027113 TTATTTTTGCACATGGTGTGAGG + Intergenic
1110492160 13:76122464-76122486 TAATTTTTATATATGGTGAGAGG - Intergenic
1111040568 13:82741662-82741684 TGATTTTTGTATATGGTGTAAGG + Intergenic
1111069782 13:83150441-83150463 TAATTTATAGAGATGGGGTGGGG + Intergenic
1111082515 13:83330252-83330274 TGATGTTTATATATGGTGAGAGG - Intergenic
1111149700 13:84234182-84234204 TGATTTTTATATGTGGTGAGAGG - Intergenic
1111360976 13:87175845-87175867 TAATTTTTATATATGGTGTTAGG - Intergenic
1111576461 13:90160905-90160927 TAATTTTTGTAGATGGTGTAAGG - Intergenic
1111607777 13:90563308-90563330 AGATTTTAAGAGCTGGTGTGGGG + Intergenic
1111743765 13:92238917-92238939 AAATTTTTATATATGGTGTGAGG + Intronic
1111744273 13:92246500-92246522 TGGTTTGTAAAGATGGGGTGTGG - Intronic
1111765451 13:92521601-92521623 TGATTTTTGTATAAGGTGTGAGG - Intronic
1111792846 13:92880536-92880558 TTATTTTTAAAGATTGTTTGTGG - Intergenic
1111859595 13:93685166-93685188 TCATTTTTAAAAATGGTCTGTGG + Intronic
1112070218 13:95841853-95841875 TAATTTTTATATATGATGTGAGG + Intronic
1112213592 13:97406429-97406451 TGATTTTTATGAATGGTGGGAGG - Intergenic
1112404420 13:99106005-99106027 TAATTTTTACACATGGTATAAGG - Intergenic
1112544769 13:100356091-100356113 TCATTTTTATGTATGGTGTGAGG - Intronic
1112782774 13:102919592-102919614 TGATTTTTGTATATGGTGTGAGG + Intergenic
1112885217 13:104162241-104162263 TAATTTTTACATATTGTGGGAGG - Intergenic
1113019294 13:105864931-105864953 TGATTTTTAGAGAGCATGTGTGG + Intergenic
1113227378 13:108174062-108174084 TGATTTTTGTAGATGATGTAAGG - Intergenic
1113626142 13:111848524-111848546 TGATATTTATATATGGTGTGAGG + Intergenic
1113756390 13:112814515-112814537 TGATTTTTGTATAAGGTGTGAGG + Intronic
1113860107 13:113476815-113476837 TGATTTTTACATATGGTATGCGG + Intronic
1114274598 14:21131244-21131266 TGATTTTTGTATATAGTGTGAGG - Intergenic
1114475941 14:22994933-22994955 TGATTATTACAACTGGTGGGTGG - Intronic
1114951879 14:27764848-27764870 TGATTTTTATATATGGTATAAGG - Intergenic
1115177853 14:30585323-30585345 TAATTTGTATATATGGTGTGAGG + Intronic
1115207019 14:30918835-30918857 TGATCTTTAGAGAAGGTGTTGGG - Intronic
1115286799 14:31723109-31723131 TGATTTTTGTATATGGTGTAAGG + Intronic
1115293954 14:31804760-31804782 TGATTTTTGTATATGGTGTAAGG - Intronic
1115381133 14:32740539-32740561 TGATTTTTGTATATGGTGAGAGG + Intronic
1115547250 14:34475365-34475387 TGATTTTTATATAAGGTGAGAGG - Intergenic
1115595884 14:34908789-34908811 AAATTTTTACATATGGTATGAGG - Intergenic
1115648531 14:35386485-35386507 TGTTTTTTAAAGAAGGTGGGGGG + Intergenic
1115732271 14:36284225-36284247 TGATTCTTCCTGCTGGTGTGAGG + Intergenic
1115841486 14:37475916-37475938 TGATTTTTAAAGCTTATGTGGGG - Intronic
1115859083 14:37664476-37664498 TAATTTTTGTATATGGTGTGAGG - Intronic
1115937310 14:38567355-38567377 TAATTTTTATATATGGTGAGAGG - Intergenic
1115938804 14:38585799-38585821 TGATTTTTGTATATGGTGTAAGG + Intergenic
1115942540 14:38625549-38625571 TGATTTTTGTATATGGTGAGAGG - Intergenic
1115948389 14:38691802-38691824 TAATTTTTATAGATGGTATGGGG - Intergenic
1116024875 14:39502918-39502940 TGATTTTTGCATATGGTGAAAGG + Intergenic
1116026585 14:39522725-39522747 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1116104146 14:40477268-40477290 TGATGTTTACATAGTGTGTGGGG + Intergenic
1116196864 14:41738320-41738342 TAATTTTTGCATAAGGTGTGAGG - Intronic
1116337140 14:43671001-43671023 TGATTTTTGTATATGGTGTAAGG - Intergenic
1116343791 14:43761511-43761533 TGATTTTTATATATGGTGTAAGG - Intergenic
1116358867 14:43967318-43967340 TGATTTTTGCATATGGTGAAAGG - Intergenic
1116535491 14:46023503-46023525 TGATTTTTGTATATGGTGTAAGG - Intergenic
1116569548 14:46498156-46498178 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1116724799 14:48549433-48549455 TAATTTTTATATATGGTGAGAGG - Intergenic
1116751453 14:48890583-48890605 TGAATGTTACAGATGTAGTGAGG + Intergenic
1116796658 14:49398408-49398430 TGATTTTTGTATATGGTGTAAGG - Intergenic
1116876943 14:50121587-50121609 TGAGGTTGGCAGATGGTGTGGGG + Intronic
1116876967 14:50121793-50121815 TGAGGTTGGCAGATGGTGTGGGG + Intronic
1117006028 14:51421894-51421916 AGCTTTACACAGATGGTGTGGGG - Intergenic
1117234531 14:53757455-53757477 TGATTTTTGGATATGGTGTAAGG - Intergenic
1117260204 14:54024815-54024837 TGATCTTTGTATATGGTGTGAGG + Intergenic
1117389229 14:55247356-55247378 TGGTTTTTCCAGATGGGGTTGGG - Intergenic
1117467543 14:56008370-56008392 TCATAGTTACAGATGGGGTGGGG + Intergenic
1117739525 14:58802568-58802590 TGATTTTTATATGTGGTGTAAGG + Intergenic
1117768163 14:59104706-59104728 TGATTCTTACATATGGTTTAGGG - Intergenic
1117800383 14:59437818-59437840 TGATTTTTATAGACAGTGTGCGG - Intronic
1117837352 14:59820566-59820588 TGATTTTTGCATATGGTGAAAGG + Intronic
1117948212 14:61054040-61054062 TGATTTTTATATATGGTATAAGG + Intronic
1118057208 14:62091679-62091701 TCATTTTTATATATGGTGTTAGG - Intronic
1118183018 14:63512165-63512187 TAATTTTCAAAAATGGTGTGTGG - Intronic
1118298520 14:64592831-64592853 TCAATTTTGCATATGGTGTGAGG - Intergenic
1118504967 14:66401241-66401263 TTATTTTTGCAGAAGGTTTGGGG + Intergenic
1118660340 14:68002694-68002716 TGATTTTTGTATATGGTGTAAGG + Intronic
1119096412 14:71836356-71836378 TAATTTTTGCATATGGTGTGAGG + Intergenic
1119876951 14:78068403-78068425 TGATTTTTATATATGATGTAAGG + Intergenic
1120131615 14:80814581-80814603 TGATTTTTGTATATGGTGAGAGG - Intronic
1120448617 14:84636122-84636144 TGATTTTTTTATATGGTGTGAGG + Intergenic
1120555557 14:85926181-85926203 TAATTTTTGTATATGGTGTGAGG + Intergenic
1120705195 14:87738714-87738736 TGATTTAAACAGAAGGTGAGGGG - Intergenic
1120723396 14:87911790-87911812 TGATTTTTGTATATGGTGTAAGG + Intronic
1121205851 14:92166653-92166675 TAATTTTTGTATATGGTGTGAGG + Exonic
1121398569 14:93650952-93650974 TAATTTTTATGTATGGTGTGAGG + Intronic
1121487451 14:94329348-94329370 TGATTTTTGTGTATGGTGTGAGG + Intergenic
1121513050 14:94527383-94527405 TGATTTTTATATGTGGTGTAAGG - Intergenic
1121581159 14:95032323-95032345 TAATTTTTTGATATGGTGTGAGG + Intergenic
1121658365 14:95615420-95615442 AGATGTATACAAATGGTGTGAGG + Intergenic
1121706266 14:95996992-95997014 TGATTTTTGTATATGGTGTAAGG + Intergenic
1121750897 14:96355302-96355324 TGATTTTTGTATATGGTGTAAGG + Intronic
1122045359 14:99019073-99019095 TGATTTGTGTATATGGTGTGAGG - Intergenic
1122185166 14:99986878-99986900 TGAATTTTGTATATGGTGTGAGG - Intronic
1122433371 14:101673563-101673585 TCATTTTTGTATATGGTGTGAGG - Intergenic
1123416607 15:20100238-20100260 TCTTTTTTTCAGATGGAGTGTGG + Intergenic
1123525945 15:21107344-21107366 TCTTTTTTTCAGATGGAGTGTGG + Intergenic
1123726196 15:23104177-23104199 TAATTTTTGCATATGGAGTGAGG + Intergenic
1123812865 15:23946515-23946537 TGATTAGTACAGATGATATGGGG + Intergenic
1123979337 15:25585436-25585458 TAATTTTTATATATGGTGTAAGG + Intergenic
1124083704 15:26525698-26525720 TAATTTTGGCATATGGTGTGAGG + Intergenic
1124450725 15:29787272-29787294 TAATTTTTGTAGATGTTGTGAGG - Intronic
1124881345 15:33645725-33645747 TGATTTTTGCAATTTGTGTGTGG - Intronic
1125053155 15:35325548-35325570 TGATTTTTATGGATGGAGTGAGG - Intronic
1125177035 15:36835630-36835652 TAATTTTTGCATATGGTGTGAGG - Intergenic
1125226350 15:37400631-37400653 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1125274160 15:37972943-37972965 TGATTTTTGTATATGGTGTAAGG + Intergenic
1125400082 15:39292935-39292957 TGATTTTTGTATATGGTGTAGGG + Intergenic
1125443492 15:39728612-39728634 TGATTTTTGTATATGGTGTAAGG - Intronic
1125696718 15:41643986-41644008 TCATTTTTGCATGTGGTGTGAGG + Intronic
1125780841 15:42265880-42265902 TGATTTTTGAATATGGTGTGAGG + Intronic
1126028585 15:44473653-44473675 TAATTTTTATAGATGGTGTGAGG + Intronic
1126233294 15:46353049-46353071 TGATTTTTATATATGGTGAAAGG + Intergenic
1126279418 15:46926111-46926133 TGATTTTTGTGTATGGTGTGAGG - Intergenic
1126429682 15:48568816-48568838 TAATTTTTGTATATGGTGTGAGG - Intronic
1126442646 15:48707571-48707593 TGATTTTTGCACATGATGAGAGG + Intergenic
1126530770 15:49708640-49708662 TGATTTTTGTATATGGTGTAAGG + Intergenic
1126948699 15:53854461-53854483 TAATTTTTATATATGGTGTAAGG + Intergenic
1127070926 15:55288069-55288091 TAATTTTTAAATATGGTGTGAGG - Intronic
1127330597 15:57935611-57935633 TGATTTTTATATATGGTATAAGG + Intergenic
1127356142 15:58201966-58201988 TAATTTTTACATATATTGTGAGG - Intronic
1127368793 15:58316275-58316297 TGATTTTTGTATATGGTGTAAGG + Intronic
1127490981 15:59463175-59463197 TAATTTTTGTATATGGTGTGAGG + Intronic
1127974391 15:63986434-63986456 TTATTTTTAGAGATGGGGTCTGG + Intronic
1128421745 15:67498301-67498323 TAATTTTTATATATGATGTGAGG - Intronic
1128869755 15:71145372-71145394 TGATTTTTATAGATCTTATGAGG + Intronic
1129526490 15:76219300-76219322 TAATTTTTGTATATGGTGTGAGG - Intronic
1129583387 15:76836539-76836561 TGATTTTTATATATGGTGAAAGG - Intronic
1129585172 15:76855250-76855272 TGATTTTTGTATATGGTGTAAGG - Intronic
1129585584 15:76860689-76860711 TTATTCTTACATATAGTGTGTGG - Intronic
1129646050 15:77434197-77434219 TGATTTTTGTATATGTTGTGAGG - Intronic
1129924076 15:79346684-79346706 TGATTTTTGTATATGGTGTAAGG + Intronic
1129973370 15:79800145-79800167 TAATTTTTGCATATGCTGTGAGG + Intergenic
1130029719 15:80301053-80301075 TAATTTTTATATATGGTGTAAGG + Intergenic
1130609428 15:85347496-85347518 TGCTGTTTACAGAGGCTGTGAGG - Intergenic
1130758597 15:86793447-86793469 TAATTTTTGTAAATGGTGTGAGG - Intronic
1130860671 15:87885693-87885715 TGATTTTTGTATATGGTGTGAGG - Exonic
1131396035 15:92087111-92087133 TGATTTTTGCACGTGTTGTGAGG + Intronic
1131534560 15:93224473-93224495 TAATTTTTATATATGGTTTGAGG + Intergenic
1131870090 15:96755035-96755057 TGATTTTTGTGTATGGTGTGGGG - Intergenic
1132007733 15:98244876-98244898 TGATTTTTATATATGGTGCAAGG + Intergenic
1132108033 15:99078812-99078834 TGATTTTTGCATATGGTGTAAGG + Intergenic
1132127890 15:99245717-99245739 TAATTTTTGTATATGGTGTGAGG - Intronic
1132144770 15:99423086-99423108 TGATTTTTGTATATGGTGTAAGG + Intergenic
1132166771 15:99600571-99600593 TAATTTTTGTATATGGTGTGAGG + Intronic
1132300625 15:100773471-100773493 TGAATTTTCCAGATGGTGTATGG + Intergenic
1132352686 15:101149555-101149577 TAATTTTTAAAGATAGAGTGGGG - Intergenic
1132375897 15:101327937-101327959 TGAGTTTTAGAAATGGTGAGTGG - Intronic
1132380803 15:101365121-101365143 TTATTTTTGTATATGGTGTGAGG - Intronic
1132422288 15:101680962-101680984 TAATTTTTTCATATGGTATGAGG + Intronic
1132647569 16:1006289-1006311 TGTTTTTTGGAAATGGTGTGGGG + Intergenic
1134232823 16:12442086-12442108 TAATTTTTATATATGGTATGAGG + Intronic
1134276952 16:12785259-12785281 TTATTTTTACAGATGGGGTCTGG + Intronic
1134418412 16:14064625-14064647 TGATTTTTGTACATGGTGTAAGG + Intergenic
1134628820 16:15742032-15742054 TGATTGTCACAGCTGGGGTGGGG + Intronic
1134781298 16:16898327-16898349 TCATTTTTGTATATGGTGTGAGG + Intergenic
1135127098 16:19820064-19820086 TAATTTTTATATACGGTGTGGGG - Intronic
1135246849 16:20863946-20863968 TGATTTTTGTATATGGTGTAAGG - Intronic
1135683448 16:24478629-24478651 TGAGTTTTACATAGCGTGTGGGG - Intergenic
1135782468 16:25316167-25316189 TGATTTTTATATATGATGTAAGG - Intergenic
1135902994 16:26483634-26483656 TGATTTTTGCATATGGTGTTAGG - Intergenic
1135944139 16:26850306-26850328 TAATTTTTATATATGATGTGAGG - Intergenic
1135977704 16:27121236-27121258 TAATTTTTGTATATGGTGTGAGG - Intergenic
1136093997 16:27940978-27941000 TAATTTTTATAGATGGTTTAAGG - Intronic
1136601462 16:31293411-31293433 TGATTTTTGTATATGGTGTAAGG + Intronic
1136677943 16:31930950-31930972 TGATTTTTGTATATGGTGTAAGG - Intergenic
1137248400 16:46724461-46724483 TAATTTTTGTATATGGTGTGAGG + Intronic
1138259796 16:55608939-55608961 TGATTTTTGTATATGGTGTAAGG + Intergenic
1138976074 16:62209605-62209627 TGATTTTTGTATATGGTGTAAGG + Intergenic
1138989674 16:62376034-62376056 TGATTTTTGCATATGGTGTAAGG - Intergenic
1139129814 16:64129133-64129155 TGATTTTAGCATAGGGTGTGAGG + Intergenic
1140004205 16:71059306-71059328 TTATTTTTGCATATGGTGTGAGG + Intronic
1140052841 16:71498075-71498097 TGTTTTCTAAAGATGGTGTTTGG + Intronic
1140097602 16:71888433-71888455 TAGTTTTTGCATATGGTGTGAGG + Intronic
1140348000 16:74233675-74233697 TTATTTTTTCAGATGGAGTCTGG - Intergenic
1140592037 16:76365041-76365063 TAATTTTTGCATAAGGTGTGAGG + Intronic
1140611859 16:76609307-76609329 TGATTTTTGCATAAGGTGTAAGG + Intronic
1140679567 16:77371603-77371625 TGATTTTGACATATGGTGAGAGG - Intronic
1140734931 16:77890113-77890135 TGGATTTTACAGATGAGGTGGGG + Intronic
1140802037 16:78497292-78497314 TGATTTTTCTATATGGTGTGAGG - Intronic
1140846886 16:78898307-78898329 TAATTTTTGTATATGGTGTGAGG + Intronic
1141060817 16:80867396-80867418 TAATTTTTATATATGGTGAGAGG - Intergenic
1141505356 16:84473912-84473934 TGGTTTTTGTAGATGGTGAGAGG - Intergenic
1141527890 16:84624391-84624413 TAATTTTTGTATATGGTGTGAGG - Intergenic
1141566353 16:84904784-84904806 TAATTTTTATATATAGTGTGAGG - Intronic
1141902984 16:87004899-87004921 TAATTTTTATATATGGTGTGAGG - Intergenic
1142274516 16:89110315-89110337 TTAATTTTGCATATGGTGTGAGG + Intronic
