ID: 922748322

View in Genome Browser
Species Human (GRCh38)
Location 1:228059562-228059584
Sequence GAGGAGTCCCGCCCCCAGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 165}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748322_922748341 23 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
922748322_922748335 1 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350
922748322_922748343 28 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748322_922748337 3 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331
922748322_922748342 27 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748342 1:228059612-228059634 CAGAACTCCTACCTGAAGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 175
922748322_922748331 -10 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 40
4: 346
922748322_922748336 2 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259
922748322_922748338 4 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748338 1:228059589-228059611 GGGGTGGGGCTCCTACCTGGGGG 0: 1
1: 0
2: 4
3: 27
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748322 Original CRISPR GAGGAGTCCCGCCCCCAGGG AGG (reversed) Exonic
900228479 1:1543887-1543909 GATGAGAAACGCCCCCAGGGTGG + Exonic
901082054 1:6589072-6589094 GTGGAGTCCCTGGCCCAGGGCGG + Exonic
901504413 1:9675595-9675617 GGGGAGTCCAGATCCCAGGGAGG + Intronic
908581869 1:65525405-65525427 GAGGACCCCTGCCCGCAGGGAGG - Intronic
912553682 1:110500676-110500698 GTGGAATCAAGCCCCCAGGGTGG - Intergenic
914718835 1:150272679-150272701 GGGGAGTTCTGCCCCCTGGGAGG + Intronic
915110890 1:153564146-153564168 GGGGAGCCCTGCCCTCAGGGGGG - Intronic
919820183 1:201467761-201467783 AAGGAGTCCGGCTCCCAAGGTGG - Intronic
920022518 1:202966860-202966882 GACCAGCCCCACCCCCAGGGAGG + Exonic
921430513 1:215059919-215059941 GAGGAGACCCTCCAGCAGGGAGG + Intronic
922748322 1:228059562-228059584 GAGGAGTCCCGCCCCCAGGGAGG - Exonic
922748332 1:228059581-228059603 TAGGAGCCCCACCCCCAGGGAGG - Exonic
922748339 1:228059600-228059622 TAGGAGTTCTGCCCCCAGGTAGG - Exonic
1064060024 10:12129592-12129614 GCCCAGCCCCGCCCCCAGGGCGG - Intergenic
1066370637 10:34815525-34815547 GAGGGGTCCCGCGCCCCCGGAGG - Intergenic
1069891412 10:71654776-71654798 GAGCAGGCGCACCCCCAGGGAGG + Intronic
1069959316 10:72070287-72070309 GAGGAGCCCAGGCCCCAGGTAGG - Intronic
1070290501 10:75110661-75110683 GAGGAGACCTTCCCTCAGGGTGG + Intronic
1070479695 10:76870199-76870221 CAGGAGCCCCGCCCGCAAGGTGG - Intronic
1070801405 10:79246485-79246507 GAGGAGTTCCTTCCCCATGGAGG - Intronic
1071366673 10:84907539-84907561 GAGCAATCCTGGCCCCAGGGTGG + Intergenic
1072809314 10:98446843-98446865 GAGGATCGCCGCCCCCAGAGGGG + Exonic
1076692363 10:132230378-132230400 GAGGAGTCCCGTGCCCGGGATGG + Intronic
1076844395 10:133061887-133061909 GAGGGGTTCCACCCCCAGGAGGG - Intergenic
