ID: 922748322

View in Genome Browser
Species Human (GRCh38)
Location 1:228059562-228059584
Sequence GAGGAGTCCCGCCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 165}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748322_922748338 4 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748338 1:228059589-228059611 GGGGTGGGGCTCCTACCTGGGGG 0: 1
1: 0
2: 4
3: 27
4: 300
922748322_922748336 2 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259
922748322_922748337 3 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331
922748322_922748341 23 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
922748322_922748335 1 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350
922748322_922748342 27 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748342 1:228059612-228059634 CAGAACTCCTACCTGAAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 175
922748322_922748343 28 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748322_922748331 -10 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 40
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748322 Original CRISPR GAGGAGTCCCGCCCCCAGGG AGG (reversed) Exonic