1142524399 17:529055-529077 TGATTTTTATATATGGTGTGTGG + Intronic
1142526560 17:546179-546201 TAATTTTTGCATATGGTGTGAGG - Intronic
1142948566 17:3457796-3457818 TGATTTTTGTATATGGTGTAAGG - Intronic
1143034711 17:3987811-3987833 TGATTTTTGTATATGGTGTGAGG - Intergenic
1143230471 17:5349975-5349997 TGCTTTAAAGAGATGGTGTGGGG + Intronic
1143415388 17:6744558-6744580 TGATTTTTGCATACGGTGTAAGG - Intergenic
1143418953 17:6774392-6774414 TGATTTTTGCATATGGTGTAAGG - Exonic
1144121229 17:12155390-12155412 TGATTTTTGTATATGGTGTAAGG - Intergenic
1144121936 17:12163371-12163393 TGATTTTTGTAGACGGTGTGTGG + Intergenic
1144254661 17:13455215-13455237 TAATTTTTGTATATGGTGTGAGG + Intergenic
1144311652 17:14019414-14019436 AGAGTTTTACAGATGGAGGGTGG + Intergenic
1144393461 17:14819086-14819108 TGATTTTTGTACATGGTGTAAGG + Intergenic
1144410816 17:14999649-14999671 TAATTTTTGTATATGGTGTGAGG - Intergenic
1144648859 17:16993928-16993950 TAATTTTTGTATATGGTGTGAGG + Intergenic
1144697018 17:17311400-17311422 TAATTTTTGTATATGGTGTGAGG + Intronic
1145201380 17:20948302-20948324 TTATTTTTAGAGATGGGGGGGGG + Intergenic
1145224980 17:21120914-21120936 TAATTTTCATAAATGGTGTGAGG + Intergenic
1146040927 17:29453753-29453775 TAGTTTTTATATATGGTGTGAGG + Intronic
1146834772 17:36101854-36101876 TGATTTTTACAGATGGTGTAAGG + Intergenic
1146849379 17:36209036-36209058 TGATTTTTACAGATGGTGTAAGG + Intronic
1147460813 17:40567556-40567578 TAATTGTTGCATATGGTGTGAGG + Intergenic
1147601832 17:41751391-41751413 TGATTTGTAAAGATGGAGTCTGG - Intergenic
1147630580 17:41928193-41928215 TGATTTTTGTATATAGTGTGAGG + Intronic
1148531929 17:48401596-48401618 TAATTTTTTTATATGGTGTGAGG - Intronic
1148943485 17:51236851-51236873 TGATTTTTATATATGATGTGAGG - Intronic
1148967023 17:51444275-51444297 TGATTTCTGTATATGGTGTGAGG - Intergenic
1148968025 17:51454156-51454178 TTTTTTTTAGAGATGGTGGGGGG + Intergenic
1148971188 17:51483675-51483697 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1149176699 17:53880486-53880508 TGATTTTTATATATGATGTAAGG - Intergenic
1149395307 17:56235520-56235542 TGATTTTTGTACATGGTGTAAGG + Intronic
1149471518 17:56919695-56919717 TAATTTTTATATATGGTGTGGGG + Intergenic
1149777348 17:59368481-59368503 TGATTGTTCCAGATGTTATGAGG + Intronic
1149934845 17:60794570-60794592 TGATTTTTGCATAAGGTGAGAGG + Intronic
1150039238 17:61841041-61841063 TGGTTTTTGTAGATGGTGAGAGG - Intronic
1150076388 17:62195806-62195828 TGATTTTTGTATATGGTGTAAGG - Intergenic
1150110767 17:62497413-62497435 TAATTATTAGAGATGTTGTGTGG + Intronic
1150151629 17:62813958-62813980 TTATTTTTGTATATGGTGTGAGG + Intergenic
1150175287 17:63048469-63048491 TGATTTTTGTATATGGTGTAAGG + Intronic
1150176149 17:63058588-63058610 TGATTTTTGTATATGGTGTAAGG + Intronic
1150317835 17:64184750-64184772 TAATTTTTATGTATGGTGTGAGG + Intronic
1150696358 17:67409030-67409052 TAATTTTTGCATATGGTGTGGGG + Intronic
1150998774 17:70349939-70349961 TGATTTTTGTATATGGTCTGAGG - Intergenic
1151253677 17:72858142-72858164 TGATTTTTGTATATGGTGTAAGG + Intronic
1151925137 17:77190123-77190145 TAATTTTTATACAAGGTGTGAGG + Intronic
1151947002 17:77325308-77325330 TGATTTTTGCATGTGGTGTAAGG + Intronic
1151948621 17:77333723-77333745 TAACTTTTGCATATGGTGTGAGG + Intronic
1153168384 18:2287719-2287741 TGATTTTTGTATATGGTGTAAGG + Intergenic
1153360218 18:4186442-4186464 TGATTTTTGTACATGGTGTGAGG + Intronic
1153407573 18:4758238-4758260 TGATCATTACACATGTTGTGAGG + Intergenic
1153506100 18:5800635-5800657 TGATTTTTGCATATAGTATGAGG + Intergenic
1153544190 18:6189068-6189090 TGATGTTCCCAGATGGAGTGTGG - Intronic
1153603061 18:6801165-6801187 TCATTTTTGTATATGGTGTGTGG + Intronic
1153669988 18:7402261-7402283 TGATTTTTGTATATGGTGTAAGG - Intergenic
1153825715 18:8872576-8872598 TAATTTTTTTATATGGTGTGAGG + Intergenic
1154371845 18:13770709-13770731 GGATTTTTGCATATGGTGTGAGG - Intergenic
1154372042 18:13772969-13772991 TGATTTTTGTTGATAGTGTGAGG + Intergenic
1154373038 18:13783221-13783243 TAATTTTTGCATATAGTGTGAGG - Intergenic
1154395631 18:13985752-13985774 TGATTTTTGTATATGGTGTAAGG - Intergenic
1154489749 18:14911290-14911312 TGATTATTATATATGGTGAGAGG + Intergenic
1155246735 18:23918057-23918079 TGATTTTTGCATATGGTGAAAGG + Intronic
1155373931 18:25135635-25135657 TAATTTTAACAGAGTGTGTGTGG + Intronic
1155598752 18:27518548-27518570 TAATTTTTATAAATGGTGTGAGG + Intergenic
1155599736 18:27531735-27531757 TGATTTTTATATAAGGTGTAAGG - Intergenic
1155773799 18:29733489-29733511 TGATTTTTGTATATGGTGTAAGG + Intergenic
1156024876 18:32641135-32641157 TAATCTTTACAGAAGCTGTGGGG + Intergenic
1156421516 18:36958995-36959017 TGTTTTTTTAATATGGTGTGAGG + Intronic
1156826815 18:41439796-41439818 TGATTTTTGTATATGGTGTAAGG + Intergenic
1157376347 18:47170093-47170115 TAATTTTTGAAGATGGTGTGAGG + Intronic
1157769270 18:50331100-50331122 TGAGTTTTGTATATGGTGTGAGG + Intergenic
1158310980 18:56158041-56158063 TTACTTTTTCAAATGGTGTGTGG - Intergenic
1158337613 18:56430675-56430697 TGATTTTTACATGTGGTATAAGG - Intergenic
1158472967 18:57754526-57754548 TGCCTTTTACAGCTGCTGTGAGG + Intronic
1158667431 18:59445205-59445227 TAATTTTTGCAGATGGTGTAAGG + Intronic
1158704154 18:59776280-59776302 TAATTTTTACATAAGGTGTAAGG - Intergenic
1158899014 18:61944550-61944572 TCATTTTTGCATATGGTGTGAGG + Intergenic
1158951559 18:62499856-62499878 ATATTTATACAGATGGTATGTGG + Intergenic
1159178459 18:64869537-64869559 TGATTTTTGTATATGGTGAGAGG + Intergenic
1159189269 18:65020487-65020509 TGATTTTTGTATATGGTGTGAGG + Intergenic
1159400155 18:67920934-67920956 TGATTTTTGTATATGGTGTAAGG + Intergenic
1159574708 18:70161322-70161344 TGATTTTTATATATGGTGAAAGG - Intronic
1159606600 18:70480796-70480818 TGATTTTTGTAAATGGTGTAGGG + Intergenic
1159846721 18:73469935-73469957 TAATTTTTGCAGAAGGTGTAAGG + Intergenic
1159853374 18:73554711-73554733 TGATTGTCATACATGGTGTGAGG - Intergenic
1159905609 18:74088368-74088390 TGATTTTTATATGTGGTGTAAGG + Intronic
1160736430 19:664651-664673 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1161629784 19:5347782-5347804 TGATTTTTGTATATGGTGTGAGG - Intergenic
1161647558 19:5463124-5463146 TGATTTTTGTGTATGGTGTGAGG + Intergenic
1161745216 19:6054704-6054726 TCATTTTTATGTATGGTGTGAGG - Intronic
1161758799 19:6155273-6155295 TAATTTTTGCATATGATGTGAGG - Intronic
1161868383 19:6851742-6851764 TGGTTTTTACCCATGGTCTGTGG + Intronic
1162684635 19:12371771-12371793 TGATTTTTGTATATGGTGTAAGG - Intergenic
1163383469 19:16984371-16984393 TAATTTTTTTATATGGTGTGAGG - Intronic
1163384978 19:16994141-16994163 TTATTTTTGTATATGGTGTGAGG - Intronic
1163659703 19:18569316-18569338 CGATGTTTACAGATGCTGTTGGG + Exonic
1164027867 19:21369545-21369567 TGATTTTTATATATAGTGTAAGG + Intronic
1164107891 19:22125051-22125073 TGCTTTTTTCAGAGGGTTTGTGG - Intergenic
1165083040 19:33321799-33321821 TAATTTTTGTATATGGTGTGAGG - Intergenic
1165208125 19:34208801-34208823 TAATTTGTACAGATGCTGGGGGG + Intronic
1165470937 19:36004186-36004208 TGATTTGTAGAGATGGGGGGAGG + Intronic
1165677732 19:37742651-37742673 TGATTGTTACATAAGGTGTAAGG - Intronic
1165703658 19:37958488-37958510 TAATTTTTGTATATGGTGTGAGG - Intronic
1165764112 19:38339781-38339803 TAATTTTTGTATATGGTGTGAGG + Intronic
1165822860 19:38687608-38687630 TAATTTTTGTATATGGTGTGAGG - Intronic
1165981083 19:39724667-39724689 TGATTTTTATATAAGGTGTAAGG - Intergenic
1166176058 19:41071099-41071121 TGATTTTTGTATATGGTGTGAGG + Intergenic
1166443932 19:42842435-42842457 TAATTTTTGCACATGGTGTTAGG - Intronic
1166530343 19:43539112-43539134 TTGTTTTTGCATATGGTGTGAGG - Intergenic
1166800205 19:45451976-45451998 TGTTTTTTAGAGATGGGGTCTGG + Intronic
1166969352 19:46553701-46553723 TAATTTTTGTATATGGTGTGAGG + Intronic
1168424459 19:56227753-56227775 TGCTTTTTAAAAAGGGTGTGTGG + Intronic
925419449 2:3700165-3700187 TGATTTTTGTATATGGTGTAAGG + Intronic
925431218 2:3795534-3795556 TGATTTTTGTATAAGGTGTGAGG + Intronic
925471180 2:4162653-4162675 TGATTTTTGTATAAGGTGTGAGG - Intergenic
925773377 2:7306717-7306739 TCATTTTTGCATATGGTGTAAGG + Intergenic
925951749 2:8920211-8920233 TGATTTTTATGTATGATGTGAGG + Intronic
926044725 2:9702049-9702071 TTATTTTTGGATATGGTGTGAGG + Intergenic
926129630 2:10294220-10294242 TAATTTTTGTATATGGTGTGAGG + Intergenic
926545091 2:14229979-14230001 TGATTTTTATAAATGGTGAAAGG + Intergenic
926696786 2:15775632-15775654 TAATTTTTGCATATGGTGTAAGG + Intergenic
926895707 2:17685578-17685600 TTATTTTTATGTATGGTGTGAGG - Intronic
926930040 2:18028040-18028062 TAATTTTTGCATATAGTGTGGGG + Intronic
927205484 2:20607121-20607143 TAATTTTTGCATATGGTATGAGG + Intronic
927282423 2:21320941-21320963 AGAATTTTACAGAGGGTGTGAGG - Intergenic
927457488 2:23267754-23267776 TTATTTTTGCATATGGCGTGAGG + Intergenic
927801583 2:26105046-26105068 TAATTTTTATATATGGTATGGGG + Intronic
927867657 2:26601498-26601520 TGATTTTTGTGTATGGTGTGAGG - Intronic
927912489 2:26911044-26911066 TAATTTTTATACATGGTATGTGG + Intronic
928010955 2:27607292-27607314 TAATTTTTATATATAGTGTGAGG + Intronic
928142592 2:28743283-28743305 TGATTTTTGCATATGATGTAAGG - Intergenic
928491113 2:31784258-31784280 TGATTTTTGTATATGGTGTAAGG - Intergenic
928916235 2:36474492-36474514 TAATTTTTGTATATGGTGTGAGG + Intronic
928955542 2:36863341-36863363 TGATTTTTATATATGGTATAAGG + Intronic
929017903 2:37518694-37518716 TAATTTTTGTGGATGGTGTGAGG + Intergenic
929109486 2:38394525-38394547 TGATTTTTATATATGGTGTAAGG - Intergenic
929367529 2:41178204-41178226 TGATTTTTGTATATGGTGTAAGG + Intergenic
929383007 2:41375018-41375040 TAATTTTTGTAGATGATGTGAGG + Intergenic
929718211 2:44335529-44335551 TGATTTGTATATATGGTGTAAGG - Intronic
929964440 2:46523402-46523424 TAATTTTTACATAAGGTGTAAGG + Intronic
930334930 2:50033451-50033473 TAATTTTTGTATATGGTGTGAGG - Intronic
930413748 2:51062550-51062572 TAATTTTTGTATATGGTGTGAGG - Intergenic
930476018 2:51883034-51883056 TGATTTTTGTATATGGTGTAAGG + Intergenic
930513474 2:52376149-52376171 TAATTTTTGCACATGGTGAGAGG + Intergenic
930546423 2:52772941-52772963 TGATTTTTGTATATGGTGTAAGG - Intergenic
930586399 2:53272258-53272280 TAATTTTTGCATATGGTGTAAGG - Intergenic
930594969 2:53376358-53376380 TGATTTTTATATATGGTATAAGG - Intergenic
930731488 2:54732460-54732482 TAATTTTTATATATGGTGTGAGG + Intronic
930839611 2:55831029-55831051 TGATTTTTGTATATGGTGTAAGG - Intergenic
930859762 2:56059079-56059101 TGATTTTTGTACATGGTGGGAGG + Intergenic
930943502 2:57042337-57042359 TGATTTTTATATATGGTGAAAGG - Intergenic
931016482 2:57987030-57987052 TAATTTTTGTATATGGTGTGAGG - Intronic
931331537 2:61290784-61290806 TAATTTTTGCATATGATGTGAGG - Intronic
931523838 2:63130277-63130299 TGATTTTTGTATATGGTGTAAGG + Intronic
931594962 2:63931479-63931501 TGATTTTTGTATATGGTGTAAGG - Intronic
931779929 2:65570429-65570451 TGATTTTTGTACATGGTGTAAGG + Intergenic
931943169 2:67275647-67275669 TTGTTTTTAAAGATGGTGAGTGG - Intergenic
931970989 2:67586188-67586210 TGAGTTGTACAGATCGTGTGAGG + Intergenic
932006807 2:67935507-67935529 TGATTTTTATATAAGGTGTAAGG - Intergenic
932267460 2:70380588-70380610 TAATTTTTGCATATGGTGTGAGG + Intergenic
932310817 2:70738862-70738884 TGATTTTTGTATATGGTGTAAGG - Intronic
932441662 2:71741100-71741122 TGATTTTTGTATATGGTGTAAGG - Intergenic
932554357 2:72807187-72807209 TGATTTTTGCACATGGTATAAGG + Intronic
932557491 2:72837902-72837924 TAATTTTTATAAATGCTGTGAGG + Intergenic
932560811 2:72867115-72867137 TAATTTTTGCATATGGTGTGAGG - Intergenic
932631696 2:73349804-73349826 TGATTTTTAGGTATGGTGTGAGG + Intergenic
932687147 2:73881261-73881283 TGATTTTTGTATATGGTGTAAGG + Intergenic
933050677 2:77597657-77597679 TGATTTTTATATAAGGTGTAAGG - Intergenic
933082007 2:78002130-78002152 TGATTTTTAGAGACGGAGTTTGG - Intergenic
933314138 2:80695822-80695844 TGATTTTTCCAGATGTTGGAGGG - Intergenic
933347830 2:81111836-81111858 TGATTTTTGTATATGGTGTAAGG - Intergenic
933447598 2:82402177-82402199 TAATTTTTGCATATGGTGTAAGG + Intergenic
933985310 2:87586055-87586077 TTATTTTTAAATATGGTGTGAGG + Intergenic
934045137 2:88167463-88167485 TAATTTCTGCATATGGTGTGAGG + Intergenic
934485436 2:94704442-94704464 TGATTTTTATATATGGTATAAGG + Intergenic
934534123 2:95118823-95118845 TAATTTTTATATATGGTGTGAGG - Intronic
934650296 2:96087049-96087071 TGAGTTTTATATATGGTGTGAGG - Intergenic
934733697 2:96676070-96676092 TAATTTTTGCATATGGTATGAGG + Intergenic
934813051 2:97300285-97300307 TGATTTTTATATAAGGTGTGGGG - Intergenic
934824644 2:97408195-97408217 TGATTTTTATATAAGGTGTGGGG + Intergenic
934931256 2:98426337-98426359 TAATTTTTGAATATGGTGTGAGG - Intergenic
934996139 2:98962532-98962554 TGATTTTTGCATATGGTGTAAGG + Intergenic
935133392 2:100278202-100278224 TGTTTTTTAAAGTTTGTGTGAGG - Exonic
935519606 2:104088075-104088097 AGAATTTTACATATGATGTGAGG + Intergenic
935587074 2:104810759-104810781 TGATTTTTGTATGTGGTGTGAGG - Intergenic
935711000 2:105898263-105898285 TGATTTTTGTATATGGTGTAAGG + Intergenic