1077295245 11:1823470-1823492 GAGCAGACCCACCCACAGGGTGG - Intergenic
1078594354 11:12674215-12674237 GCGGAGTCTCGCGCCCACGGGGG - Intergenic
1081812631 11:45922377-45922399 GAGGAGACGCGGCCCCAGAGCGG + Intronic
1083848972 11:65354593-65354615 TAGAAGCCCCGCCCCCAGAGGGG + Intergenic
1084182258 11:67452636-67452658 GAGGACTCCTACCCCCAAGGTGG - Exonic
1084385205 11:68839414-68839436 CAGCAGCCCCGCCCCCAGGCTGG + Intronic
1084656774 11:70524215-70524237 GAGCAGTCCCACCCCCTGGGGGG + Intronic
1084863223 11:72035908-72035930 GAGGAGTGCAGCCCCCCGGGTGG + Exonic
1084939911 11:72607004-72607026 GAGGGGACCCCCGCCCAGGGAGG - Intronic
1089290577 11:117435693-117435715 GAGCAGTGCCACCCCCAGTGTGG + Exonic
1089605680 11:119639991-119640013 GAAAAGCCCCGCCCCCAGAGGGG - Intronic
1089834185 11:121355726-121355748 GAAGGGTTGCGCCCCCAGGGAGG + Intergenic
1089920755 11:122207398-122207420 GAGGAGTACAGCCCCCAGTGTGG - Intergenic
1090486103 11:127113363-127113385 GAGGAGTCCTTTCCCCTGGGAGG + Intergenic
1092954884 12:13540798-13540820 AAGGAGAGCCGGCCCCAGGGAGG + Exonic
1097234057 12:57527942-57527964 GAGGAGCTCCCCCCCCAGGGAGG - Exonic
1097850368 12:64404892-64404914 GGGGAGTCCCGACGCCAGGGAGG + Intronic
1104444561 12:128823243-128823265 GAGGAATCCCGCCAGCAGGTGGG - Intronic
1104848044 12:131856914-131856936 GAGGAGCCCAGGCCCCATGGAGG - Intergenic
1106140377 13:27006496-27006518 GAGGAGGCCTGTCCCCAGGGGGG - Intergenic
1107451448 13:40513927-40513949 GAGGAGTCACGTCCAAAGGGAGG - Intergenic
1119382346 14:74237308-74237330 AAGGAGTCCAGCTCCCAGGGTGG + Intergenic
1120058098 14:79948927-79948949 GAGGAGTCCATCCCCAAGTGAGG - Intergenic
1121107270 14:91289227-91289249 GAGGACTCCAGCTGCCAGGGAGG + Exonic
1121410251 14:93744459-93744481 GAGCAGCCCCGCACCCAGGCTGG - Intronic
1121465349 14:94112000-94112022 GAGGAGGCCCGGGCCCAGAGGGG - Intronic
1122344682 14:101051222-101051244 GAGGTGTCCCGCCACCAGAGAGG + Intergenic
1122468119 14:101948228-101948250 CAGGAGTCCCGCCCCCTGAAGGG + Intergenic
1122878834 14:104680871-104680893 GAGGAGGCCTGCCATCAGGGTGG + Intergenic
1123636434 15:22362724-22362746 GAGGACTCCCTCCCCCATGCAGG + Intergenic
1132178436 15:99733452-99733474 CCCCAGTCCCGCCCCCAGGGGGG - Intronic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1133339432 16:5027149-5027171 GAGTTCTCCCGCCCTCAGGGTGG + Exonic
1134092979 16:11401393-11401415 GAGGAGACCAGCACCTAGGGAGG + Exonic
1134686315 16:16161307-16161329 GTGGAGTCCCTCCACCAAGGAGG - Intronic
1135398340 16:22148101-22148123 GAGGGGTCCCTCCTCCTGGGTGG - Intronic
1136237606 16:28924588-28924610 GAGGACTCCCGGTCCCAGGAAGG - Exonic
1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG + Intronic
1141161868 16:81634606-81634628 GAGGAGCCGCCTCCCCAGGGAGG + Intronic
1143088345 17:4433719-4433741 GAGTTGTCCAGTCCCCAGGGTGG + Exonic
