ID: 922748331

View in Genome Browser
Species Human (GRCh38)
Location 1:228059575-228059597
Sequence GGGACTCCTCCCTGGGGGTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 346}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748313_922748331 12 Left 922748313 1:228059540-228059562 CCCACCTAAACGGGGCAGTACTC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 40
4: 346
922748309_922748331 30 Left 922748309 1:228059522-228059544 CCTGGGTGGAGCAGGACTCCCAC 0: 1
1: 0
2: 1
3: 26
4: 252
Right 922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 40
4: 346
922748322_922748331 -10 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 40
4: 346
922748314_922748331 11 Left 922748314 1:228059541-228059563 CCACCTAAACGGGGCAGTACTCC 0: 1
1: 0
2: 0
3: 4
4: 30
Right 922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 40
4: 346
922748315_922748331 8 Left 922748315 1:228059544-228059566 CCTAAACGGGGCAGTACTCCTCC 0: 1
1: 0
2: 0
3: 4
4: 33
Right 922748331 1:228059575-228059597 GGGACTCCTCCCTGGGGGTGGGG 0: 1
1: 0
2: 4
3: 40
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748331 Original CRISPR GGGACTCCTCCCTGGGGGTG GGG Exonic