935798284 2:106666898-106666920 TTACTTTTTCATATGGTGTGAGG + Intergenic
935923172 2:108037040-108037062 TGATTTTTGTATATGGTGTAAGG + Intergenic
936147435 2:109989962-109989984 TAACTTTTATAAATGGTGTGAGG + Intergenic
936197257 2:110381479-110381501 TAACTTTTATAAATGGTGTGAGG - Intergenic
936237700 2:110758058-110758080 TAATTTTTATATATGGTGTAAGG + Intronic
936274955 2:111087634-111087656 TGATTTTTGTATATGGTGTAAGG - Intronic
936308534 2:111364752-111364774 TTATTTTTAAATATGGTGTGAGG - Intergenic
936342784 2:111651589-111651611 TGATTTTTGTATATGGTATGAGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936590675 2:113800895-113800917 TAATTTTTATATATGGTGTCAGG + Intergenic
936700153 2:115002346-115002368 TGATTGTTATATATGGTATGAGG - Intronic
937144636 2:119633190-119633212 TAATTTATGTAGATGGTGTGAGG - Intronic
937397647 2:121552165-121552187 TGATTTTTATGTATGGTGTAAGG - Intronic
937406807 2:121637433-121637455 TAATTTTTGTACATGGTGTGAGG - Intronic
937410282 2:121669117-121669139 AGATTTCTACATATGGTGTGAGG - Intergenic
937586728 2:123560727-123560749 TAATTTTTGCATAAGGTGTGAGG + Intergenic
937830913 2:126422235-126422257 TGACTTTTGTATATGGTGTGAGG + Intergenic
937848344 2:126606939-126606961 TGATTTTTGTAAATGGTGTAAGG - Intergenic
937934765 2:127234351-127234373 TAATTTTTATATATGGTATGAGG - Intergenic
938130642 2:128713322-128713344 TAATTTTTGTAGATGGTGTTAGG + Intergenic
938655659 2:133430539-133430561 TAATTTTTACATATGATGAGAGG + Intronic
938665887 2:133536303-133536325 TAATTTTTATATATGGTGAGAGG + Intronic
938678130 2:133659316-133659338 TAATTTTTGTAGATGGTGTGAGG - Intergenic
938707742 2:133947520-133947542 TCATTTTTATATATAGTGTGAGG - Intergenic
938990217 2:136620417-136620439 TGATTTTTGTATATGGTGTAAGG + Intergenic
939288161 2:140159315-140159337 TGATTTTTGTATATGGTGTAAGG + Intergenic
939367708 2:141255818-141255840 GGATTTTTACATATGATGTTGGG - Intronic
939593140 2:144091187-144091209 TCATTTTTATATATGGTGGGAGG - Intronic
939610854 2:144308551-144308573 TAATTTTTATATATAGTGTGCGG - Intronic
939700972 2:145390122-145390144 TAATTTTTGTATATGGTGTGAGG + Intergenic
939899282 2:147830600-147830622 TCATTTTTACGTATGATGTGAGG + Intergenic
939921462 2:148119669-148119691 TAATTTTTATGTATGGTGTGAGG + Intronic
939987556 2:148845805-148845827 TAATTTTTCCACATGGTGTTAGG + Intergenic
940053751 2:149491951-149491973 TGATCTTTAGTGATTGTGTGAGG + Intergenic
940097820 2:149998064-149998086 TGATTTTTGTATATGGTGTAAGG - Intergenic
940132492 2:150398503-150398525 TGATTTTTGCATATGATGTAAGG + Intergenic
940208596 2:151233032-151233054 TGATTTTTGTATATGGTGTAAGG - Intergenic
940366585 2:152854936-152854958 TGATTTTTGTATATGGTGTAAGG + Intergenic
940458328 2:153930496-153930518 TGACTTTTACATATGGTGAAAGG + Intronic
940465002 2:154016318-154016340 TGATTTTTAAAGATTATGTTTGG + Intronic
940615427 2:156043462-156043484 TGATTTTTGTACATGGTATGAGG - Intergenic
940620112 2:156101828-156101850 TAATTTTTATACATGGTGTGAGG - Intergenic
940628754 2:156210612-156210634 TGATTTTTGTATATGGTGTAAGG + Intergenic
940629874 2:156224647-156224669 TGATTTTTATATATGGTGTAAGG - Intergenic
940785132 2:157972611-157972633 TGATATTTAAAGATGGGGTTAGG - Intronic
940806131 2:158188567-158188589 TAATTTTTATATATGGTGAGAGG - Intronic
940812527 2:158261343-158261365 TGATTTTTATATATGATGTAAGG - Intronic
940814496 2:158283103-158283125 TGATTTTTGTATAAGGTGTGAGG - Intronic
940948100 2:159641724-159641746 TGATTTTTGTATATGGTGTAAGG + Intergenic
941073602 2:160982663-160982685 TAATTTTTATATATGGTGTGAGG - Intergenic
941118308 2:161497899-161497921 TAATTTTTGTATATGGTGTGAGG + Intronic
941302240 2:163817102-163817124 TGATTTTTATATAAGGTGTAAGG + Intergenic
941541576 2:166792404-166792426 TGATTTTTGTATATGGTGTAAGG - Intergenic
941603408 2:167565331-167565353 TGATTTTTGCATAAGGTGTAAGG - Intergenic
941704810 2:168646704-168646726 TGATTTTTGTATATGGTGTAAGG + Intronic
941958068 2:171225035-171225057 TAATTTTTATATATGATGTGAGG - Intronic
942059790 2:172217651-172217673 TGTTTTTTAAAGATAGTGTCTGG + Intergenic
942216588 2:173726632-173726654 TGATTTTTGTATATGGTGTAAGG - Intergenic
942477699 2:176345456-176345478 TAATTTTAACGTATGGTGTGAGG + Intergenic
942626505 2:177906608-177906630 TGATTTTTGCAGATGTTTTGGGG + Intronic
942719597 2:178936266-178936288 TGATTTTTGCATATGGTGTAAGG + Intronic
942724074 2:178987292-178987314 TGATTTTTGTATATGGTGTAAGG - Intronic
942814853 2:180040811-180040833 TAGTTTTTGCATATGGTGTGAGG + Intergenic
942818579 2:180082630-180082652 TGACTTTTATATATGGTGTAAGG + Intergenic
942828363 2:180208300-180208322 TGATTTTTGTATATGGTGTAAGG + Intergenic
942917508 2:181329166-181329188 TGATTTTTGTATATGGTGTAAGG - Intergenic
942977868 2:182040821-182040843 TGATTTTTATATATAGTGAGAGG + Intronic
943092076 2:183387612-183387634 TGATTTTTGTATGTGGTGTGAGG + Intergenic
943490703 2:188552334-188552356 TGATTTTTATATATGGTGATAGG + Intronic
943799533 2:192040947-192040969 TATTTTTTGCAGATGGAGTGAGG - Intronic
944196439 2:197059315-197059337 TGATTTGTACAGCTTTTGTGAGG - Intronic
944268705 2:197757491-197757513 TAATTTTTGTATATGGTGTGAGG - Intronic
944364155 2:198896899-198896921 TGATTTTTATATATGGTGTAAGG - Intergenic
944416741 2:199486701-199486723 TGATTTTCAGAGTTAGTGTGGGG - Intergenic
944470126 2:200044425-200044447 TGATTTTTGTATATAGTGTGAGG - Intergenic
944537063 2:200721320-200721342 TGATTTTTGTGTATGGTGTGAGG - Intergenic
944607780 2:201368858-201368880 TGATTTTTATATATGGTGAAAGG - Intergenic
944765229 2:202857450-202857472 TAATTTTTATATAAGGTGTGAGG - Intronic
944774407 2:202948019-202948041 TTATTTTTGTATATGGTGTGAGG + Intronic
944969871 2:204979810-204979832 TGATTTTTGTATATAGTGTGAGG - Intronic
945344837 2:208701276-208701298 TGATTTTTATATATGGTGTAAGG + Intronic
945503890 2:210613933-210613955 TGATTTTGACAGAGAGTGTAAGG + Intronic
945523177 2:210854647-210854669 TGATTTTTGTATATGGTGTAAGG + Intergenic
945563185 2:211363548-211363570 TGATTTTTGTATATGGTGTAAGG - Intergenic
945578074 2:211557089-211557111 TGATTTTTGTATATGGTGTAAGG - Intronic
945623262 2:212169485-212169507 TGATTTTTGTATATGGTGTTAGG - Intronic
945747143 2:213732081-213732103 TGATTTTTGTTGATGGTGTAAGG + Intronic
946985124 2:225263646-225263668 TGATTTTTGTATATGGTGAGAGG - Intergenic
947021063 2:225676316-225676338 TAATTTTCACATATGGTGAGAGG + Intergenic
947198177 2:227590100-227590122 TGATTTTTGTATATGGTGTAAGG + Intergenic
947281117 2:228456112-228456134 TGATTTTTGTATATGGTGTAAGG + Intergenic
947474731 2:230433166-230433188 TGATTTATGCATATGGTGTGAGG + Intronic
947485434 2:230544117-230544139 TGATTTTTGTATATGGTGTAAGG - Intergenic
947512625 2:230771910-230771932 TAATTTTTAAATATGGTATGAGG - Intronic
947672880 2:231950826-231950848 TCATTTTTACGCATGGTGTGAGG - Intergenic
947677309 2:231994034-231994056 TAATTTTTATATATGGTCTGAGG + Intronic
947942064 2:234065861-234065883 TGATTTTTGCATATGTTGTGAGG + Intronic
947957835 2:234209770-234209792 TGATTTTTGTATATGGTGTAAGG + Intergenic
948152814 2:235757690-235757712 TGATTTTTACCAAGGTTGTGCGG + Intronic
948229514 2:236339575-236339597 TGATTTTTGTATATGGCGTGAGG + Intronic
948235348 2:236384827-236384849 TGATTTTTGCATAAGGTGTAAGG + Intronic
948324728 2:237105165-237105187 TGATTTTTACGTAGGGTGAGAGG - Intergenic
948418836 2:237839619-237839641 TGATTTTTGGATATGGTGTAAGG - Intronic
948432156 2:237926159-237926181 TAATTTTCACATATGGTGTGAGG - Intergenic
948914139 2:241022392-241022414 TAATTTTTGTATATGGTGTGAGG + Intronic
949067390 2:242001426-242001448 TTAATTTTACATATGATGTGAGG + Intergenic
1168770627 20:412954-412976 TAATTTTTATATAAGGTGTGAGG + Intronic
1169011500 20:2254938-2254960 TGTTTTGTAGAGATGGTGCGGGG + Intergenic
1169076603 20:2763717-2763739 TGATTTTTGTGTATGGTGTGAGG - Intergenic
1169097548 20:2916349-2916371 TAATTTTTATATATGGTATGAGG + Intronic
1169169172 20:3450370-3450392 TTATTTTTATTGATGGTATGAGG - Intergenic
1169299408 20:4429186-4429208 TAATTTTTATATATGGTATGAGG - Intergenic
1169466550 20:5846205-5846227 TGATTTGGACAGATTGTGGGAGG + Intronic
1169715382 20:8610872-8610894 TGATTTTTGCATATAGTGTGAGG + Intronic
1170053070 20:12168326-12168348 TGATTTTTACGTATGGTATAAGG + Intergenic
1170212302 20:13857651-13857673 TGAATTTAACACATGGAGTGGGG + Intronic
1170245900 20:14220901-14220923 TGCTTTTTTCAGAGGGTCTGTGG + Intronic
1170247548 20:14239658-14239680 TGATTTTTGTATATGGTGTAAGG - Intronic
1170273664 20:14557199-14557221 TAATTTTTATATATGGTGTAAGG - Intronic
1170611804 20:17920261-17920283 TAATTTTTGTAGAAGGTGTGGGG - Intergenic
1170694062 20:18642205-18642227 TGATTTTGACAGCTGTTTTGGGG - Intronic
1170769144 20:19317144-19317166 TGATTTTTGTACATGGTGTAAGG - Intronic
1170865917 20:20157591-20157613 TAATTTTTGTATATGGTGTGAGG - Intronic
1170953884 20:20961047-20961069 TAATTTTTATATATGGTGAGAGG - Intergenic
1171060402 20:21952213-21952235 TGATTTTTGTAGGTGGTGAGAGG + Intergenic
1171130750 20:22651041-22651063 TGATTTTTGTATATGGTGTAAGG + Intergenic
1171239746 20:23555945-23555967 TGATTTTTGTATATGGTGTAAGG + Intergenic
1171303861 20:24088055-24088077 TAATTTTTGCAGAGGGTGTAAGG + Intergenic
1171422671 20:25028591-25028613 TGATTTTTGTACAGGGTGTGAGG - Intronic
1171435832 20:25123631-25123653 TAATTTTTACGTATGGTGTAAGG - Intergenic
1171512726 20:25698974-25698996 TGATTTTTATATGTGGTGAGGGG + Intergenic
1171936782 20:31282130-31282152 TGATTTTTGCATATGGTATAAGG - Intergenic
1172627254 20:36354308-36354330 TGTTTTCTACAGATGGGGTCTGG - Intronic
1173055483 20:39608153-39608175 TGGTGTCTACAGATGATGTGTGG - Intergenic
1173057576 20:39630686-39630708 TGATTTTCCCAGATGGGCTGTGG + Intergenic
1173369474 20:42422028-42422050 TGATTTTTGTATATGGTGTAAGG - Intronic
1174178605 20:48660506-48660528 TTATTGTTGCATATGGTGTGAGG - Intronic
1174525017 20:51163662-51163684 TTATTTGTAGAGATGGTGGGGGG - Intergenic
1174607802 20:51773602-51773624 TGGTTGTCACAGCTGGTGTGAGG - Intergenic
1174618699 20:51857146-51857168 TAATTTTTGCATATGGTGTGAGG - Intergenic
1174928508 20:54787344-54787366 TGATTTTTATATAAGGTGTAAGG - Intergenic
1175046262 20:56108544-56108566 TGATTTTTGCATAAGGTGTAAGG - Intergenic
1175090417 20:56498894-56498916 TCATTTTTACAAATGCTGTTTGG + Intronic
1175472542 20:59241078-59241100 TAATTTCTACAGCTGGTGTGAGG + Intronic
1175513297 20:59550106-59550128 TGATTTTTGTATATGGTGTAAGG - Intergenic
1175631729 20:60544908-60544930 TGATTTTCATATATGGTGAGAGG + Intergenic
1175638772 20:60608794-60608816 TGATTTTTCTATATGGTGTAAGG - Intergenic
1176051662 20:63123026-63123048 TAATTTTTGCATATGGTGTGAGG + Intergenic
1176737608 21:10565831-10565853 TGATTTTTGTATATGGTGAGAGG - Intronic
1177022567 21:15881536-15881558 TGATTTTTGTATATGGTGTAAGG + Intergenic
1177104558 21:16938372-16938394 TGATTTTCATATATGGTGAGAGG + Intergenic
1177113813 21:17061398-17061420 TGATTTTTCATGCTGGTGTGGGG - Intergenic
1177211758 21:18080497-18080519 TGATTTTTGTATATGGTGAGAGG + Intronic
1177493287 21:21856052-21856074 TGATTTTTGTATATGGTGTAAGG + Intergenic
1177526809 21:22303669-22303691 TGATTTTTGTACATGGTGTAAGG - Intergenic
1177581803 21:23033078-23033100 TGATTTTTGTATATGGTGTAAGG + Intergenic
1177813113 21:25946055-25946077 TAATTTTCATATATGGTGTGAGG - Intronic
1178212188 21:30548443-30548465 TGATTTTTGTATATGGTGTAAGG + Intronic
1178260456 21:31095305-31095327 TAATTTTTATATATGGAGTGAGG + Intergenic
1178574848 21:33777137-33777159 TGATTTTTGCAGATAGTATAAGG + Intronic
1178628335 21:34237272-34237294 TGATTTTTGTATATGGTGTAAGG - Intergenic
1178811901 21:35891905-35891927 TGATTATTACAGATGCTATTGGG + Intronic
1178986396 21:37307246-37307268 TAATTTTTATATATAGTGTGAGG + Intergenic
1180191591 21:46167775-46167797 TAATTTTCATATATGGTGTGAGG - Intronic
1180193019 21:46177088-46177110 TGATTTTTGTATATGGTGTAAGG - Intronic
1180886347 22:19247162-19247184 TTATTTTTGTACATGGTGTGAGG + Intronic
1180977679 22:19858408-19858430 TCATTTTTACATACGGTGTTAGG + Intergenic
1181416390 22:22762427-22762449 TGATATATAAAGATGGTGAGCGG + Intronic
1181994578 22:26866034-26866056 TGATTTTTGTATATGGTGTGAGG + Intergenic
1182118477 22:27771999-27772021 TGATTTTTCCAGCAGGTGAGTGG - Intronic
1182140957 22:27957811-27957833 TAATTTTTGAATATGGTGTGAGG - Intergenic
1182170816 22:28227214-28227236 TGATTTTTATGTATGGTGTAAGG - Intronic
1182195461 22:28511482-28511504 TGATTTTTGTATATGGTGTAAGG - Intronic
1182384635 22:29927001-29927023 TAATTTTTGTATATGGTGTGAGG + Intronic
1182920990 22:34078722-34078744 TGATTTTTTCATTTGCTGTGCGG - Intergenic
1183025123 22:35059007-35059029 TGATTTTTGTATATGGTGTAAGG - Intergenic
1184935990 22:47721319-47721341 TTTTTTTTGCATATGGTGTGAGG + Intergenic
1185265277 22:49898980-49899002 TAATTTTTTAACATGGTGTGAGG - Intergenic
949393720 3:3592054-3592076 TAATTTTTGCATATGGTGTAAGG - Intergenic
949434340 3:4012176-4012198 TAATTTTTACATATGGTGAAAGG - Intronic
949633023 3:5949943-5949965 TCATTTCTGCAGATGTTGTGTGG - Intergenic
949913301 3:8934119-8934141 TGATTTTAGCATATGTTGTGAGG - Intronic
950341511 3:12249918-12249940 TGGTTTTTGTATATGGTGTGAGG - Intergenic
950564160 3:13755789-13755811 TAATTTTTGTATATGGTGTGAGG + Intergenic