1143167008 17:4901833-4901855 GCGAAGCCCCGCCCCGAGGGCGG + Exonic
1143759019 17:9087908-9087930 GGGGCATCCTGCCCCCAGGGAGG + Intronic
1144682103 17:17203131-17203153 CAGGAGTCCCGCCCCCAGTGTGG + Intronic
1148089803 17:45016500-45016522 GAGATGTGCGGCCCCCAGGGAGG - Intergenic
1148278781 17:46330895-46330917 CACGAGTCCAGCCCCAAGGGAGG + Exonic
1148300993 17:46548757-46548779 CGGGAGTCCAGCCCCAAGGGAGG + Exonic
1148716461 17:49719495-49719517 GAGGAGGCCCCCCCGCTGGGAGG - Intronic
1148895168 17:50835340-50835362 GAGGGGGCCCGGCCCCAAGGAGG + Intronic
1149995826 17:61405523-61405545 CAGGTGTCCGGCGCCCAGGGGGG - Exonic
1150497074 17:65616158-65616180 CAGAAGTCCCGTGCCCAGGGAGG - Intronic
1152045369 17:77931585-77931607 GGGGAGTCTGGCCCACAGGGAGG - Intergenic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152790117 17:82274112-82274134 GAGCAGGCCCGCGCCCTGGGAGG + Intergenic
1155035513 18:22021904-22021926 GAGGAGTCCAGCGCTCAGGTGGG + Intergenic
1156283472 18:35665571-35665593 GAGGATTTCAACCCCCAGGGGGG + Intronic
1158441235 18:57476082-57476104 GAGGACTCCAGACGCCAGGGTGG - Intronic
1160848982 19:1180638-1180660 GAGGAGCCCGGCGCCCAGGAGGG - Intronic
1160893989 19:1394430-1394452 GAGGAGCGCGGTCCCCAGGGAGG - Intronic
1160894026 19:1394546-1394568 GAGGAGCGCGGTCCCCAGGGAGG - Intronic
1160975268 19:1789844-1789866 GCGGGGTCCCGGCGCCAGGGAGG - Intronic
1161103048 19:2430745-2430767 GAGGAGACCCGCCAGGAGGGAGG + Exonic
1161766613 19:6212117-6212139 GAGGAGGCCGAGCCCCAGGGCGG + Intergenic
1161963591 19:7535742-7535764 GAAGAGTCGCGCCCCCGGGGAGG + Intronic
1162572238 19:11480333-11480355 GGGCAATCCCGCCTCCAGGGCGG + Intronic
1166214822 19:41327995-41328017 GAGCAGACACACCCCCAGGGTGG - Intronic
1166524781 19:43504210-43504232 GCGGAGACCCCCCCCCAAGGAGG + Intronic
1167055397 19:47108061-47108083 GAGGAGTCCCTCCACCAATGAGG + Intronic
1167121617 19:47520786-47520808 GTAGAGTCCCCGCCCCAGGGAGG + Exonic
1167136459 19:47619037-47619059 GAGAACTCCCGCACCCAGGCCGG - Intronic
1167411527 19:49347002-49347024 GAGGAGGCCAGCCCCCAGGGTGG - Intronic
926012066 2:9416401-9416423 GATGAGGCCCGCCCACACGGTGG - Intronic
927252773 2:21013084-21013106 GAGGAGAGCCTCCTCCAGGGAGG - Intronic
937993360 2:127675798-127675820 ACGCAGTCCCGCCCCCAGGGAGG + Intronic
938697572 2:133848517-133848539 GAGGAGAGCAGCTCCCAGGGAGG + Intergenic
941658787 2:168172949-168172971 CCTGAGTCCCGGCCCCAGGGAGG + Intronic
942103550 2:172610410-172610432 GAGGAGCCCCCCCACCATGGTGG - Intergenic
942231880 2:173867780-173867802 GAGGGGTCCGGCACCAAGGGAGG + Intergenic
945140966 2:206685710-206685732 CAGGAGCCCCGTGCCCAGGGTGG - Intronic
946350420 2:219147548-219147570 GAGAAGTGCCTCCCCCAGGATGG - Intronic
947533351 2:230926383-230926405 GGGCAGTCCTGCCCCCAGCGAGG + Intronic
948284722 2:236774604-236774626 GAGCTGTCTCTCCCCCAGGGTGG - Intergenic
948508312 2:238446200-238446222 GAGGAGAGCAGGCCCCAGGGAGG - Intronic