950947774 3:16967929-16967951 TGATTTTTGCATATGGTATAAGG + Intronic
951055064 3:18138029-18138051 TGGTTTTTGAAGATGGTTTGTGG - Intronic
951070405 3:18321655-18321677 TGATTTTTATATGTGGTGTAAGG + Intronic
951182276 3:19672421-19672443 TGATTTTTCTATATGGTGAGAGG - Intergenic
951227603 3:20139074-20139096 TCATTTGTAGAGATGGTGAGGGG + Intronic
951393448 3:22135947-22135969 TGATTTTTATATAAAGTGTGAGG - Intronic
951775230 3:26302953-26302975 TGATTTTTGCATATGGTATAAGG + Intergenic
951816374 3:26759656-26759678 TGATTTTTGCATAAGGTGTAAGG - Intergenic
951842945 3:27053657-27053679 TGATTTTTGTATATGGTGTGGGG + Intergenic
951858130 3:27220995-27221017 TAATTTTTGCATATGGTATGAGG - Intronic
951865460 3:27301977-27301999 TGATTTTTGTGTATGGTGTGTGG + Intronic
951998024 3:28753199-28753221 TGATTTTTGCATATTGTGTAAGG - Intergenic
952022038 3:29034665-29034687 TAATTTTTATATAAGGTGTGAGG + Intergenic
952327089 3:32330815-32330837 TAATTTTTATACATGGTGTCAGG - Intronic
952340762 3:32444223-32444245 TGTTTTTTGCATAGGGTGTGAGG + Intronic
952459108 3:33505454-33505476 TAATTTTTGTATATGGTGTGAGG - Intronic
952475227 3:33702434-33702456 TAATTTTTATGTATGGTGTGAGG - Intronic
952546606 3:34426829-34426851 TGATATTTAAATATGGTGTAAGG - Intergenic
952992049 3:38839022-38839044 TAATTTTTGTATATGGTGTGAGG + Intergenic
953008813 3:39004187-39004209 TGATTTTTGTATATGGTGTAAGG + Intergenic
953047905 3:39312113-39312135 TAATTTTTGCATAAGGTGTGAGG - Intergenic
953104662 3:39865127-39865149 TGATTTTTGCATATAGTGTAAGG - Intronic
953219208 3:40953102-40953124 TGATTTTTATATATGTTGTGAGG + Intergenic
953235831 3:41105230-41105252 TAATTTTTATATAAGGTGTGAGG + Intergenic
953299666 3:41759925-41759947 TAATTTTTGCATATGGAGTGAGG - Intronic
953523336 3:43664355-43664377 TGATTTTTATATAAGGTGTAAGG - Intronic
953541161 3:43819704-43819726 TGATTTTTGTATATGGTGTAAGG + Intergenic
953617462 3:44504108-44504130 TTATTTTTATAGATGGAGTGAGG - Intronic
953667466 3:44935839-44935861 TGATTTTTGTATATGGTGTAAGG - Intronic
953836143 3:46346437-46346459 TAATTTTTGCATATGATGTGAGG + Intergenic
954495417 3:50954989-50955011 TGATTTTTTTATATGGTGTAAGG + Intronic
954509619 3:51111555-51111577 TGATTTTTACATATGGTATAAGG - Intronic
954515179 3:51168566-51168588 TGATTTTTGTATATGGTGTAAGG - Intronic
954611473 3:51946737-51946759 TTATTTTTTCAGATGGAGTCTGG - Intronic
954741652 3:52756578-52756600 TAATTTTTATATATGGTGTTAGG - Intronic
954830223 3:53415077-53415099 TGATTTTTATACATGGTTTGGGG + Intergenic
955119114 3:56037922-56037944 TGATTTTTGTATAAGGTGTGAGG - Intronic
955428876 3:58821118-58821140 TGATTTTTATATAAGGTGTAAGG - Intronic
955452266 3:59082018-59082040 TAGTTTTTATAGATGGTATGAGG + Intergenic
955636364 3:61034090-61034112 TAATTTTTATATATGGTGTGAGG - Intronic
955680892 3:61500684-61500706 AGATTTTTATATATGGTGTAAGG + Intergenic
956266401 3:67401251-67401273 TGATTTTGAAATATTGTGTGAGG - Intronic
956355111 3:68382385-68382407 TGATTTTTGTATATAGTGTGAGG + Intronic
956496785 3:69835642-69835664 TGATTTTTGTATATGGTGAGAGG + Intronic
956715707 3:72078102-72078124 TGAATATTTCAGATGTTGTGCGG + Intergenic
956920283 3:73920996-73921018 TGATTTTTGTATAAGGTGTGAGG - Intergenic
957020497 3:75121018-75121040 TGATTTTTGTATAAGGTGTGAGG + Intergenic
957160109 3:76600210-76600232 TGATTTTTGTATATGGTGTAAGG + Intronic
957432963 3:80137508-80137530 TGATTTTTGCATATGGTGTAAGG - Intergenic
957584615 3:82117760-82117782 TGATTTTTATATAAGGTGTAAGG - Intergenic
957628347 3:82684487-82684509 TGACTTTTGTAGATGGTATGAGG + Intergenic
957951474 3:87132746-87132768 TGATTTTTGAATATGGTGTAAGG + Intergenic
958090889 3:88874673-88874695 TGATTTTTATATAAGGTGTAAGG - Intergenic
958143818 3:89598449-89598471 TGCTTTTTACAGATGAGATGCGG - Intergenic
958266257 3:91440916-91440938 TGATTTTTAAAAATGTTTTGAGG + Intergenic
958268197 3:91464977-91464999 TGATTTTTTTATATGGTGTAAGG + Intergenic
958448116 3:94239834-94239856 TGATTTTTGTATATGGTGTAAGG + Intergenic
958605958 3:96358736-96358758 TGATTTTTGCTTATAGTGTGAGG - Intergenic
958626907 3:96637932-96637954 TGATTTTTACATATGGTGAAAGG - Intergenic
958849803 3:99310937-99310959 TGATTTTTCTATATGGTGTAAGG - Intergenic
958998333 3:100932179-100932201 TGATTTTTATATATGGTGAAAGG - Intronic
959264188 3:104117131-104117153 TGATTTTTGTATATGGTGTAAGG - Intergenic
959286533 3:104419436-104419458 TAATTTTAATACATGGTGTGAGG + Intergenic
959301630 3:104609563-104609585 TGATTTTTGCATATGCTGTAAGG - Intergenic
959392739 3:105796417-105796439 TGATTTTTATGTATGGTGTAAGG - Intronic
959510390 3:107204142-107204164 TGATTTTTGTATATGGTGTAAGG - Intergenic
959535417 3:107479490-107479512 TAATTTTTGTATATGGTGTGAGG - Intergenic
959636083 3:108572358-108572380 TGATTTTTGCATTTGGTATGAGG + Intronic
959734118 3:109638356-109638378 TGATTTTTATAGATAGTGTAAGG + Intergenic
959779142 3:110207050-110207072 TGATTTTCATATATGGTGTAAGG - Intergenic
959879532 3:111427773-111427795 TGAGTTTTGTAGATGGTGTAAGG - Intronic
959898429 3:111631952-111631974 TGATTTTTGTATATGGTGTAAGG - Intronic
959980109 3:112506638-112506660 TGCTTATCACAGCTGGTGTGGGG + Intergenic
960013068 3:112854462-112854484 TGATTTTTGTATATGGTGTAAGG - Intergenic
960013714 3:112861473-112861495 TAATTTTTGTATATGGTGTGAGG + Intergenic
960077828 3:113508107-113508129 TAATTTTTGAATATGGTGTGAGG - Intronic
960118484 3:113922442-113922464 TGATTTTTATATATGGTGTAAGG + Intronic
960502085 3:118450154-118450176 TGATTTTTGTATATGGTGTAAGG + Intergenic
960559224 3:119064230-119064252 TAATTTTTATAAATGGTATGAGG + Intronic
960646894 3:119895576-119895598 TAATTTTTGTATATGGTGTGAGG + Intronic
960658685 3:120034391-120034413 TAATTTTTGTAGATGGTATGAGG + Intronic
960881024 3:122345033-122345055 TAATTTTTGTATATGGTGTGAGG + Intergenic
961418792 3:126782901-126782923 TGATTTTTGTATATGGTGTAAGG + Intronic
961606773 3:128101464-128101486 TGCTTTCTTCAGAGGGTGTGGGG - Intronic
962047858 3:131779658-131779680 TGATTTTTATATATGGTGACAGG - Intronic
962397163 3:135026380-135026402 TGATTTTTGTATATGGTGTAAGG + Intronic
962472703 3:135726873-135726895 TGATTTTTGTATATGGTGTAAGG + Intergenic
962478240 3:135776347-135776369 TGATTTTTATATATGGTGAAAGG - Intergenic
962639262 3:137366677-137366699 TGACTTTTGTACATGGTGTGAGG - Intergenic
962655239 3:137537281-137537303 TGATTTTTATATATGGTGTAAGG + Intergenic
962913218 3:139874169-139874191 TAATTTTAATATATGGTGTGGGG - Intergenic
963191009 3:142473265-142473287 TGATTTTTGTATATGGTGTAAGG + Intronic
963197697 3:142551648-142551670 TAATTTTTGTATATGGTGTGAGG - Intronic
963259899 3:143181415-143181437 TAATTTTTATATATGGTGTAAGG + Intergenic
963478195 3:145833396-145833418 TAATTTTTACATGTGGCGTGAGG - Intergenic
963517230 3:146323699-146323721 TGATTTTTGCATAAGGTGTAAGG - Intergenic
963653800 3:148019532-148019554 TGATTTTTGTATATGGTGAGAGG - Intergenic
963979697 3:151523641-151523663 TGATTTTTGTATATGGTGTAAGG - Intergenic
964054425 3:152435206-152435228 TGATTTTTGTATATGGTGTAAGG + Intronic
964080597 3:152750866-152750888 TGATTTTTGTATATGGTGTGAGG - Intergenic
964255431 3:154770063-154770085 TGATTTTTATGTATGGTGTAAGG + Intergenic
964705612 3:159615651-159615673 TGACCTTGGCAGATGGTGTGGGG + Intronic
964941450 3:162161104-162161126 TAATTTTTGTAGAGGGTGTGAGG + Intergenic
965392848 3:168126888-168126910 TGATTTTTGTGTATGGTGTGAGG - Intergenic
965775807 3:172229986-172230008 TAATTTTTGCATATGATGTGAGG - Intronic
965982837 3:174713967-174713989 TAATTTTTATATAAGGTGTGAGG + Intronic
966166814 3:177028990-177029012 TGATTTTTATATATGGTGTGAGG - Intronic
966230602 3:177647700-177647722 TGGTTCTCACAGAGGGTGTGTGG + Intergenic
966323248 3:178724670-178724692 TAATTTTTGCATATGGTGAGAGG + Intronic
966475779 3:180344174-180344196 TGATTTTTGCATAGGGTGAGAGG + Intergenic
966515809 3:180820126-180820148 TGATTTTTATATATGGTGAAAGG - Intronic
966541189 3:181091651-181091673 TGATTTTTATATATGGTGTAAGG + Intergenic
966844751 3:184119878-184119900 TGATTTTTGTGTATGGTGTGAGG - Intergenic
966988681 3:185206311-185206333 TGATTTTTATATATGGTGCTAGG - Intronic
967077678 3:186018882-186018904 TGATTTTTGTATATGGTGTAAGG - Intergenic
967288317 3:187895040-187895062 TGATTTTTGCATAAGGTGTAAGG - Intergenic
967292906 3:187938869-187938891 TTTTTTGTACAGATGGTGGGGGG + Intergenic
967445204 3:189557505-189557527 TAATTTTTATATATGGTGTGAGG - Intergenic
967635993 3:191804006-191804028 TAATTTTTACATATGGTGTCAGG - Intergenic
968081915 3:195852326-195852348 TGATGTTTAAACATGGTATGTGG + Intergenic
968718771 4:2182642-2182664 TAATTTTTGCATATGGTGTGAGG - Intronic
968792501 4:2677114-2677136 TCATTTTTATATATGGTGTTAGG + Intronic
968819629 4:2840369-2840391 GGTTTTTTGCATATGGTGTGAGG + Exonic
969082542 4:4630351-4630373 TAGTTTTTATTGATGGTGTGAGG + Intergenic
969911675 4:10453139-10453161 TCATTTATACAGCTGATGTGAGG + Intronic
969952207 4:10849309-10849331 TGATTTTTGTATATGGTGTAAGG + Intergenic
970058591 4:12003516-12003538 TGATTTTTATATATGGTGTAAGG - Intergenic
970196129 4:13551578-13551600 TGATTTTTATATGTGGTGTAAGG - Intergenic
970571872 4:17391438-17391460 TAATTTTTATATATGGTGTAAGG + Intergenic
970624579 4:17862698-17862720 TGATTTTTGTATATGGTGTAAGG - Intronic
970678772 4:18483361-18483383 TGATTTTTATGTATGGTGTAAGG + Intergenic
970712820 4:18883789-18883811 TAATTTTTTTATATGGTGTGAGG - Intergenic
970901573 4:21165526-21165548 TAATTTTTGTACATGGTGTGAGG - Intronic
971033361 4:22665876-22665898 TAATTTTTATAGATGGTGTGAGG + Intergenic
971102928 4:23488124-23488146 TGATTTTTGTACATGGTGTAAGG + Intergenic
971106417 4:23529362-23529384 TGATTTTTGCATATGGTGTAAGG - Intergenic
971805007 4:31345894-31345916 TGGTTTTTGCATATGGTGTGAGG - Intergenic
972087118 4:35232515-35232537 TGATTTTTGTATATGGTGTAAGG + Intergenic
972147378 4:36044526-36044548 TGATTCTTATATATGGGGTGAGG - Intronic
972480373 4:39490824-39490846 TGATTTTAAAAAATGCTGTGTGG - Intergenic
972823828 4:42733414-42733436 AGATATTTAAAGATGTTGTGTGG + Intergenic
972859975 4:43155839-43155861 TGATTTTTATATATGGTGAAAGG + Intergenic
972919095 4:43916027-43916049 TGATTTTTGCTTATGGTGTAAGG - Intergenic
973012258 4:45091751-45091773 TGATTTTTGTATATGGTGTAAGG - Intergenic
973046882 4:45544993-45545015 TGATTTTTGTATATGGTGTAAGG - Intergenic
973062071 4:45739569-45739591 TGATTTTTGTATATGGTGTAAGG + Intergenic
973129396 4:46631684-46631706 TGATTTTTATATATGGTATAAGG + Intergenic
973203212 4:47529306-47529328 TAATTTTTGTAGATGGTGAGAGG + Intronic
973269450 4:48246728-48246750 TAATTTTTGTATATGGTGTGAGG - Intronic
973345818 4:49054173-49054195 TGATTTTTGTATATGGTATGAGG + Intronic
973554146 4:52065457-52065479 TGATTTTTGCATAAGGTGAGAGG + Intronic
973600136 4:52534148-52534170 TGATTTTTGTATATGGTGTAAGG - Intergenic
973724454 4:53760890-53760912 TGATTTTTGTATATGGTGTGAGG - Intronic
973922224 4:55699400-55699422 TGAGTTTTTTACATGGTGTGAGG - Intergenic
973935113 4:55838091-55838113 TAATTTTTGTATATGGTGTGAGG - Intergenic
973963576 4:56136997-56137019 TGATTTTTGACAATGGTGTGAGG - Intergenic
974032163 4:56786080-56786102 TGATTTTTGTATATGGTGTAAGG + Intergenic
974063785 4:57058572-57058594 TAATTTTTTCATATGGTGTAAGG - Intronic
974239840 4:59232673-59232695 TGATTTTTGTACATGGTGTAAGG + Intergenic
974248584 4:59355937-59355959 TGATTTTTGTACATGGTGTAAGG + Intergenic
974297103 4:60014689-60014711 TGATTTTTGTAAATGGTGTAAGG + Intergenic
975022600 4:69507683-69507705 TGATTTTTGTATATGGTGTAAGG - Intronic
975187800 4:71423815-71423837 TGATTTTTGCATAAGGTGTAAGG - Intronic
975298007 4:72756348-72756370 TGATTTTTGTATATGGTGTAAGG - Intergenic
975478479 4:74850288-74850310 TGATTTTTGTATATGGTGTAAGG + Intergenic
975679320 4:76860116-76860138 TAATTTTTGCATATAGTGTGAGG - Intergenic
975774299 4:77767666-77767688 TGATTTTTAAATATAGTATGAGG - Intronic
976001728 4:80382133-80382155 TGATTTTTGAATATGGTGTGAGG - Intronic
976015909 4:80554158-80554180 TGATTTTTGTATATGGTGTAAGG + Intronic
976322347 4:83730330-83730352 TGATTTTTGTATATGGTGTAAGG - Intergenic
977051606 4:92135199-92135221 TGATTTTTATATATAGTGAGGGG - Intergenic
977167270 4:93715097-93715119 TGATTTTTGTATATGGTGTAAGG + Intronic
977183749 4:93910463-93910485 TGATTTTTGTACATGGTGTAAGG + Intergenic
977482946 4:97601594-97601616 TGATTTTTCTATATGGTGTAAGG + Intronic
977752486 4:100626105-100626127 TAATTTTTAAATATGGTGTAAGG - Intronic
978004395 4:103598620-103598642 TGATTTTTATATAAGGTGTAAGG + Intronic
978079955 4:104580083-104580105 AGATTTTAATAAATGGTGTGAGG + Intergenic
978214983 4:106189172-106189194 TAATTTTTACAGATGGGTGGGGG + Intronic
978305379 4:107322845-107322867 TGATTTTTGCATATAGTGTAAGG + Intergenic
978656573 4:111072630-111072652 TGATTTTTTAATATGGTGTAAGG - Intergenic
978693723 4:111549426-111549448 TGATTTTTGTATATGGTGTAAGG - Intergenic
978805897 4:112799983-112800005 TTAATTTTACATGTGGTGTGTGG - Intergenic
979076681 4:116279606-116279628 TGATTTTAGCATATGGTGTAAGG - Intergenic
979086393 4:116415931-116415953 TGATTTTTGTATATGGTGTATGG + Intergenic
979160430 4:117453037-117453059 TAATTTTTGTATATGGTGTGAGG - Intergenic