1173185998 20:40840753-40840775 GAGGAGTGCTGCACCCAGGTCGG - Intergenic
1174146545 20:48456190-48456212 GGGGAGCCCCGCCCCCAGTCTGG - Intergenic
1175502521 20:59460543-59460565 GAGGAGTGCCACCCCCTGTGTGG + Intergenic
1175951085 20:62583712-62583734 GACGAGGCCCACCCCCATGGTGG + Intergenic
1176100411 20:63361924-63361946 GAGGGGCCCCGCCCTCAGGTGGG + Intronic
1181390408 22:22576501-22576523 GAGGAGCCCAAGCCCCAGGGAGG - Intergenic
1183217549 22:36490586-36490608 TCGGAGCCCCGCCCCCAGTGTGG - Intronic
1183328826 22:37208586-37208608 GAGTAGTCCCTCCCCCTGGCTGG + Intronic
1183492097 22:38122196-38122218 GAGGACTCCCCACCCTAGGGTGG - Intronic
1184670879 22:46011853-46011875 GAGGCGGTCCTCCCCCAGGGAGG + Intergenic
1185130317 22:49035237-49035259 AAGAAGTCCCGGCCCCTGGGAGG + Intergenic
1185222531 22:49636241-49636263 GAGGAGACCCCCACCCAGGGTGG + Intronic
1185268571 22:49918075-49918097 GAGGAGCCCGGCCCCAAGTGAGG + Intronic
950704178 3:14769803-14769825 GAGGAGGCCAGTACCCAGGGTGG + Intronic
954084302 3:48231899-48231921 GAGGAGGCAGGCCCCCAAGGAGG - Intergenic
954390011 3:50263794-50263816 GAGGAGTCCCCACCCAGGGGAGG + Intergenic
955324689 3:58000870-58000892 CAGGAGTCCTCACCCCAGGGCGG - Intergenic
955467324 3:59250673-59250695 GATGAGGCCAGACCCCAGGGAGG - Intergenic
961008394 3:123420155-123420177 GAGGAGACCTGTCCCCAGGGTGG - Intronic
961459722 3:127042703-127042725 GAGGATGCCCACCCCAAGGGAGG - Intergenic
962679084 3:137780350-137780372 GAGGAGTCGGGCTCCCAGAGCGG - Intergenic
967387142 3:188922878-188922900 GATGAGTCTTGGCCCCAGGGTGG - Intergenic
968356666 3:198113619-198113641 GCGGTCTCCCGCCTCCAGGGCGG + Intergenic
968423409 4:504327-504349 GAGAAGCCCCACACCCAGGGAGG - Intronic
968750980 4:2388935-2388957 GAAGAGTCCTGCCCACAGAGAGG + Intronic
969701530 4:8770353-8770375 GGGCAGTCCCGCCGCCAGGAGGG + Intergenic
969701536 4:8770373-8770395 GGGCAGTCCCGCCGCCAGGATGG + Intergenic
970226236 4:13860240-13860262 GAGGAGTGCTGCCCCCAAGAGGG + Intergenic
975238799 4:72032232-72032254 GAGGGGTCGCGCCCCCAAGCGGG - Intronic
982391436 4:154868574-154868596 GAGGAGGCCCACCCACAGTGGGG - Intergenic
985551413 5:535255-535277 GAGGGGTCCTGCCCCTGGGGAGG - Intergenic
985728099 5:1526192-1526214 GAGGAGTCCCTCTCCCAGAGGGG + Intergenic
985828758 5:2212883-2212905 CAGGTGTCCAGCCCCCAGCGAGG + Intergenic
1001045138 5:168365646-168365668 GAGGCTTCCAGCCCCCGGGGTGG + Intronic
1001116837 5:168947391-168947413 GTGGAGTCCAGGCACCAGGGCGG - Intronic
1002461472 5:179375957-179375979 GAGGACTCCAGCCCCTGGGGAGG + Intergenic
1005811319 6:29518560-29518582 GAGGATTCCGGACCCCAGTGGGG + Intergenic
1006342002 6:33452255-33452277 GAGGTGCCACACCCCCAGGGTGG - Exonic
1010378592 6:75202742-75202764 GAGCAGGGCCGCGCCCAGGGCGG + Exonic
1012373332 6:98531895-98531917 GGGGAGACCCACCCACAGGGTGG - Intergenic