979428686 4:120599846-120599868 TGATTTTTGTATATGGTGTAAGG - Intergenic
979471299 4:121100705-121100727 TGATTTTTATGCATGGTGTGAGG + Intergenic
979541532 4:121889123-121889145 TGATTTTTGTATATGGTGAGAGG - Intronic
979712679 4:123798661-123798683 GAATTTTTACATATGGTGTAAGG + Intergenic
979861428 4:125698145-125698167 TGATTTTTGTATATGGTGTAAGG - Intergenic
979968927 4:127110679-127110701 TGATTTTTGTATATGGTGTAAGG - Intergenic
980024301 4:127746939-127746961 TGATTTTTATATATGGTGTAAGG + Intronic
980037374 4:127900718-127900740 TGATTTTTATATAAGGTGTAAGG + Intergenic
980328955 4:131386452-131386474 TAATTTTTACTTATGGTGTAAGG + Intergenic
980477468 4:133336063-133336085 TAATTTTTGTAGATGGTGTAAGG + Intergenic
980539291 4:134172485-134172507 TGATTTTTGCATATGGTGTAAGG - Intergenic
980598732 4:134990881-134990903 TGATTTTTAGATATGGGGTTTGG - Intergenic
980647308 4:135658956-135658978 TGATTTTTGTATATGGTGTAAGG + Intergenic
980740603 4:136946067-136946089 TGATTTTTGTATATGGTGAGAGG + Intergenic
980762542 4:137254782-137254804 TAATTTTTATAAATGGTGAGAGG + Intergenic
980824837 4:138060784-138060806 TGATTTTTGTATATGGTGTGAGG + Intergenic
981062897 4:140445695-140445717 TGATTTTTGTATATGGTGTAAGG + Intronic
981158038 4:141463246-141463268 TGATTTTTGCTTATGGTGTAAGG + Intergenic
981241254 4:142478821-142478843 TGATTGTTGCATATGGTGTAAGG - Intronic
981302291 4:143201354-143201376 TGATTTTTGTATATGGTGTAAGG - Intronic
981388530 4:144159857-144159879 TGATTTTTACATGTGGTTTAAGG + Intergenic
981399570 4:144297836-144297858 TTAATTTTACATATTGTGTGAGG + Intergenic
981448019 4:144863111-144863133 TGATTTTTATATATGGTGTAAGG - Intergenic
981924022 4:150117781-150117803 TGCTTTTTTCAGAGGGTCTGTGG + Intronic
981976070 4:150729970-150729992 TGATTTTTACATAAGGTGTGAGG - Intronic
982079419 4:151773287-151773309 TAATTTTTATATATGGTGTGAGG + Intergenic
982107922 4:152026806-152026828 TAATTTTTCTATATGGTGTGAGG - Intergenic
982187454 4:152817436-152817458 TAATTTTTGTATATGGTGTGAGG - Intronic
982294740 4:153815957-153815979 TGATTTTTGTCTATGGTGTGAGG + Intergenic
982547752 4:156756619-156756641 TAATTTTTACATATGGTATGAGG + Intergenic
982902930 4:161029800-161029822 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
982971594 4:161995051-161995073 TGATTTTTGCATATGGTGTAAGG + Intronic
983053091 4:163071117-163071139 TGATTTTTGTATATGGTGTAAGG - Intergenic
983439150 4:167758841-167758863 TGATTTTTGTATATGGTGTGAGG - Intergenic
983482658 4:168294234-168294256 TGCTTTTTGCATATGGTGTGAGG - Intronic
983612676 4:169667159-169667181 TAATTTTTATATATGGTGTGAGG + Intronic
983985731 4:174058688-174058710 TAATTTTTGTGGATGGTGTGAGG - Intergenic
984038081 4:174693324-174693346 TGATTTTTGTATATGGTGTAAGG + Intronic
984057294 4:174945659-174945681 TGATTTTTGTATATGGTGTAAGG + Intronic
984308059 4:178019872-178019894 TGATTTTTGTATAAGGTGTGAGG - Intergenic
985000593 4:185478599-185478621 TGATTTTTATACAGAGTGTGAGG + Intergenic
985378545 4:189367888-189367910 GGATCTTTACAGCTGGTTTGTGG - Intergenic
985978663 5:3443875-3443897 TGATTTTTATATAAGGTGTAAGG - Intergenic
986101940 5:4620247-4620269 TGATTTTTATATAAGGTGTAAGG - Intergenic
986217524 5:5733673-5733695 TGATTTTTGCATATGGTATGAGG + Intergenic
986967414 5:13290977-13290999 TGCTTTTTGCATATGGTGTAAGG - Intergenic
986984953 5:13490168-13490190 TGATTTTTTTATATGGTGTAAGG + Intergenic
987260858 5:16201392-16201414 TGATTTTTGTATATGGTGTAAGG - Intergenic
987400831 5:17474815-17474837 TGATTTTTGCATATGGTCTAAGG - Intergenic
987430364 5:17825438-17825460 TGATTTTTATATGTGGTGTAAGG - Intergenic
987513365 5:18872540-18872562 TGATTTTTGTATATGGTGTAAGG - Intergenic
987553151 5:19409958-19409980 TGATTTTTGTATATGGTGTAAGG + Intergenic
987572321 5:19680251-19680273 TGATTTTTTTATATGGTGTAAGG - Intronic
988408926 5:30860999-30861021 TGATTTTTGAATATAGTGTGAGG - Intergenic
988689131 5:33554767-33554789 TGAATTTTACAGATTGTCTATGG - Intronic
988955497 5:36312448-36312470 TGTTTTTTTCAGATGTTGAGTGG + Intergenic
989046420 5:37278167-37278189 TAATTTTCACATATGGTGTGAGG + Intergenic
989086370 5:37680565-37680587 TGATTTTTGTACATGGTGTAAGG + Intronic
989297359 5:39845414-39845436 TGATTTTTACATAGGGTAAGAGG + Intergenic
989298977 5:39865858-39865880 TTATTTTTGCATATGGTGTAAGG + Intergenic
989322470 5:40152400-40152422 TGATTTTTGCATATGGTGAGAGG - Intergenic
989342037 5:40387056-40387078 TGATTTTTACAGATGGGGTCAGG + Intergenic
989370784 5:40705299-40705321 TGATTTTTGTATATGGTGTAAGG - Intergenic
989428274 5:41321903-41321925 TGATTTTTGTATATGGTGAGAGG - Intronic
989461062 5:41698426-41698448 TGATTTTTTTATATGGTGTCAGG - Intergenic
989526409 5:42458452-42458474 TGATTTTTTTATATGGTGTAAGG - Intronic
989559388 5:42833840-42833862 TGATTTTTTTATATGGTGTAAGG - Intronic
989653853 5:43722788-43722810 TGATTTTTGCATAAGGTGTAAGG - Intergenic
989734059 5:44681544-44681566 TGATTTTTGTATATGGTGTAAGG - Intergenic
989738522 5:44739253-44739275 TGATTTTTGTATATGGTGTAAGG - Intergenic
989778362 5:45235662-45235684 TGATTTTTGTATATGGTGAGAGG + Intergenic
990089650 5:52026238-52026260 TGATTTTTGTATATGGTGTAAGG - Intronic
990090250 5:52036593-52036615 TTACTTTTGCATATGGTGTGAGG - Intronic
990434511 5:55774684-55774706 TCATTTTTATAGATGGTGTAGGG + Intronic
990483959 5:56239437-56239459 TGATTTTTGTACATGGTGTAAGG - Intergenic
990562721 5:56999485-56999507 TAATTTTTACATAAGGTGTGAGG - Intergenic
990606317 5:57413837-57413859 TAATTTTTAAGGATGGTTTGTGG + Intergenic
991158280 5:63464175-63464197 TGATTTTTATGCATGGTGTAAGG - Intergenic
991177058 5:63701285-63701307 TGATTTTTGTATATGGTGTAAGG - Intergenic
991208871 5:64081868-64081890 TAATTTTTATATATGGTGAGAGG + Intergenic
991267468 5:64738801-64738823 TGATTTTTATATATGGCATGAGG - Intronic
991268062 5:64746194-64746216 TAATTTTTACATATAGTCTGAGG - Intronic
991285288 5:64967742-64967764 TGATTTTTATATATGGCGTAAGG - Intronic
991460987 5:66858356-66858378 TGATTTTTGAGTATGGTGTGAGG + Intronic
991558207 5:67920218-67920240 TGATTTTTGTACATGGTGTAAGG + Intergenic
992290513 5:75274822-75274844 GGATTTTAACTGATGGTGAGGGG - Intergenic
992355783 5:75981692-75981714 TGATTTTTGTAAATGGTGTAAGG - Intergenic
992705293 5:79385082-79385104 TGATTTTCATATATGGTGAGAGG - Intronic
993281165 5:85926255-85926277 TGATTTTTATATATAGTGTAAGG - Intergenic
993310312 5:86322558-86322580 TGATTTTTGTATATGGTGTAAGG - Intergenic
993389789 5:87305466-87305488 TAATTTTTGCATATGGTGTAAGG - Intronic
993425456 5:87758472-87758494 TGATTTTTGAATATGGTGTAAGG + Intergenic
993465743 5:88244301-88244323 TGATTTTTGTACATGGTGTAAGG + Intronic
993558335 5:89370079-89370101 TGATTTTTATATATGATGAGAGG - Intergenic
993967793 5:94379270-94379292 TGATTTTTGTATATGGTGTAAGG + Intronic
994113840 5:96039539-96039561 TGATTTTTGCATAAGGTGTGAGG + Intergenic
994204369 5:97017583-97017605 TGATTTTTGTGGATGGTGTGAGG + Intronic
994309759 5:98255387-98255409 TGATTTTTGTATATGGTGTAAGG + Intergenic
994346339 5:98691846-98691868 TAATTTTTGCATATGGTGTGAGG + Intergenic
994378536 5:99042596-99042618 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
994403999 5:99320203-99320225 TGATTTTTGTATATGGTGTAAGG + Intergenic
994441090 5:99803694-99803716 TGATTTTTGTATATGGTGAGAGG - Intergenic
994517023 5:100785001-100785023 TAATTTTTACATAAGGTGTAAGG - Intergenic
994672238 5:102776502-102776524 TAATTTTTATATAAGGTGTGAGG + Intronic
994695754 5:103071637-103071659 TGATTTCTGTATATGGTGTGAGG + Intergenic
994808532 5:104481851-104481873 TAATTTTTATAGATGGTGTTGGG - Intergenic
994876667 5:105431926-105431948 TAATTTTTGCATATGTTGTGTGG + Intergenic
994954115 5:106505692-106505714 TGCTTTTTATATATGGTGTGAGG - Intergenic
995001265 5:107133008-107133030 TGATTTTTGTATATGGTGTAAGG + Intergenic
995094186 5:108215866-108215888 TAATTTTTATATATGGTCTGAGG + Intronic
995099878 5:108287096-108287118 TGATTTTTATAGATGGTGTAAGG - Intronic
995112526 5:108443469-108443491 TGATTTTTGTATAAGGTGTGAGG - Intergenic
995351271 5:111178462-111178484 TGATTTTTATACAAGGTGAGAGG + Intergenic
995431139 5:112079094-112079116 TGATTTTTGTATATGGTGTAAGG + Intergenic
995571063 5:113482917-113482939 TAATTTTTGTAGATGGTGTGAGG + Intronic
995677206 5:114675711-114675733 TGATTTTTGCATAAGGTGTAAGG - Intergenic
995691776 5:114834411-114834433 TAATTTTTATATATGGTGTAAGG - Intergenic
995700071 5:114925623-114925645 TAATTTTTACATATGATGTATGG - Intergenic
995798963 5:115971483-115971505 TAATTTTTGCATATGGTGTGAGG + Intronic
995957859 5:117801350-117801372 TGATTTTTGTATATGGTGAGAGG - Intergenic
996053577 5:118959919-118959941 TGACTTTTATATATGGTGTAAGG - Intronic
996181191 5:120422378-120422400 TGATTTTTATATAAGGTGTAAGG + Intergenic
996195063 5:120594931-120594953 TGATTTTTGTATATGGTGTAAGG - Intronic
996247998 5:121288780-121288802 TGATTTTTGTATATGGTGTAAGG + Intergenic
996257343 5:121420818-121420840 TTATTTTTACTCATTGTGTGTGG + Intergenic
996570575 5:124929004-124929026 AGATTTTTACAGATGGTCACTGG + Intergenic
996806770 5:127464327-127464349 TGATTTTTTAATATGGTGTAAGG + Intronic
996850582 5:127947121-127947143 TGATTTTTGTATATGGTGTAAGG + Intergenic
997075212 5:130666403-130666425 TGATTTTTGTATATGGTGTAAGG - Intergenic
997076245 5:130681167-130681189 TGATTTTTGTACATGGTGTAAGG - Intergenic
997143077 5:131403804-131403826 TAATTTTTACATATGGTATAAGG - Intergenic
997143674 5:131409723-131409745 TGATTTTTTTATATGGTGAGAGG - Intergenic
997181814 5:131837036-131837058 TGATTTTTACACATGGTGTAAGG + Intronic
997421487 5:133770891-133770913 TAATTTTTATATATGGTGAGAGG + Intergenic
997515479 5:134485766-134485788 TGATTTTGAGGTATGGTGTGAGG - Intergenic
997589079 5:135062019-135062041 TGATTTTTAGAAATACTGTGTGG + Intronic
997658258 5:135571160-135571182 TGATCCTTAAAGAAGGTGTGGGG - Exonic
998275470 5:140748577-140748599 TGATTTTTGTATATGGTGTAAGG + Intergenic
998419196 5:141968461-141968483 TAATTTTTGCATATGGTGTGAGG + Intronic
998598949 5:143565001-143565023 TGATTTTTATAAATCGTGTGAGG + Intergenic
998692238 5:144599411-144599433 TTTTTTTTACAGATGGAGTCTGG + Intergenic
998700611 5:144694734-144694756 TAATTTTTGTATATGGTGTGAGG - Intergenic
999057210 5:148590995-148591017 TGATTTTTGTATATGGTGTAAGG + Intronic
999555475 5:152737732-152737754 TAATTTTTATACATAGTGTGAGG + Intergenic
999860634 5:155641939-155641961 TGAGTTTTACAGATGAAATGGGG + Intergenic
999939103 5:156521177-156521199 TGATTTTTGTATATGGTGTAAGG - Intronic
999946432 5:156601302-156601324 TGATTTTTATATATAGTGAGAGG + Intronic
1000097143 5:157981434-157981456 TGATTTTTGGATATAGTGTGAGG + Intergenic
1000142572 5:158420113-158420135 TAATTTTTGTATATGGTGTGAGG + Intergenic
1000165542 5:158644814-158644836 TGATTTTTTTAGATGGTATAGGG - Intergenic
1000224069 5:159241405-159241427 TGAATTTTGAATATGGTGTGAGG - Intergenic
1000468259 5:161607220-161607242 TGATTTTTATATAAGGTGTAAGG + Intronic
1000557151 5:162740354-162740376 TGATTTTTATATATGTTGTAAGG + Intergenic
1000698260 5:164416600-164416622 TTATTTTTATATATGGTGTAAGG + Intergenic
1000737577 5:164924499-164924521 TGATTTTTGTATATGGTGTAAGG + Intergenic
1000859959 5:166445694-166445716 TAATTTTTATATATGGTGTAAGG + Intergenic
1001046811 5:168379830-168379852 TTAGTTTTACACATGGTGTGAGG - Intronic
1001760188 5:174201431-174201453 TGATTTTTATATATGATGTAAGG + Intronic
1002323655 5:178390757-178390779 TAATTTCTACATATGGTGTGAGG - Intronic
1002413725 5:179105901-179105923 TGATTTTTATATAAGGTGTAAGG - Intergenic
1002681103 5:180965245-180965267 TTATTTTTATACATGGTGTGAGG - Intergenic
1002768792 6:269355-269377 TAATTTTTGCACATGGTGTTAGG + Intergenic
1002850277 6:988493-988515 CAATTTTTGCACATGGTGTGAGG + Intergenic
1003200231 6:3952926-3952948 TGATTTTTTTATATGGTGTAAGG + Intergenic
1003354190 6:5350651-5350673 TAATTTTTACACAAAGTGTGAGG - Intronic
1003451276 6:6235112-6235134 TCATTTTTACATATGGTGCAAGG - Intronic
1003617125 6:7665453-7665475 TAATTTTTGTATATGGTGTGGGG + Intergenic
1003800691 6:9663383-9663405 TGATTTTTTGTGATGGGGTGGGG + Intronic
1003830291 6:10002146-10002168 TGATTTTTGTATATGGTGTAAGG + Intronic
1003992973 6:11505846-11505868 TAATTTTTATATATGGTGTAAGG - Intergenic
1004164665 6:13245815-13245837 TGATTTTTGTATATGGTGTAAGG + Intronic
1004535694 6:16499165-16499187 TCATTTTTGTATATGGTGTGAGG + Intronic
1004968815 6:20885479-20885501 TGATTTTTGTACATGGTGTAAGG - Intronic
1005007557 6:21304346-21304368 TGATTTTTGCATATGGTGTAAGG - Intergenic
1005027000 6:21472715-21472737 TAATTTTTGTATATGGTGTGAGG + Intergenic
1005172186 6:23000593-23000615 TGATGTTTACATATGGTATAAGG - Intergenic
1005316730 6:24609911-24609933 TGATTTTTGTATATGTTGTGTGG - Intronic
1005433677 6:25785291-25785313 TGGTTTTTAAAAATAGTGTGAGG - Intronic
1005478439 6:26232366-26232388 TGATTTCTACAGATGGTTATGGG - Intergenic
1005658076 6:27964301-27964323 TAATTTTTATGTATGGTGTGAGG + Intergenic
1005768046 6:29034631-29034653 TGATTTTTGTATATGGTTTGAGG + Intergenic
1006064312 6:31452376-31452398 TGATTTATACATATGCTGTGAGG + Intergenic
1006217437 6:32456843-32456865 TGATTTTTGTATATGGTGTAAGG - Intergenic
1006251274 6:32788130-32788152 TGATTTTTGTATATGGTGTAAGG - Intergenic