1015935756 6:138404580-138404602 GAGGACGCCGGCCCCCAGGTAGG + Exonic
1016460788 6:144278633-144278655 GAGGAGTCCCGGAAGCAGGGAGG + Intergenic
1017889968 6:158629825-158629847 CAGCAGTCCAGACCCCAGGGTGG - Intronic
1018799542 6:167211227-167211249 AAGAAGGCCCGCCCCCAGGAAGG - Intergenic
1019452703 7:1108023-1108045 CTGGAGTCCCGCACCCCGGGGGG + Intronic
1019452721 7:1108071-1108093 CTGGAGTCCCGCACCCCGGGGGG + Intronic
1019452739 7:1108119-1108141 CTGGAGTCCCGCACCCCGGGGGG + Intronic
1019452757 7:1108167-1108189 CTGGAGTCCCGCACCCCGGGGGG + Intronic
1019452775 7:1108215-1108237 CTGGAGTCCCGCACCCCGGGGGG + Intronic
1019452792 7:1108264-1108286 CTGGAGTCCCGCACCCCGGGGGG + Intronic
1019452808 7:1108312-1108334 CTGGAGTCCCGCGCCCCGGGAGG + Intronic
1019493455 7:1325581-1325603 GGAGAGTGCGGCCCCCAGGGAGG + Intergenic
1019493469 7:1325609-1325631 GGGGAGTGCGGCCCCCAGGGAGG + Intergenic
1020279307 7:6642387-6642409 GTGGAGGCTCGCTCCCAGGGAGG + Exonic
1021936039 7:25632319-25632341 GGGGTGTCCTGCCCCCAGTGGGG - Intergenic
1023839465 7:44088268-44088290 AAGGTGTCCCGCCACGAGGGTGG - Intergenic
1026441351 7:70446991-70447013 GATGACTTCAGCCCCCAGGGTGG + Intronic
1032476396 7:132214215-132214237 GAACAGTCCAGCCCCCAGGCAGG - Intronic
1034552187 7:151828130-151828152 GGGGAGCCCCGACCCCAGGCTGG + Intronic
1037990308 8:23316984-23317006 GACGTGGCCTGCCCCCAGGGCGG - Exonic
1040112133 8:43571252-43571274 GAGGAGACACGCACCCAGGGTGG + Intergenic
1040550702 8:48435019-48435041 GAGGGGTCCAGGGCCCAGGGTGG + Intergenic
1044917359 8:97129254-97129276 GGGGAGTCCTGGCCCCAGAGTGG - Intronic
1049273721 8:141709335-141709357 GCAGCGTCCCACCCCCAGGGAGG + Intergenic
1049342578 8:142121087-142121109 GAGGAGACCCACACGCAGGGAGG - Intergenic
1052857880 9:33418289-33418311 GTGGAGCCTCGGCCCCAGGGTGG - Intergenic
1060208043 9:121694021-121694043 GAGGCTTCCCACCCCCAGGGAGG - Intronic
1060414227 9:123419361-123419383 GAGGAGGCCTGGCCCCAGAGGGG + Intronic
1060508311 9:124214734-124214756 GGGGAGGCCCTCCCCCAGGGAGG - Intergenic
1060821221 9:126662598-126662620 AAGGAGGCCTGCTCCCAGGGTGG + Intronic
1060968544 9:127724902-127724924 GTGGGCTCCCGCCCCCACGGTGG + Intronic
1061573782 9:131493750-131493772 GGGGAGTGCTGTCCCCAGGGTGG + Intronic
1061684605 9:132264807-132264829 GAGGGGTCCAGACCCCAGGGTGG - Exonic
1061955803 9:133960764-133960786 CAGGAGTCCCGAACCCAGAGAGG + Intronic
1062146511 9:134992435-134992457 GAAGAGGCCCCCCCCCACGGAGG + Intergenic
1062229735 9:135475108-135475130 GTGGAGACCCGCCACCAGGTGGG - Intergenic
1062304303 9:135894309-135894331 GAGGAGTCCCGTGACCAGTGGGG - Intronic
1062442287 9:136576203-136576225 GTGGAGTCCGGGCCCCAGGCTGG - Intergenic
1189391519 X:40580764-40580786 GGGCAGTCCCGCCCCCCGGTCGG - Intergenic
1196137284 X:112223690-112223712 GTGGAGTCCCTCCTACAGGGAGG - Intergenic
1200077343 X:153557675-153557697 GAGGAGTCCCTGTCCCATGGAGG - Intronic