1006570204 6:34996848-34996870 TAATTTTTATATATGGTGTGAGG + Intronic
1006684024 6:35816973-35816995 TAATTTTTGTATATGGTGTGAGG - Intronic
1006711913 6:36081356-36081378 TAATTTTTATAGATGATGTGAGG + Intronic
1006747505 6:36354420-36354442 TAATTTTTGGAGATGGTGTAAGG + Intergenic
1006931207 6:37689595-37689617 GGGCTTTTACAGCTGGTGTGGGG + Intronic
1007188203 6:39990772-39990794 TGATTTTTATATATGGTGTAGGG + Intergenic
1007216328 6:40242699-40242721 TAATTTTTCCATATGGTATGAGG + Intergenic
1007314424 6:40974432-40974454 TGATTTTTGTATATGGTGTAAGG + Intergenic
1007438578 6:41837430-41837452 TGATTCTTGTAGATGGTGTAAGG - Intronic
1007639270 6:43324408-43324430 TAATTTTTATGTATGGTGTGAGG - Intronic
1008083832 6:47223041-47223063 TGATTTCTGTATATGGTGTGGGG + Intergenic
1008189833 6:48440941-48440963 TGATTTTTGTATATGGTGAGAGG + Intergenic
1008217351 6:48809786-48809808 TGTTTTTTCCAGATGTTGTAAGG - Intergenic
1008255086 6:49288784-49288806 TGATTTTTGCATAAGGTGAGAGG + Intergenic
1008386251 6:50894390-50894412 TGATTTTTGTATAAGGTGTGAGG - Intergenic
1008551002 6:52630526-52630548 TAATTTTTATATATGGTATGAGG - Intergenic
1008688497 6:53950746-53950768 TGATTTTCGCATATGGTGTAAGG - Intronic
1008713072 6:54253621-54253643 TCATTTCTTCAGTTGGTGTGAGG + Intronic
1008734759 6:54529366-54529388 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1008948121 6:57122203-57122225 TAATTTTTATATATGGTGAGAGG - Intronic
1008972982 6:57391531-57391553 TGATTTTTATATATGGTATAAGG + Intronic
1008987009 6:57556610-57556632 TGATTTTTTTATATGGTGTAAGG - Intronic
1008989019 6:57581058-57581080 TGATTTTTAAAAATGTTTTGAGG - Intronic
1009161891 6:60293089-60293111 TGATTTTTATATATGGTATAAGG + Intergenic
1009174964 6:60449167-60449189 TGATTTTTTTATATGGTGTAAGG - Intergenic
1009177556 6:60479297-60479319 TGATTTTTAAAAATGTTTTGAGG - Intergenic
1009332084 6:62436048-62436070 TGAGTTTTATAGATGGTGTAAGG + Intergenic
1009362373 6:62830203-62830225 TGATTTTTGTATAAGGTGTGAGG - Intergenic
1009521633 6:64689801-64689823 TGATTTTTGCATAAGGTGTAAGG - Intronic
1009586880 6:65618720-65618742 TGATTTTTATATAAGGTGTAAGG + Intronic
1009690101 6:67019297-67019319 TGATTTTTATATAAGGTGTAAGG + Intergenic
1009764134 6:68047396-68047418 TGATTTTTGCATATGGTGTAAGG + Intergenic
1009891182 6:69685367-69685389 TGAATTTATCAGATGATGTGAGG + Intronic
1009915627 6:69992067-69992089 TGATTTTTATATATGGTGAAAGG + Intronic
1009996182 6:70897782-70897804 TAATTTTTATATATGGTATGAGG + Intronic
1010095838 6:72044211-72044233 TAATTTTTATATACGGTGTGAGG - Intronic
1010280724 6:74019824-74019846 TGATTTTTGTATATGGTGAGAGG - Intergenic
1010299676 6:74245125-74245147 TGATTTTTGTATATGGTGTAAGG + Intergenic
1010432834 6:75798149-75798171 TGATTTTTATATATGGTGAAAGG + Intronic
1010466302 6:76170603-76170625 TGATTTTTATATATAGTGTAAGG - Intergenic
1010488342 6:76443810-76443832 TTATTTTCATATATGGTGTGAGG + Intergenic
1010550732 6:77219879-77219901 TGATTTTTGCATATGGTGTAAGG - Intergenic
1010565386 6:77405747-77405769 TGTTTTTGACAGATGCTCTGTGG + Intergenic
1010648547 6:78423979-78424001 TAATTTTTGTATATGGTGTGAGG - Intergenic
1010708167 6:79139032-79139054 TGATTTTTGTAGATGGTGTAAGG - Intergenic
1010892907 6:81336357-81336379 TAATTTTTACATAAGGTGTAAGG + Intergenic
1010916053 6:81620521-81620543 TAATTTTTGTATATGGTGTGAGG + Intronic
1010988708 6:82455085-82455107 TGATTTTTGCATATGGTGAAAGG + Intergenic
1011031001 6:82922556-82922578 TGATTTTTATATAAGGTGTAAGG - Intronic
1011102109 6:83734169-83734191 TGATTTTTTTATATGGTGTAAGG + Intergenic
1011209029 6:84934774-84934796 TGATTTTTGTAGAGGGTGAGTGG - Intergenic
1011257108 6:85434001-85434023 TGATTTTTATATATTGTGTAAGG + Intergenic
1011312681 6:85997727-85997749 TAATTTTTACTGTTAGTGTGAGG - Intergenic
1011386600 6:86804756-86804778 TAATTTTTGCATATGGTGTAAGG + Intergenic
1011849422 6:91607375-91607397 TGTTTTTTACAGTTGGTTTTAGG + Intergenic
1011896735 6:92236994-92237016 TGATTTTTGTATATGGTGTAAGG + Intergenic
1012167502 6:95976243-95976265 TGATTTTCTCAGATGATGTGAGG - Intergenic
1012194744 6:96327265-96327287 TGATTTTTGTATATGGTGTAAGG - Intergenic
1012214633 6:96567154-96567176 TGATTTTTACATGTTATGTGAGG + Intronic
1012284770 6:97375473-97375495 TGATTTTTGTATATGGTGTAAGG + Intergenic
1012586595 6:100930861-100930883 TGATTTTCATATATGGTGTAAGG + Intergenic
1012619801 6:101328998-101329020 TAATTTTTATATATGGTTTGAGG + Intergenic
1012666137 6:101972712-101972734 TGATTTTTATATATGGTGAAAGG + Intronic
1012727285 6:102830685-102830707 TTATTTTTATATATGGTGTAAGG + Intergenic
1012729472 6:102863089-102863111 TGATTTTTATATATGGTGAAAGG - Intergenic
1012766414 6:103371860-103371882 TGATTTTTATATAAGGTGTAAGG - Intergenic
1013045808 6:106484014-106484036 TGATTTTTGCATATTGTGAGAGG + Intergenic
1013070565 6:106725341-106725363 TGATTTTTGTATATGGAGTGAGG - Intergenic
1013363098 6:109412710-109412732 TTATTTTTATATATGGTGAGAGG - Intronic
1013544802 6:111145560-111145582 TTATTTTTTTATATGGTGTGAGG - Intronic
1013617337 6:111857388-111857410 TGATGTTTCAAGATAGTGTGGGG - Intronic
1013726890 6:113109135-113109157 AGATTTTTGTATATGGTGTGAGG + Intergenic
1013760997 6:113517743-113517765 TGATTTCTACAGATATTATGAGG + Intergenic
1013905834 6:115218119-115218141 TGATTTTTTTATATGATGTGAGG - Intergenic
1013933403 6:115563876-115563898 TAATTTTTATATATGGTGAGAGG - Intergenic
1014244161 6:119049658-119049680 TGATTTTTGTATATGGTGTAAGG - Intronic
1014324138 6:119969967-119969989 TGACTTTTATATATGGAGTGAGG - Intergenic
1014364661 6:120524338-120524360 TGACTTTTATATATGGTGTAAGG + Intergenic
1014367005 6:120556324-120556346 GGATTATTACACATGGGGTGCGG + Intergenic
1014390971 6:120863832-120863854 TGATTTTAGCATATGGTGAGAGG - Intergenic
1014393139 6:120890184-120890206 TGATTTTTTTATATGGTGTCAGG + Intergenic
1014431822 6:121380172-121380194 TGATTTTTTTATATGGTGTAAGG + Intergenic
1014478661 6:121907508-121907530 TAATTTTTATATATGGTGAGAGG + Intergenic
1014906866 6:127040987-127041009 TGATTTTTGAATATGGTGTAAGG - Intergenic
1014960411 6:127676790-127676812 TGATTTTTGTATATGGTGTAAGG + Intergenic
1014961285 6:127688480-127688502 TGATTTTTGTATATGGTGTAAGG + Intergenic
1015192942 6:130491695-130491717 TGATTTTTTTATATGGTGTAAGG + Intergenic
1015501423 6:133937322-133937344 TGCTTCTTTCAGATGGTCTGTGG + Intergenic
1015766705 6:136725859-136725881 TGATTTTTGTATATGGTGTGAGG + Intronic
1015991865 6:138953167-138953189 TGATTTTTATATAGGGTGAGAGG - Intronic
1016084767 6:139899756-139899778 TGATTTTTGTACATGGTGTAAGG + Intergenic
1016088863 6:139950549-139950571 TGATTTTTGCATATGGTGTATGG - Intergenic
1016228767 6:141775547-141775569 TGATTTTTATATATTGTGTGAGG - Intergenic
1016423302 6:143907944-143907966 TGATTTTTGCAGATGGTGTAAGG + Intronic
1016432580 6:144003234-144003256 TGATTTTTGTGTATGGTGTGAGG - Intronic
1016698822 6:147030822-147030844 TGATTTTTGCATATGGTGTAAGG - Intergenic
1016766126 6:147796233-147796255 TGATTTTTATATAAGGTGTAAGG + Intergenic
1016778016 6:147926839-147926861 TGATTTTTTTATATGGTGTAAGG + Intergenic
1016867930 6:148787355-148787377 TGATTTTTGTATATGGTGTAAGG + Intronic
1017340680 6:153318111-153318133 TAATTTTTATATATGGTTTGAGG - Intergenic
1017420150 6:154264329-154264351 TAATTTTTATATCTGGTGTGAGG + Intronic
1017535648 6:155345609-155345631 TAATTTTTATATATGGTGTAAGG + Intergenic
1017601699 6:156090451-156090473 TGATTTTTGTATATGGTGTGAGG - Intergenic
1017818888 6:158034847-158034869 TGATTTTTGTATATGGTGTAAGG + Intronic
1017938434 6:159028070-159028092 TGATTTTTAAATATGATTTGTGG + Intergenic
1017994086 6:159516374-159516396 TGATTTTTGTATATGGTGTAAGG + Intergenic
1018348577 6:162929745-162929767 TGATTTTTGTAGATGGTGAGAGG + Intronic
1018349252 6:162939228-162939250 TGATTTTTGCATAAGGTGAGAGG - Intronic
1018622090 6:165739463-165739485 TGATTTTTGTATATGGTGTGAGG - Intronic
1019372832 7:671970-671992 ACATTTTTAGAGATGGTGTGTGG - Intronic
1019498288 7:1351641-1351663 TAATTTTTGCATGTGGTGTGAGG + Intergenic
1019561124 7:1658237-1658259 TGATGTTTGTATATGGTGTGAGG - Intergenic
1019585264 7:1798444-1798466 TTAATTTTACTTATGGTGTGAGG - Intergenic
1020065787 7:5187592-5187614 TAATTTTTGAATATGGTGTGAGG + Intergenic
1020331714 7:7024330-7024352 TGATTTTTGTATATGGTGTAAGG + Intergenic
1020425755 7:8064269-8064291 TTATTTTTGTATATGGTGTGAGG + Intronic
1020735571 7:11945167-11945189 TGATTTTTATATATGGTATAAGG + Intergenic
1020749589 7:12123627-12123649 TGATGTTAACAGATGGAATGGGG - Intergenic
1020851636 7:13360864-13360886 TAATTTGTATAAATGGTGTGAGG + Intergenic
1020860618 7:13488411-13488433 TGATTTTTGTACATGGTGTAAGG - Intergenic
1021007331 7:15414962-15414984 TAACTTTTACATATGGTATGAGG - Intronic
1021126446 7:16855543-16855565 TTATTTTGTCAGATTGTGTGTGG + Intergenic
1021224112 7:18008102-18008124 TGATTTTTATATAAGGTGTAAGG + Intergenic
1021515449 7:21479331-21479353 TAATTTTTACGTATGGTGTTAGG + Intronic
1021520199 7:21531931-21531953 TGATTTTTGTATATGGTGTAAGG + Intergenic
1021752860 7:23821819-23821841 TGATTTTTATATATGGTGAGAGG + Intronic
1021837586 7:24695603-24695625 TGATTTTTGTATATGGTGTAAGG + Intergenic
1021976489 7:26016040-26016062 TGATTTTTGTATATGGTGTAAGG + Intergenic
1022465162 7:30648798-30648820 TGATTCTGACAGCTGGGGTGTGG - Intergenic
1022878183 7:34557504-34557526 TGATTTTTATATATGGTGTAAGG - Intergenic
1022927996 7:35075531-35075553 TGATTTTTGTATATGGTGTAAGG - Intergenic
1023071388 7:36438145-36438167 TAATTTTTATAAATGGTATGAGG + Intronic
1023072667 7:36452200-36452222 TGTTTTATACAGGTAGTGTGCGG - Intronic
1023075443 7:36477506-36477528 TGATTTTTGTATATGGTGTAAGG + Intergenic
1023133007 7:37022081-37022103 TGATCTTTGCAGATGGTATGAGG - Intronic
1023236065 7:38089305-38089327 TAATTTTTGCATATGGTGTGAGG - Intergenic
1023243273 7:38172744-38172766 TGATTTTTGTAAATGGAGTGAGG + Intergenic
1023263765 7:38383763-38383785 TAATTGTTACAGATGATTTGTGG + Exonic
1023782789 7:43672991-43673013 TGATTTTTGTATATGGTGTAAGG - Intronic
1023932187 7:44712708-44712730 TGATTTTTGGAGATGGAGTCTGG + Intergenic
1024143152 7:46482187-46482209 TGATTTTTGTATAAGGTGTGAGG + Intergenic
1024165860 7:46729498-46729520 TGATTTTTGTATATGGTGTAAGG - Intronic
1024223695 7:47308112-47308134 TAATTTTTACACATGGTGTGAGG + Intronic
1024280744 7:47717273-47717295 AGATTTTTGTATATGGTGTGAGG - Intronic
1024456133 7:49609379-49609401 TGATTTTTGTATATAGTGTGAGG + Intergenic
1024593097 7:50907038-50907060 TGATTTTTGTATATGGTGTAAGG - Intergenic
1024853528 7:53749174-53749196 TGATTTTTGTACATGGTGTAAGG - Intergenic
1024885202 7:54133612-54133634 TGATTTTTGTATATGGTGTAAGG + Intergenic
1025565608 7:62430323-62430345 TGATTTTTATATAAGGTGTAAGG - Intergenic
1025572119 7:62587752-62587774 TGATTTTTGTAGAAGGTGTAAGG - Intergenic
1026546840 7:71330572-71330594 TTTTTTGTAGAGATGGTGTGGGG + Intronic
1026711708 7:72746951-72746973 TAATTTTTATATAAGGTGTGAGG + Intronic
1026713737 7:72767896-72767918 TAATTTTTATGAATGGTGTGAGG - Intronic
1026733727 7:72934647-72934669 TAATTTTTGTATATGGTGTGAGG + Intronic
1026784008 7:73289200-73289222 TAATTTTTGTATATGGTGTGAGG + Intergenic
1026878958 7:73895918-73895940 TAATTTTTATATATGGTGTGAGG + Intergenic
1027279655 7:76598221-76598243 TGATTTTTGTATATGGTGTCAGG - Intergenic
1027389808 7:77693630-77693652 ATATTTAGACAGATGGTGTGTGG + Intergenic
1027802886 7:82777732-82777754 TGATTTCTGCATATGGTGTAAGG - Intronic
1028277383 7:88873636-88873658 TGATTTTTATACAAGGTGTAAGG + Intronic
1028337692 7:89677840-89677862 TAATTTTTATATATGGTGTAAGG - Intergenic
1028374284 7:90130061-90130083 TGATTTTTGTATATGGTGTAAGG + Intergenic
1028514555 7:91662280-91662302 TGATTTTTGTATATGGTATGAGG + Intergenic
1028640286 7:93034747-93034769 TGATTTTTGTATATGGTGTAAGG - Intergenic
1028763594 7:94524014-94524036 CGATTTTACTAGATGGTGTGAGG - Intronic
1028864970 7:95698445-95698467 TTAATTTTACATAAGGTGTGAGG + Intergenic
1028967047 7:96813850-96813872 TAATTTTTAGATAAGGTGTGAGG - Intergenic
1029052884 7:97708086-97708108 TGATTTTTGTATATGGTGTAAGG - Intergenic
1029063926 7:97828809-97828831 TGATTTTTGTATATGGTGTAAGG - Intergenic
1029102623 7:98145514-98145536 TGATTTTTGAGGATGGTGTTAGG + Intronic
1029674060 7:102054324-102054346 TAATTTTTGCATATGGTGTGAGG + Intronic
1029738791 7:102479724-102479746 TTATTTTTGGAGATGGTGGGGGG + Intergenic
1029755916 7:102573380-102573402 TTATTTTTGGAGATGGTGGGGGG + Intronic
1029773858 7:102672453-102672475 TTATTTTTGGAGATGGTGGGGGG + Intergenic
1029795063 7:102885785-102885807 TAATTTTTATACATAGTGTGAGG + Intronic
1029808597 7:103022648-103022670 TGATTTTTGTATATGGTGTAAGG - Intronic
1029879433 7:103791557-103791579 TAATTTTTGTATATGGTGTGAGG - Intronic
1029888538 7:103900816-103900838 TGATTTTTATATAAGGTGTGAGG - Intronic
1029907766 7:104108865-104108887 TGATTTTTGTATATGGTGTAAGG + Intergenic
1029932683 7:104389841-104389863 TGATTTTTATATATGGTATGAGG - Intronic
1030012110 7:105180400-105180422 TGATTTTTGTATATGGTGTAAGG - Intronic
1030203913 7:106934044-106934066 TAATTTTTGCATATGGTATGAGG - Intergenic
1030374613 7:108740780-108740802 TGATTTTTGTATATGGTGTAAGG + Intergenic
1030378762 7:108786763-108786785 TGATTTTTGTATATGGTGTAAGG - Intergenic
1030485515 7:110162115-110162137 TGCTCTTTTCAGATGGTCTGAGG - Intergenic
1030805786 7:113916861-113916883 TGATTTTAACTGATGCTGTTAGG - Intronic
1030808257 7:113944105-113944127 TAATTTTTATATATGGTGGGAGG - Intronic
1030929214 7:115501269-115501291 TGATTTTTATATATGGTGAAAGG - Intergenic
1031183112 7:118441913-118441935 TGATTTTTGCATATGGTGTAAGG - Intergenic
1031189099 7:118523667-118523689 TAATTTTTATATATGGTGAGAGG + Intergenic
1031245429 7:119305479-119305501 TGATTTTTGTATATGGTGTAAGG + Intergenic
1031348727 7:120701782-120701804 TAATTTTTATATATGGTGTAAGG - Intronic
1031387827 7:121174388-121174410 TGATTTTTGTATATGGTGTAAGG + Intronic
1031418677 7:121523453-121523475 TGATTTTTGTAAATGGTATGAGG + Intergenic
1031429354 7:121647768-121647790 TGATTTTTGTAGATGGTGTAAGG + Intergenic
1031498702 7:122484476-122484498 TAATTTTTATATATGGTGAGAGG - Intronic
1031550734 7:123109137-123109159 TGATTTTTACATATGGTATAAGG + Intergenic
1031616385 7:123886734-123886756 AAATTTTTACATATGGTGTGAGG - Intergenic
1031651729 7:124299860-124299882 TGATTTTTTTATATGGTGTAAGG + Intergenic
1031680126 7:124662891-124662913 TGATTTGTTCAGGTGGTGTCAGG - Intergenic
1031746144 7:125500651-125500673 TGATCTTTATATATGGTGAGAGG + Intergenic
1032039967 7:128551315-128551337 TAATTATTAGAGATGTTGTGTGG + Intergenic
1032143914 7:129361169-129361191 GGCTTTATACAGCTGGTGTGAGG + Intronic
1032249794 7:130245842-130245864 TGATTTTTGTATATGGTGTAAGG - Intergenic
1032372014 7:131365609-131365631 TGATTTTTGTATATGATGTGAGG + Intronic
1032460920 7:132110382-132110404 TAATTTTTGCATATGTTGTGAGG - Intergenic
1032729755 7:134628327-134628349 TAATTTTTGTATATGGTGTGAGG + Intergenic
1032775189 7:135105399-135105421 TGATTTTTGTATATGGTGTAAGG + Intronic
1033296640 7:140144326-140144348 TAATTTTTGTATATGGTGTGTGG - Intronic
1033468369 7:141619513-141619535 TAATTTTTAGATATAGTGTGAGG - Intronic
1033723914 7:144092018-144092040 TGATCTTTGCATATGGTGTAAGG + Intergenic
1033835738 7:145309599-145309621 TAATTTTTGCATATGGTGTAAGG - Intergenic
1033954556 7:146830257-146830279 TGATTTTTGAGTATGGTGTGGGG + Intronic
1034173848 7:149084958-149084980 TGATTTTTGTATATGGTGTAAGG + Intronic
1034216596 7:149412139-149412161 TGATTTTTGTATATGGTGTAAGG - Intergenic
1034675434 7:152889625-152889647 TGATTTTTGTAGATGGAGGGAGG + Intergenic
1034847654 7:154462027-154462049 TGATTTTTGTATATGGTGAGAGG + Intronic
1034852591 7:154508957-154508979 TAATTTTTATCTATGGTGTGAGG - Intronic
1035229453 7:157455260-157455282 TAATTTTTATATATAGTGTGAGG + Intergenic
1035235020 7:157491290-157491312 TAATTTTTTTATATGGTGTGAGG + Intergenic
1035545147 8:475123-475145 TAATTTTTATATATGGTGTGAGG + Intergenic
1035594575 8:845825-845847 TGATGTTTGCATATGGTGTGAGG + Intergenic
1036076221 8:5504048-5504070 TGATTTTTGTATATGGTGTGAGG + Intergenic
1036195558 8:6710360-6710382 TGATTTGAACAGACGGTGGGGGG - Intronic
1036531356 8:9591063-9591085 TGATGTTTGGAGATGATGTGAGG + Intronic
1036574041 8:10008387-10008409 TGATTTTTGTACATGGTGTATGG + Intergenic
1036606820 8:10313982-10314004 TGATTTTTGTGTATGGTGTGAGG - Intronic
1036735231 8:11308208-11308230 TGATTTTTGAGTATGGTGTGAGG + Intronic
1036960379 8:13238910-13238932 TGACTCTGCCAGATGGTGTGGGG + Intronic
1037023333 8:14001188-14001210 TGATTTTTGTATATGGTGTAAGG + Intergenic
1037027904 8:14062027-14062049 TGATTTTTTTATATGGTGTAAGG + Intergenic
1037191505 8:16131648-16131670 TGATTTTTGTATATGGTGTAAGG + Intronic
1037358701 8:18050795-18050817 TGATTGTTACAGTTGCTGGGTGG - Intergenic
1037504728 8:19518466-19518488 TGATGTTTACATAGTGTGTGGGG - Intronic
1037626600 8:20612983-20613005 TGATTTTTGTATAAGGTGTGAGG + Intergenic
1037895942 8:22655443-22655465 TAATTTTTAAATATGGTGTGAGG + Intronic
1037989840 8:23313621-23313643 TGATTTTTGTAGAAGGTGTGAGG - Intronic
1038173295 8:25158552-25158574 TAATTTTTACATATGGTGTAAGG + Intergenic
1038317428 8:26499251-26499273 TGATTTTTGTATATGGTGTAAGG - Intronic
1038704633 8:29882021-29882043 TAATTTTCACAGATGGTTTCTGG - Intergenic
1038719974 8:30026939-30026961 TAATTTTTACATATGGTGTAAGG - Intergenic
1038829252 8:31038741-31038763 TTATTTTTGTATATGGTGTGAGG + Intronic
1038858321 8:31357520-31357542 TGATTTTTGTATATGGTGAGAGG + Intergenic
1038859476 8:31371328-31371350 TGATTTTTGTATATGGTGTAGGG + Intergenic
1038878396 8:31578467-31578489 TGATTTTTATAAATGGTTTAAGG + Intergenic
1038998066 8:32947292-32947314 TAATTTTTATATATGGTGTAAGG + Intergenic
1039084414 8:33765722-33765744 TAATTTTTGTATATGGTGTGAGG - Intergenic
1039640455 8:39214855-39214877 TGATTTTTGTATATGGTGAGAGG + Intronic
1039678614 8:39702650-39702672 TGATTTTTGTATATGGTGTAAGG + Intronic
1039690090 8:39853799-39853821 TAATTTTGGCATATGGTGTGAGG + Intergenic
1040714857 8:50238466-50238488 TGATTTTTGTATATGGTGTAAGG - Intronic
1040826754 8:51630259-51630281 TTATTTTTATATATGGTGTAAGG - Intronic
1040986510 8:53299933-53299955 TGATTTTTTTATATGGTGTAAGG + Intergenic
1041220198 8:55643265-55643287 TGATTTTTGCATATGGTGTTAGG + Intergenic
1041372495 8:57177339-57177361 TGATTTTTGCACATGGTGAAAGG - Intergenic
1041420044 8:57656894-57656916 TAATTTTTGCATATGCTGTGAGG + Intergenic
1041577759 8:59419369-59419391 TGATTTTTGTATATGGTGTAAGG - Intergenic
1041611807 8:59859002-59859024 TGATTTTTGTATATGTTGTGAGG - Intergenic
1041749782 8:61247950-61247972 TGATTTTTGTATATGGTGTAAGG + Intronic
1041764127 8:61399701-61399723 TGATTTTTGTATATGGTGTAAGG + Intronic
1041897005 8:62937043-62937065 TGATTTTTACATATCATGTGAGG + Intronic
1042162193 8:65908233-65908255 TAATTTTTGTATATGGTGTGAGG - Intergenic
1042293317 8:67192675-67192697 TAATTTTTGCACAGGGTGTGAGG + Intronic
1042433761 8:68740078-68740100 TAATTTTTGCAGATGGTATAAGG - Intronic
1042619679 8:70691579-70691601 TGATTTTTGTATATGGTGTAAGG + Intronic
1042670314 8:71255570-71255592 TAATTTTTGCATATGGTGTAAGG - Intronic
1042697626 8:71573521-71573543 TAATTTTTGTATATGGTGTGAGG + Intronic
1042976276 8:74473462-74473484 TGATTTTTGTATATGGTGTATGG + Intronic
1042981735 8:74537269-74537291 TAATTTTTATATATGGTGTAAGG + Intergenic
1043591490 8:81838605-81838627 TGATTTTTGTCCATGGTGTGAGG - Intronic
1043612041 8:82076844-82076866 TAATTTTTGTATATGGTGTGAGG + Intergenic
1043737890 8:83769523-83769545 TGATTTTTGTATATGGTGTAAGG - Intergenic
1043845511 8:85158750-85158772 TGATTTTTTTATATGGTGTCAGG - Intergenic
1043976177 8:86587504-86587526 TGATTTTTATATAAGGTGTAAGG + Intronic
1044193607 8:89348804-89348826 TGATTTTTGTATATGGTGTAAGG + Intergenic
1044272280 8:90260308-90260330 TAATTTTTGTATATGGTGTGAGG - Intergenic
1044297854 8:90549120-90549142 TGATCTTTACAGATGTAGTTAGG + Intergenic
1044318836 8:90779612-90779634 TGATTTTTCTAGATGGTGAGAGG + Intronic
1044550921 8:93511566-93511588 TGATTTTTGTAAATGGTGTAAGG + Intergenic
1044709529 8:95042959-95042981 TCATTTTTGTATATGGTGTGAGG - Intronic
1044914011 8:97092646-97092668 TGATTTTTATGTATGGTGAGAGG - Intronic
1045212976 8:100118215-100118237 TAATTTTTGCATATGGTGTAAGG - Intronic
1045283277 8:100768070-100768092 TGATTTTTATAGAGGGTGAGAGG - Intergenic
1045374937 8:101562541-101562563 TAATTTTTATATATGGTGTGAGG + Intronic
1045580385 8:103472482-103472504 TGACTTTTGTATATGGTGTGAGG + Intergenic
1045672243 8:104568244-104568266 TGTTTTTTGCATATGATGTGAGG - Intronic
1045676164 8:104610056-104610078 TGATTTTTGTATATGGTGTAAGG + Intronic
1045691617 8:104765138-104765160 TGATTTTTGCATATGGTATAAGG - Intronic
1045699160 8:104846783-104846805 TGATTTTTATATGTGGTGTAAGG + Intronic
1045789913 8:105971163-105971185 TGATTTTTATATATGATGTAAGG - Intergenic
1046015294 8:108597685-108597707 TGATTTTTGTATATGGTGTAAGG + Intergenic
1046139776 8:110075967-110075989 TGATTTTTCTATATGGTGTAAGG + Intergenic
1046179233 8:110621265-110621287 TAATTTTTGCATATGGTGTAAGG - Intergenic
1046187191 8:110736235-110736257 TAATTTTTATATATGGTGAGAGG + Intergenic
1046255286 8:111689004-111689026 TGATTTTTGTATATGGTGTAAGG + Intergenic
1046294923 8:112205178-112205200 TGATTTTTGTAGCTGGTGTGAGG - Intergenic
1046432296 8:114143860-114143882 TGATTTTTGTATATGGTATGAGG + Intergenic
1046434330 8:114167576-114167598 TGATTTTTGTATAAGGTGTGAGG - Intergenic
1046568774 8:115935626-115935648 TGATTTTAAAACATGGGGTGTGG + Intergenic
1046813067 8:118553506-118553528 TGATTTTTGTATAAGGTGTGAGG - Intronic
1047159180 8:122357553-122357575 TGATTTTTGTATATGGTGTAAGG + Intergenic
1047580483 8:126209260-126209282 TGATTTTTATTTATGGTGTAAGG + Intergenic
1047602629 8:126441476-126441498 TAATTTTTGTATATGGTGTGAGG - Intergenic
1047890662 8:129304405-129304427 TGATTTTTATGTATGGTGTGAGG + Intergenic
1047935960 8:129778432-129778454 TGATTTTTGAATATGGTGTAAGG - Intronic
1048102963 8:131375132-131375154 TAATTTTTACAAATGGTGATAGG - Intergenic
1048114058 8:131500606-131500628 TAATTTTTTCATATAGTGTGAGG - Intergenic
1048202646 8:132389017-132389039 TTATTTTTGTATATGGTGTGAGG - Intronic
1048464224 8:134650881-134650903 TAATTTTTGCATATGATGTGAGG - Intronic
1048545551 8:135383623-135383645 TGATTTTTGTATATGGTGTAAGG + Intergenic
1048640814 8:136358708-136358730 TGATTTTTATATATGGTGTAAGG + Intergenic
1048676299 8:136785773-136785795 TGATTTTTATATAAGGTGAGAGG - Intergenic
1048683039 8:136867836-136867858 TGATTTTTATATAGGGTGTAAGG - Intergenic
1048931574 8:139319468-139319490 TGAACTTTACTGATGGTGTTGGG + Intergenic
1049026396 8:139992877-139992899 TTATTTTTATATATGATGTGAGG - Intronic
1049115687 8:140685218-140685240 TGATTTTTGTATATGGTGTAAGG - Intronic
1049234189 8:141503082-141503104 TAAATTTTTCATATGGTGTGAGG - Intergenic
1049453074 8:142672870-142672892 TGATGTTTACATATGGCGTGGGG + Intronic
1049652760 8:143781488-143781510 TGATTTTTATGTATGGTGTAAGG + Intergenic
1049823518 8:144651896-144651918 TGATTTTTGTATATGGTGTAAGG - Intergenic
1050202257 9:3157632-3157654 TGATTTTTATATAGGGTGAGAGG + Intergenic
1050314347 9:4385915-4385937 TGATTGGTACAGATGGTAAGTGG - Intergenic
1050690080 9:8217272-8217294 TGATTTTTGCATATGGTGTGAGG + Intergenic
1050878316 9:10669130-10669152 TGATTTTTGCATATGGTGTAAGG + Intergenic
1050928145 9:11291884-11291906 TGATTTTTATATATAGTGTAAGG + Intergenic
1051241916 9:15066112-15066134 TAATTTTCATATATGGTGTGAGG - Intergenic
1051280314 9:15436349-15436371 TGATTTTTATATATGATGTAAGG + Intronic
1051326778 9:15980592-15980614 AGATCTGTACAGATGGTTTGGGG - Intronic
1051443003 9:17106943-17106965 TGATTTTTATATAGAGTGTGAGG + Intergenic
1051492803 9:17685614-17685636 TGATTTTTGTATAAGGTGTGAGG + Intronic
1051646375 9:19272630-19272652 TGATTTTTGCATATGGCGTGAGG - Intronic
1051656712 9:19388889-19388911 TGATTTTTATATATAGTGTAAGG - Intergenic
1051709494 9:19916074-19916096 TAATTTCTATAAATGGTGTGAGG + Intergenic
1052188315 9:25626242-25626264 TGATTTTTGTATATGGTGTAAGG + Intergenic
1052198412 9:25746610-25746632 TGATTGTTAGGAATGGTGTGAGG + Intergenic
1052475237 9:28951215-28951237 TAATTTTTGCAGAAGGTGTAAGG - Intergenic
1052479880 9:29010004-29010026 TGATTTTTGTATATGGTGTAAGG - Intergenic
1052764201 9:32623991-32624013 GAATTTTTGCATATGGTGTGAGG + Intergenic
1052779977 9:32771619-32771641 TGATTTTTGTATATGGTGTAAGG + Intergenic
1053492833 9:38523474-38523496 TGATAATGACAGCTGGTGTGGGG - Intergenic
1053558312 9:39161477-39161499 TGATTTTTGTATATGGTGTAAGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053822426 9:41981714-41981736 TGATTTTTGTATATGGTGTAAGG - Intronic
1053922173 9:43006275-43006297 TGATTTTTATATATGGTATAAGG - Intergenic
1054138803 9:61457449-61457471 TGATTTTTGTATATGGTGTAAGG + Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054425884 9:65066832-65066854 TGATTTTTGCATAAGGTGTAAGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054608150 9:67205664-67205686 TGATTTTTGTATATGGTGTAAGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054801183 9:69350242-69350264 TAATTTTTGCATATGGTGTGAGG + Intronic
1055250661 9:74300758-74300780 TAATTTTTGTGGATGGTGTGAGG - Intergenic
1055289594 9:74769111-74769133 TGCTTCTTAGAGATGCTGTGAGG - Intronic
1056010305 9:82322347-82322369 TGATTTTTGTATATGGTGTAAGG + Intergenic
1056053491 9:82795508-82795530 TAATTTTTGCATATGGTGTATGG - Intergenic
1056146579 9:83737173-83737195 TAATTTTTGCATATGGTGTAAGG + Intergenic
1056175624 9:84032157-84032179 TTATTTTTACAGATGTTTTCAGG + Intergenic
1056378799 9:86038766-86038788 TAATTATTGCATATGGTGTGAGG - Intronic
1056484973 9:87046716-87046738 TGATTTTTATATAAGGTGTAAGG - Intergenic
1056593778 9:87988081-87988103 TCATTTTTGTATATGGTGTGAGG + Intergenic
1056903643 9:90625485-90625507 TAATTCTTATATATGGTGTGAGG + Intronic
1057070658 9:92096661-92096683 TAATTTTTGTATATGGTGTGAGG - Intronic
1057124476 9:92605622-92605644 TAATTTTTATATATGGTGTGAGG - Intronic
1057269200 9:93638442-93638464 TTATTTTTGTATATGGTGTGAGG + Intronic
1057634573 9:96751773-96751795 TAATTTTTATATATGGTGTTGGG + Intergenic
1057727958 9:97582166-97582188 TGATTTTTGTAGAAGGTGTAAGG + Intronic
1058233499 9:102460993-102461015 TGATTTTTGTATATGGTGTAAGG - Intergenic
1058461124 9:105183897-105183919 TGATTTGTATATATGGTGTAAGG + Intergenic
1058782913 9:108356560-108356582 TGATATTTATATATGGTGTTAGG - Intergenic
1059036474 9:110759305-110759327 TGATTTTTGTATATGGTGTAAGG - Intronic
1059077079 9:111204888-111204910 TGATTTTTGTATATGGTGTAAGG - Intergenic
1059493300 9:114687983-114688005 TAATTTTTGTATATGGTGTGAGG + Intergenic
1059870788 9:118572247-118572269 TAACTTTTATATATGGTGTGAGG + Intergenic
1060172619 9:121474294-121474316 TGAGTTCTACAAATGGTCTGGGG - Intergenic
1060333344 9:122696806-122696828 TTATTTTTACAGATGGTATTAGG + Intergenic
1060702989 9:125775410-125775432 TAATTTTTGAATATGGTGTGAGG + Intronic
1060901844 9:127264886-127264908 TGATTTTTGCAGAAGGTTTGTGG + Exonic
1061616472 9:131783259-131783281 TGATTTTTGTGTATGGTGTGAGG + Intergenic
1062335618 9:136065030-136065052 TAATTTTTGTATATGGTGTGAGG - Intronic
1185768901 X:2749656-2749678 TGATTTCTTCTGATGCTGTGAGG + Intergenic
1185874190 X:3688683-3688705 TTTTTTTTATAGATGGTGTCTGG - Intronic
1185963392 X:4571798-4571820 TGATTTTTTTATATGGTGTAAGG - Intergenic
1186291990 X:8110370-8110392 TTATTTCTACATATGGTGTAAGG + Intergenic
1186372699 X:8963863-8963885 TGATTTTTGTATATGGTGTAAGG - Intergenic
1186593670 X:10957893-10957915 TGATTTTTGTATATGGTGTAAGG - Intergenic
1186935244 X:14442789-14442811 TGATTTTTGTGGTTGGTGTGGGG + Intergenic
1186937306 X:14464347-14464369 TGATTTTTATATAAGGTGAGAGG + Intergenic
1187107431 X:16258555-16258577 TGATTTTTGTAGGTGGTGTAAGG + Intergenic
1187129253 X:16485803-16485825 TAATTTTTCCATATAGTGTGAGG - Intergenic
1187226949 X:17382572-17382594 TGATATTTGCAAATGGTGTGAGG + Intronic
1187371481 X:18711527-18711549 TGATTTTCACGTATGGTGTGAGG + Intronic
1187584561 X:20645847-20645869 TCATTTTTGCATAAGGTGTGGGG - Intergenic
1187620714 X:21050523-21050545 TGATTTTTGCATGTGGTGTAAGG - Intergenic
1187756222 X:22529900-22529922 TGATTTTTGTATATGGTGTAAGG - Intergenic
1187778788 X:22794050-22794072 TAATTTTTATATATGGTGTAAGG - Intergenic
1187787454 X:22908029-22908051 TGATTTTTGTATATGGTGAGAGG + Intergenic
1188335694 X:28929750-28929772 TCATTTTTATGGTTGGTGTGAGG + Intronic
1188345061 X:29053734-29053756 TGATTTTTGTATATGGTGTAAGG + Intronic
1188635517 X:32425953-32425975 TGATTTTTGTATATGGTGTAAGG - Intronic
1188659066 X:32735740-32735762 TGATTTTTGTATAAGGTGTGAGG - Intronic
1188667416 X:32841670-32841692 TGATTATTGCATATGGTGTGAGG - Intronic
1188725086 X:33573049-33573071 TGATTTTTGTATATGGTGTAAGG + Intergenic
1188764822 X:34079059-34079081 TGATTTTTGCATAGGTTGTGAGG + Intergenic
1188794944 X:34451873-34451895 TAATTTTTGCATATGGTATGAGG - Intergenic
1188817823 X:34737203-34737225 TGATTTTTGTATATGGTGTAAGG + Intergenic
1188909241 X:35825160-35825182 TGATTTTTGTATATGGTGTAAGG + Intergenic
1188910176 X:35837756-35837778 TAATTTTTATATATGGTTTGAGG + Intergenic
1189313842 X:40039552-40039574 TAATTTTTGTAGACGGTGTGAGG + Intergenic
1189489949 X:41463141-41463163 TGAATTTTGCGTATGGTGTGAGG + Intronic
1189542198 X:42004073-42004095 TAATTTTTACATATGGTGAAAGG - Intergenic
1189605007 X:42667872-42667894 TGACTTTTACACATATTGTGTGG - Intergenic
1189722699 X:43936680-43936702 TGATTTTTGTATATGGTGTAAGG + Intergenic
1189771830 X:44434784-44434806 TGATTTTTGTATATGGTGTAAGG - Intergenic
1189806370 X:44739450-44739472 TGATTTTTGTATATGGTGTAAGG + Intergenic
1189862255 X:45285535-45285557 TAATTTTTGTATATGGTGTGAGG + Intergenic
1189866970 X:45340591-45340613 TGATTTTTGCATATGGTGTAAGG - Intergenic
1189871544 X:45388447-45388469 TGATTTTTGCATATAGTGTGAGG + Intergenic
1190145409 X:47886985-47887007 TAATTTTTGTATATGGTGTGAGG + Intronic
1190379096 X:49820977-49820999 TAATTTTTATATATGGTATGAGG + Intergenic
1190415355 X:50175387-50175409 TGATTTTTGTATAAGGTGTGAGG + Intergenic
1190431457 X:50381568-50381590 TAATTTTTACGTATAGTGTGAGG - Intronic
1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1190532031 X:51387917-51387939 TGATTTTTATATATGGTGTAAGG - Intergenic
1190585438 X:51935506-51935528 TGATTTTTGTATATGGTGTAAGG + Intergenic
1190823281 X:53994353-53994375 TGATTTTTGAAGATGTTCTGTGG + Intronic
1191023039 X:55883274-55883296 TGATTTTTGTATATGGTGTAAGG - Intergenic
1191024832 X:55902791-55902813 TGATTTTTGCATATAGTGTAAGG + Intergenic
1191139340 X:57099577-57099599 TGATTTTTATATAAGGTGTAAGG - Intergenic
1191185845 X:57610996-57611018 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1191598702 X:62977065-62977087 TGATTTTTGCATATGGTGAAAGG + Intergenic
1191614671 X:63156337-63156359 TAATTTTTGCATATGGTGTGGGG - Intergenic
1191621625 X:63222590-63222612 TAATTTTTGCATATGGTGTGGGG + Intergenic
1191657929 X:63618835-63618857 TGATTTTTATATAGGATGTGAGG - Intergenic
1191679594 X:63827245-63827267 TGATTTTTGTATATGGTGTAAGG + Intergenic
1191712714 X:64168117-64168139 TAATTTTTGTATATGGTGTGAGG + Intergenic
1191722365 X:64243866-64243888 TGATTTTTGTATATGGTGTATGG + Intergenic
1191831927 X:65424633-65424655 TGATTTTTGTATATGGTGTAAGG + Intronic
1191874118 X:65777034-65777056 TAATTTTTGCATATGGTGTGAGG + Intergenic
1191989136 X:67013875-67013897 TGATTTTTGAATATGGTGTAAGG - Intergenic
1192019344 X:67368554-67368576 TGATTTTTATATATGGTGTAAGG - Intergenic
1192068023 X:67906961-67906983 TGATTTTTATACATGGTGAGAGG - Intergenic
1192075860 X:67995708-67995730 TGATTTTTGTAGATGGTGTAAGG + Intergenic
1192187343 X:68958537-68958559 TAATTTTTGTATATGGTGTGAGG - Intergenic
1192188404 X:68974179-68974201 TAATTTTTATATATGGTGTAAGG - Intergenic
1192281299 X:69688918-69688940 TAATTTTTATACGTGGTGTGAGG + Intronic
1192565890 X:72163154-72163176 TGATTTATACATGTTGTGTGTGG - Intergenic
1192601738 X:72472013-72472035 TAATTTTTATATATGGTGCGAGG + Intronic
1192622362 X:72691074-72691096 TAATTTTTATATATGGTGTGAGG + Intronic
1192716303 X:73646054-73646076 TGATTTTTATGTATGGTATGAGG + Intronic
1192717168 X:73656467-73656489 TGATTTTTATATATGGTATAAGG + Intronic
1192728245 X:73775410-73775432 TAATTTTTGCATATGGTGTAAGG - Intergenic
1192837970 X:74822164-74822186 TAATTTTTAAGTATGGTGTGAGG - Intronic
1192892353 X:75404201-75404223 TGATTTTTGTATATGGTGTAAGG - Intronic
1192899095 X:75475387-75475409 TAATTTTTATATATGGTGTGAGG + Intronic
1192969255 X:76214142-76214164 TGATTTTTATATAAGGTGTAAGG - Intergenic
1193053907 X:77129334-77129356 TAATTTTTATATATGGTATGAGG - Intergenic
1193193814 X:78606042-78606064 TGATCATTACAGATTGTGTATGG + Intergenic
1193299512 X:79872783-79872805 TGATTTTTGTGTATGGTGTGAGG - Intergenic
1193310911 X:80009633-80009655 TGATTTTTGCATATGGTGTAAGG + Intergenic
1193315621 X:80061713-80061735 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1193316250 X:80068590-80068612 TGATTTTTGCATGTGGTGTAAGG + Intergenic
1193436760 X:81482902-81482924 TAATTTTTTTATATGGTGTGAGG - Intergenic
1193558872 X:82992725-82992747 TGATTTTTGTATATGGTGTAAGG + Intergenic
1193585970 X:83321692-83321714 TGATTTTTGTATATGGTGTAAGG - Intergenic
1193646016 X:84069388-84069410 TAATTTTTATATAAGGTGTGAGG - Intronic
1193752331 X:85361376-85361398 TGATTTTTGTATATGGTGTAAGG + Intronic
1193805550 X:85989323-85989345 TGATTTTTGTATATGGTGTAAGG - Intronic
1193934821 X:87604934-87604956 TGATTTTTGTATATGGTGAGAGG + Intronic
1193973410 X:88086654-88086676 TGATTTTTGTATATGGTGTAAGG + Intergenic
1194055124 X:89122445-89122467 TTATTTTTTTATATGGTGTGAGG + Intergenic
1194116488 X:89905275-89905297 TAATTTTTGGATATGGTGTGAGG - Intergenic
1194118479 X:89932660-89932682 TGATTTTTATAAAAGGTGTAAGG + Intergenic
1194190372 X:90827969-90827991 TGATTTTTCTATATGGTGTAAGG + Intergenic
1194197498 X:90913781-90913803 TAATTTTTGCATATGGTGTAAGG + Intergenic
1194235457 X:91378147-91378169 TGATTTTTGTACATGGTGTAAGG - Intergenic
1194271400 X:91820839-91820861 TGATTTTTATATAAGGTGTAAGG + Intronic
1194418676 X:93645589-93645611 TAATTTTTGCATAAGGTGTGAGG + Intergenic
1194587389 X:95752749-95752771 TGATTTTTGTATATGGTGTAAGG + Intergenic
1194632347 X:96300678-96300700 TGATTTTTGTATATGGTGTAAGG - Intergenic
1194780990 X:98025440-98025462 TAATTTTTATATATGGTGTAAGG + Intergenic
1194787232 X:98101177-98101199 TGATTTTTGTATATGGTGAGAGG + Intergenic
1194836072 X:98684620-98684642 TGATTTTTATATACGGTGTAAGG + Intergenic
1194851179 X:98871162-98871184 TGATTTTTATATATGATGTAGGG + Intergenic
1194918228 X:99730773-99730795 TAATTTTTATATATGGTGTAAGG - Intergenic
1194984312 X:100473620-100473642 TGATTTTTGTATATGGTGTAAGG - Intergenic
1195142997 X:101982464-101982486 TAATTTTTGCATATGATGTGTGG - Intergenic
1195143206 X:101985439-101985461 TGATTTTTTTATTTGGTGTGAGG - Intergenic
1195197031 X:102508550-102508572 TAATTTTTATATATAGTGTGAGG - Intergenic
1195339528 X:103892675-103892697 TGATTTTTATATAAGGTGTAAGG + Intergenic
1195400511 X:104456499-104456521 TGATTTTTGCATAAGGTGTAAGG - Intergenic
1195414680 X:104607213-104607235 TGATTTTTGCATAAGGTGTAAGG - Intronic
1195453499 X:105042051-105042073 TGATTTTTATATAAGGTGTAAGG - Intronic
1195489038 X:105444508-105444530 TGATTTTTGTATATGGTGAGAGG + Intronic
1195540938 X:106062178-106062200 TGATTTTTGTATATGGTGTAAGG + Intergenic
1195817155 X:108901638-108901660 TGATTTTTGGATATGGTGTGAGG - Intergenic
1196058318 X:111380335-111380357 TAATTTTTATATATGCTGTGAGG + Intronic
1196225422 X:113160082-113160104 TGATTTTTGTATATGGTGTAAGG + Intergenic
1196271590 X:113718224-113718246 TGAATTTTATATATGGTGTGAGG + Intergenic
1196332391 X:114487482-114487504 TGATTTTTGTATATGGTGTAAGG + Intergenic
1196388568 X:115186547-115186569 TGACTTTTACAGATCGTGACAGG + Intronic
1196476732 X:116095453-116095475 TGATTTTTATATATGGTGAGAGG + Intergenic
1196716501 X:118816360-118816382 TAATTTTTGTACATGGTGTGAGG + Intergenic
1196733002 X:118960275-118960297 TCATTTTTATATATAGTGTGGGG - Intergenic
1197123844 X:122921544-122921566 TAATTTTTGTATATGGTGTGAGG + Intergenic
1197141910 X:123126707-123126729 TAATTTTTGCATATGGTGTAAGG - Intergenic
1197142783 X:123134913-123134935 TAATTTTTGCATATGGTGTAAGG - Intergenic
1197242829 X:124137923-124137945 TGATTTTTGTATATGGTGTAAGG + Intronic
1197368423 X:125596184-125596206 TGATTTTTTTATATGGTGAGAGG - Intergenic
1197373722 X:125656917-125656939 TAATTTTTATATATGGTGAGTGG - Intergenic
1197563968 X:128058129-128058151 TAATTTCTACAGATGATGGGTGG - Intergenic
1197680729 X:129381520-129381542 TGATTTTTGTATATGGTGTAAGG - Intergenic
1197730865 X:129808537-129808559 TAATTTTTATATATGGTGTGAGG - Intronic
1197878267 X:131134874-131134896 TAAATTTTACATAAGGTGTGAGG + Intergenic
1197908148 X:131449180-131449202 TAATTTTTGTATATGGTGTGAGG + Intergenic
1197941042 X:131790311-131790333 TAATTTTTGCACATGATGTGAGG + Intergenic
1197960072 X:131994467-131994489 TGATTTTTATATAAGGTGTAAGG - Intergenic
1198255160 X:134917976-134917998 TGATTTTTGTATATGGTGAGAGG + Intergenic
1198269631 X:135043525-135043547 TGACTTTTGCATATGGTGTAAGG + Intergenic
1198316502 X:135472294-135472316 TGATTTTGACAGATAGGTTGTGG + Intergenic
1198419845 X:136460296-136460318 TAAGTTTTAAATATGGTGTGAGG + Intergenic
1198658468 X:138940597-138940619 TGATTTTTGTATATGGTGTAAGG + Intronic
1198794015 X:140376631-140376653 TGATTTTTGTATATGGTGTAAGG - Intergenic
1198796443 X:140401486-140401508 TGATTTTTGTATATGGTGTAAGG - Intergenic
1198813047 X:140555508-140555530 TGATTTTTGTATATGGTGAGAGG - Intergenic
1198886912 X:141349188-141349210 TAATTTTTATATATGGTGTAAGG - Intergenic
1198998401 X:142603644-142603666 TGATTTTTGTATATGGTGTAAGG + Intergenic
1199077664 X:143543236-143543258 TGATTTTTATATAAGGTGAGAGG - Intergenic
1199090239 X:143682784-143682806 TGATTTTTGTATATGGTGTAAGG + Intergenic
1199116172 X:143995809-143995831 TGATTTTTGCATATGGTGAAAGG - Intergenic
1199370154 X:147037727-147037749 TGATTTTTGTATATGGTGAGAGG + Intergenic
1199469221 X:148175574-148175596 TGATTTTTGCATATGGTGTAAGG + Intergenic
1199585317 X:149409291-149409313 TAATTTTTTTATATGGTGTGAGG + Intergenic
1199701637 X:150382147-150382169 TGATTTTTGTATAAGGTGTGAGG + Intronic
1199706682 X:150432584-150432606 TGATTTTTCTATATGGTGTAAGG + Intronic
1199739853 X:150724753-150724775 TGATTTTTGTATATGGTGTAAGG + Intronic
1199786155 X:151107097-151107119 TGATTTTTGTATATGGTGTCAGG + Intergenic
1199791464 X:151159448-151159470 TGATTTTTGCATATGGTGTAAGG + Intergenic
1199877084 X:151941783-151941805 TGATTTTTGAATATGGTGTAAGG + Intergenic
1199905992 X:152230781-152230803 TGATTTTTGCTTATGGTGTGAGG - Intronic
1200054660 X:153453746-153453768 TGATTTTTGCATATGGAGTGAGG - Intronic
1200469288 Y:3562458-3562480 TAATTTTTGGATATGGTGTGAGG - Intergenic
1200471361 Y:3590226-3590248 TGATTTTTATAAAAGGTGTAAGG + Intergenic
1200537027 Y:4410389-4410411 TGATTTTTCTATATGGTGTAAGG + Intergenic
1200607601 Y:5286069-5286091 AGATTTTTATATATGGTGAGAGG + Intronic
1200774212 Y:7155271-7155293 TGATTTTTGCATAAGGTGTAAGG + Intergenic
1200881178 Y:8212682-8212704 TGATTTTCATAAATGGTGTTAGG + Intergenic
1201959399 Y:19662043-19662065 TAATTTTTGCATAAGGTGTGAGG - Intergenic
1202202760 Y:22371767-22371789 TGATTTTTGTAAATGGTGTAAGG - Intronic
1202595860 Y:26539123-26539145 TGATTTTTGTATATGGTGAGAGG - Intergenic